Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 14 de 14
Filtrar
Más filtros

Bases de datos
Tipo del documento
Intervalo de año de publicación
1.
Psychol Med ; 48(3): 437-450, 2018 02.
Artículo en Inglés | MEDLINE | ID: mdl-28720167

RESUMEN

BACKGROUND: Research on post-traumatic stress disorder (PTSD) course finds a substantial proportion of cases remit within 6 months, a majority within 2 years, and a substantial minority persists for many years. Results are inconsistent about pre-trauma predictors. METHODS: The WHO World Mental Health surveys assessed lifetime DSM-IV PTSD presence-course after one randomly-selected trauma, allowing retrospective estimates of PTSD duration. Prior traumas, childhood adversities (CAs), and other lifetime DSM-IV mental disorders were examined as predictors using discrete-time person-month survival analysis among the 1575 respondents with lifetime PTSD. RESULTS: 20%, 27%, and 50% of cases recovered within 3, 6, and 24 months and 77% within 10 years (the longest duration allowing stable estimates). Time-related recall bias was found largely for recoveries after 24 months. Recovery was weakly related to most trauma types other than very low [odds-ratio (OR) 0.2-0.3] early-recovery (within 24 months) associated with purposefully injuring/torturing/killing and witnessing atrocities and very low later-recovery (25+ months) associated with being kidnapped. The significant ORs for prior traumas, CAs, and mental disorders were generally inconsistent between early- and later-recovery models. Cross-validated versions of final models nonetheless discriminated significantly between the 50% of respondents with highest and lowest predicted probabilities of both early-recovery (66-55% v. 43%) and later-recovery (75-68% v. 39%). CONCLUSIONS: We found PTSD recovery trajectories similar to those in previous studies. The weak associations of pre-trauma factors with recovery, also consistent with previous studies, presumably are due to stronger influences of post-trauma factors.


Asunto(s)
Encuestas Epidemiológicas/estadística & datos numéricos , Recuperación de la Función , Trastornos por Estrés Postraumático/rehabilitación , Heridas y Lesiones/psicología , Adolescente , Adulto , Niño , Preescolar , Manual Diagnóstico y Estadístico de los Trastornos Mentales , Femenino , Humanos , Lactante , Recién Nacido , Internacionalidad , Acontecimientos que Cambian la Vida , Modelos Logísticos , Masculino , Persona de Mediana Edad , Estudios Retrospectivos , Factores de Tiempo , Organización Mundial de la Salud , Adulto Joven
2.
Acta Psychiatr Scand ; 136(1): 74-84, 2017 07.
Artículo en Inglés | MEDLINE | ID: mdl-28542726

RESUMEN

OBJECTIVE: While psychotic experiences (PEs) are known to be associated with a range of mental and general medical disorders, little is known about the association between PEs and measures of disability. We aimed to investigate this question using the World Mental Health surveys. METHOD: Lifetime occurrences of six types of PEs were assessed along with 21 mental disorders and 14 general medical conditions. Disability was assessed with a modified version of the WHO Disability Assessment Schedule. Descriptive statistics and logistic regression models were used to investigate the association between PEs and high disability scores (top quartile) with various adjustments. RESULTS: Respondents with PEs were more likely to have top quartile scores on global disability than respondents without PEs (19.1% vs. 7.5%; χ2  = 190.1, P < 0.001) as well as greater likelihood of cognitive, social, and role impairment. Relationships persisted in each adjusted model. A significant dose-response relationship was also found for the PE type measures with most of these outcomes. CONCLUSIONS: Psychotic experiences are associated with disability measures with a dose-response relationship. These results are consistent with the view that PEs are associated with disability regardless of the presence of comorbid mental or general medical disorders.


Asunto(s)
Personas con Discapacidad/estadística & datos numéricos , Salud Global/estadística & datos numéricos , Salud Mental/estadística & datos numéricos , Trastornos Psicóticos/epidemiología , Adulto , Encuestas Epidemiológicas/estadística & datos numéricos , Humanos , Organización Mundial de la Salud
3.
Psychol Med ; 44(8): 1779-92, 2014 Jun.
Artículo en Inglés | MEDLINE | ID: mdl-24103255

RESUMEN

BACKGROUND: Although DSM-IV attention deficit hyperactivity disorder (ADHD) is known to be associated with numerous adverse outcomes, uncertainties exist about how much these associations are mediated temporally by secondary co-morbid disorders. METHOD: The US National Comorbidity Survey Replication Adolescent Supplement (NCS-A), a national survey of adolescents aged 13-17 years (n = 6483 adolescent-parent pairs), assessed DSM-IV disorders with the World Health Organization (WHO) Composite International Diagnostic Interview (CIDI). Statistical decomposition was used to compare direct effects of ADHD with indirect effects of ADHD through temporally secondary mental disorders (anxiety, mood, disruptive behavior, substance disorders) in predicting poor educational performance (suspension, repeating a grade, below-average grades), suicidality (ideation, plans, attempts) and parent perceptions of adolescent functioning (physical and mental health, interference with role functioning and distress due to emotional problems). RESULTS: ADHD had significant gross associations with all outcomes. Direct effects of ADHD explained most (51.9-67.6%) of these associations with repeating a grade in school, perceived physical and mental health (only girls), interference with role functioning and distress, and significant components (34.5-44.6%) of the associations with school suspension and perceived mental health (only boys). Indirect effects of ADHD on educational outcomes were predominantly through disruptive behavior disorders (26.9-52.5%) whereas indirect effects on suicidality were predominantly through mood disorders (42.8-59.1%). Indirect effects on most other outcomes were through both mood (19.8-31.2%) and disruptive behavior (20.1-24.5%) disorders, with anxiety and substance disorders less consistently important. Most associations were comparable for girls and boys. CONCLUSIONS: Interventions aimed at reducing the adverse effects of ADHD might profitably target prevention or treatment of temporally secondary co-morbid disorders.


Asunto(s)
Trastorno por Déficit de Atención con Hiperactividad/epidemiología , Comorbilidad , Trastornos Mentales/epidemiología , Adolescente , Trastorno por Déficit de Atención con Hiperactividad/complicaciones , Manual Diagnóstico y Estadístico de los Trastornos Mentales , Femenino , Humanos , Masculino , Prevalencia , Suicidio/estadística & datos numéricos , Estados Unidos/epidemiología
4.
Psychol Med ; 42(10): 2109-18, 2012 Oct.
Artículo en Inglés | MEDLINE | ID: mdl-22370047

RESUMEN

BACKGROUND: Suicide rates increase following periods of war; however, the mechanism through which this occurs is not known. The aim of this paper is to shed some light on the associations of war exposure, mental disorders, and subsequent suicidal behavior. METHOD: A national sample of Lebanese adults was administered the Composite International Diagnostic Interview to collect data on lifetime prevalence and age of onset of suicide ideation, plan, and attempt, and mental disorders, in addition to information about exposure to stressors associated with the 1975-1989 Lebanon war. RESULTS: The onset of suicide ideation, plan, and attempt was associated with female gender, younger age, post-war period, major depression, impulse-control disorders, and social phobia. The effect of post-war period on each type of suicide outcome was largely explained by the post-war onset of mental disorders. Finally, the conjunction of having a prior impulse-control disorder and either being a civilian in a terror region or witnessing war-related stressors was associated with especially high risk of suicide attempt. CONCLUSIONS: The association of war with increased risk of suicidality appears to be partially explained by the emergence of mental disorders in the context of war. Exposure to war may exacerbate disinhibition among those who have prior impulse-control disorders, thus magnifying the association of mental disorders with suicidality.


Asunto(s)
Trastornos Mentales/epidemiología , Trastornos Mentales/psicología , Suicidio/psicología , Suicidio/estadística & datos numéricos , Guerra , Adolescente , Adulto , Distribución por Edad , Edad de Inicio , Anciano , Femenino , Encuestas Epidemiológicas/métodos , Encuestas Epidemiológicas/estadística & datos numéricos , Humanos , Entrevista Psicológica/métodos , Líbano/epidemiología , Masculino , Persona de Mediana Edad , Prevalencia , Factores de Riesgo , Distribución por Sexo , Ideación Suicida , Intento de Suicidio/psicología , Intento de Suicidio/estadística & datos numéricos , Adulto Joven
5.
J Intellect Disabil Res ; 56(4): 415-20, 2012 Apr.
Artículo en Inglés | MEDLINE | ID: mdl-21954873

RESUMEN

BACKGROUND: Rett syndrome (RTT), an X-linked, dominant, neurodevelopment disorder represents 10% of female subjects with profound intellectual disability. Mutations in the MECP2 gene are responsible for up to 95% of the classical RTT cases, and nearly 500 different mutations distributed throughout the gene have been reported. METHODS: We report here the molecular study of two isoforms, MECP2_e1 and MECP2_e2, in 45 Lebanese girls presenting developmental delay and at least one of the following features: microcephaly, neurodegeneration, abnormal behaviour, stereotypical hand movements, teeth grinding and difficulty in walking. Mutation screening was performed by denaturating high-performance liquid chromatography combined with direct sequencing. RESULTS: Sixteen variants were noted, of which 14 have been previously reported: five suspected polymorphisms and nine mutations. Two variants were novel mutations in exon 4: c.1093_1095delGAG (p.E365del) and c.1164_1184delACCTCCACCTGAGCCCGAGAGinsCTGAGCCCCAGGACTTGAGCA (p.P388PfsX389). The deletion was found in an 8-year-old girl with typical clinical features of RTT. The indel was found in a 6-year-old girl with a very mild phenotype. CONCLUSION: Genotype/phenotype correlation is discussed and the importance of a molecular study of MECP2 gene in patients with very mild features or a regression after the age of 2 is raised.


Asunto(s)
Alelos , Pruebas Genéticas , Genotipo , Mutación INDEL/genética , Proteína 2 de Unión a Metil-CpG/genética , Fenotipo , Síndrome de Rett/genética , Adolescente , Niño , Preescolar , Deleción Cromosómica , Exones/genética , Femenino , Humanos , Discapacidad Intelectual/diagnóstico , Discapacidad Intelectual/genética , Líbano , Polimorfismo Genético/genética , Síndrome de Rett/diagnóstico
6.
Epidemiol Psychiatr Sci ; 31: e41, 2022 Jun 15.
Artículo en Inglés | MEDLINE | ID: mdl-35702899

RESUMEN

AIMS: Children's responses to war and displacement are varied; many struggle, while others appear resilient. However, research into these outcomes disproportionately focuses on cross-sectional data in high-income countries. We aimed to (1) investigate change in resilience across two timepoints in a highly vulnerable sample of Syrian refugee children in Lebanon, and (2) explore predictors of their mental health problems across time. METHODS: In total, 982 Syrian child-caregiver dyads living in refugee settlements in Lebanon completed questionnaires via interview at baseline and follow-up one year later. We categorised children into groups based on their risk for mental health problems across both timepoints (stable high risk/SHR, deteriorating, improving, stable low risk) according to locally validated cut-offs on measures of post-traumatic stress disorder (PTSD), depression and behavioural problems. Analyses of covariance identified how the groups differed on a range of individual and socio-environmental predictors, followed up by cross-lagged panel models (CLPMs) to investigate the directionality of the relationships between significantly related predictors and symptoms. RESULTS: The sample showed a meaningful amount of change in mental health symptoms from baseline to follow-up. Over half (56.3%) of children met SHR criteria and 10.3% deteriorated over time, but almost one-quarter (24.2%) showed meaningful improvement, and 9.2% were consistently at low risk for mental health problems at both timepoints. Several predictors differentiated the groups, particularly social measures. According to CLPMs, maternal acceptance (ß = -0.07) predicted child mental health symptoms over time. Self-esteem (ß = -0.08), maternal psychological control (ß = 0.10), child maltreatment (ß = 0.09) and caregiver depression (ß = 0.08) predicted child symptoms and vice versa (ßse = -0.11, ßb = 0.07, ßmpc = 0.08, ßcm = 0.1, ßcd = 0.11). Finally, child symptoms predicted loneliness (ß = 0.12), bullying (ß = 0.07), perceived social support (ß = -0.12), parent-child conflict (ß = 0.13), caregiver PTSD (ß = 0.07), caregiver anxiety (ß = 0.08) and the perceived refugee environment (ß = -0.09). CONCLUSIONS: Our results show risk and resilience are dynamic, and the family environment plays a key role in children's response to war and displacement. Conversely, children also have a significant impact on the family environment and caregiver's own mental health. Interventions to promote resilience in refugee children should therefore consider family-wide mechanisms.


Asunto(s)
Refugiados , Trastornos por Estrés Postraumático , Estudios de Cohortes , Estudios Transversales , Humanos , Líbano/epidemiología , Refugiados/psicología , Trastornos por Estrés Postraumático/psicología , Siria
7.
Acta Psychiatr Scand ; 124(6): 474-86, 2011 Dec.
Artículo en Inglés | MEDLINE | ID: mdl-21534936

RESUMEN

OBJECTIVE: Estimate predictive associations of mental disorders with marriage and divorce in a cross-national sample. METHOD: Population surveys of mental disorders included assessment of age at first marriage in 19 countries (n = 46,128) and age at first divorce in a subset of 12 countries (n = 30,729). Associations between mental disorders and subsequent marriage and divorce were estimated in discrete time survival models. RESULTS: Fourteen of 18 premarital mental disorders are associated with lower likelihood of ever marrying (odds ratios ranging from 0.6 to 0.9), but these associations vary across ages of marriage. Associations between premarital mental disorders and marriage are generally null for early marriage (age 17 or younger), but negative associations come to predominate at later ages. All 18 mental disorders are positively associated with divorce (odds ratios ranging from 1.2 to 1.8). Three disorders, specific phobia, major depression, and alcohol abuse, are associated with the largest population attributable risk proportions for both marriage and divorce. CONCLUSION: This evidence adds to research demonstrating adverse effects of mental disorders on life course altering events across a diverse range of socioeconomic and cultural settings. These effects should be included in considerations of public health investments in preventing and treating mental disorders.


Asunto(s)
Divorcio , Matrimonio , Trastornos Mentales , Vigilancia de la Población , Adolescente , Adulto , Edad de Inicio , Anciano , Comorbilidad , Características Culturales , Manual Diagnóstico y Estadístico de los Trastornos Mentales , Divorcio/etnología , Divorcio/psicología , Divorcio/estadística & datos numéricos , Femenino , Salud Global , Humanos , Internacionalidad , Masculino , Matrimonio/etnología , Matrimonio/psicología , Matrimonio/estadística & datos numéricos , Trastornos Mentales/diagnóstico , Trastornos Mentales/epidemiología , Trastornos Mentales/etnología , Trastornos Mentales/psicología , Persona de Mediana Edad , Factores Desencadenantes , Prevalencia , Factores de Riesgo , Factores Socioeconómicos
8.
Br J Psychiatry ; 194(5): 411-7, 2009 05.
Artículo en Inglés | MEDLINE | ID: mdl-19407270

RESUMEN

BACKGROUND: Studies of the impact of mental disorders on educational attainment are rare in both high-income and low- and middle-income (LAMI) countries. AIMS: To examine the association between early-onset mental disorder and subsequent termination of education. METHOD: Sixteen countries taking part in the World Health Organization World Mental Health Survey Initiative were surveyed with the Composite International Diagnostic Interview (n=41 688). Survival models were used to estimate associations between DSM-IV mental disorders and subsequent non-attainment of educational milestones. RESULTS: In high-income countries, prior substance use disorders were associated with non-completion at all stages of education (OR 1.4-15.2). Anxiety disorders (OR=1.3), mood disorders (OR=1.4) and impulse control disorders (OR=2.2) were associated with early termination of secondary education. In LAMI countries, impulse control disorders (OR=1.3) and substance use disorders (OR=1.5) were associated with early termination of secondary education. CONCLUSIONS: Onset of mental disorder and subsequent non-completion of education are consistently associated in both high-income and LAMI countries.


Asunto(s)
Trastornos Mentales/epidemiología , Abandono Escolar , Adolescente , Adulto , Edad de Inicio , Niño , Costo de Enfermedad , Manual Diagnóstico y Estadístico de los Trastornos Mentales , Escolaridad , Métodos Epidemiológicos , Humanos , Instituciones Académicas/estadística & datos numéricos , Abandono Escolar/psicología , Abandono Escolar/estadística & datos numéricos , Universidades/estadística & datos numéricos
9.
Epidemiol Psychiatr Sci ; 28(6): 655-661, 2019 Dec.
Artículo en Inglés | MEDLINE | ID: mdl-30101735

RESUMEN

AIMS: To investigate for the first time the determinants and barriers of seeking help for mental disorders in the Arab world based on a national study: Lebanese Evaluation of the Burden of Ailments and Needs Of the Nation (L.E.B.A.N.O.N). METHODS: A nationally representative (n = 2857) and multistage clustered area probability household sample of adults ≥18 years and older was assessed for lifetime and 12 months mental disorders using the Composite International Diagnostic Interview. In addition, detailed information was obtained on help- seeking behaviour and barriers to treatment. RESULTS: In total, 19.7% of the Lebanese with mental disorders sought any type of treatment: 91% of those who sought treatment did so within the health sector. Severity and perceived severity of disorders predicted seeking help, the highest being for panic disorder. The greatest barrier to seek help was low perceived need for treatment (73.9%). Stigma was reported to be a factor only in 5.9% of those who thought about seeking treatment. Eighty per cent of the Lebanese reported they would not be embarrassed if friends knew they were seeking help from a professional. CONCLUSIONS: A small fraction of Lebanese seek help for their mental health problems: female gender, higher education and income are predictors of positive attitudes to help seeking. Severity and recognition of disorders, more than stigma, to get treatment seem to be the most important factors in determining help seeking. The findings underscore the importance of helping the public recognise mental health disorders.


Asunto(s)
Trastornos Mentales/epidemiología , Servicios de Salud Mental/estadística & datos numéricos , Aceptación de la Atención de Salud/psicología , Estigma Social , Adolescente , Adulto , Anciano , Femenino , Humanos , Líbano/epidemiología , Masculino , Trastornos Mentales/diagnóstico , Trastornos Mentales/terapia , Salud Mental , Persona de Mediana Edad , Aceptación de la Atención de Salud/estadística & datos numéricos , Encuestas y Cuestionarios
10.
Eur Psychiatry ; 56: 14-34, 2019 02.
Artículo en Inglés | MEDLINE | ID: mdl-30453134

RESUMEN

Background Attention-deficit/hyperactivity disorder (ADHD) is among the most common psychiatric disorders of childhood that often persists into adulthood and old age. Yet ADHD is currently underdiagnosed and undertreated in many European countries, leading to chronicity of symptoms and impairment, due to lack of, or ineffective treatment, and higher costs of illness. Methods The European Network Adult ADHD and the Section for Neurodevelopmental Disorders Across the Lifespan (NDAL) of the European Psychiatric Association (EPA), aim to increase awareness and knowledge of adult ADHD in and outside Europe. This Updated European Consensus Statement aims to support clinicians with research evidence and clinical experience from 63 experts of European and other countries in which ADHD in adults is recognized and treated. Results Besides reviewing the latest research on prevalence, persistence, genetics and neurobiology of ADHD, three major questions are addressed: (1) What is the clinical picture of ADHD in adults? (2) How should ADHD be properly diagnosed in adults? (3) How should adult ADHDbe effectively treated? Conclusions ADHD often presents as a lifelong impairing condition. The stigma surrounding ADHD, mainly due to lack of knowledge, increases the suffering of patients. Education on the lifespan perspective, diagnostic assessment, and treatment of ADHD must increase for students of general and mental health, and for psychiatry professionals. Instruments for screening and diagnosis of ADHD in adults are available, as are effective evidence-based treatments for ADHD and its negative outcomes. More research is needed on gender differences, and in older adults with ADHD.


Asunto(s)
Trastorno por Déficit de Atención con Hiperactividad/diagnóstico , Consenso , Guías de Práctica Clínica como Asunto/normas , Adulto , Trastorno por Déficit de Atención con Hiperactividad/terapia , Estimulantes del Sistema Nervioso Central/uso terapéutico , Europa (Continente) , Femenino , Accesibilidad a los Servicios de Salud/normas , Humanos , Masculino , Prevalencia , Psicoterapia/métodos
SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA