Synergistic and antagonistic interactions between antibiotics and synbiotics in modifying the murine fecal microbiome.

PURPOSE: Pro- and synbiotics have been reported to ameliorate the adverse (dysbiotic) effects of antibiotics on the gut microbial architecture, but little is known how synbiotics and antibiotics interact with each other in shaping the gut microbiota. To explore this mutual interaction we examined, first, the effect of a multi-strain synbiotic on antibiotic-induced dysbiosis and, second, the dysbiotic effect of antibiotics followed by prolonged synbiotic exposure. METHODS: The synbiotic containing nine bacterial strains was administered to male mice via the drinking water, while the antibiotic mix containing bacitracin, meropenem, neomycin, and vancomycin was administered via oral gavage. Two experimental protocols were used. In protocol 1, mice were administered placebo or synbiotic for 3 weeks prior to and during an 11-day vehicle or antibiotic treatment. In protocol 2 the synbiotic was administered for a prolonged period of time, starting 3 weeks prior and continuing for 12 weeks after an 11-day vehicle or antibiotic treatment. Subsequently, the fecal microbiome was analyzed by 16S rRNA sequencing using oligonucleotide primers 16s_515_S3_fwd: GATTGCCAGCAGCCGCGGTAA and 16s_806_S2_rev: GGACTACCAGGGTATCTAAT followed by sequencing using the Ion Torrent One. The final sequence files were analyzed by QIIME 1.8 workflow scripts. RESULTS: Antibiotic treatment markedly decreased the bacterial richness and diversity of the fecal microbiota. Synbiotic administration for 3 weeks prior to and during an 11-day antibiotic treatment preserved the Lactobacillales and expanded the Verrucomicrobiales and Bifidobacteriales order, but did not prevent the depletion of Bacteroidales and the short-term proliferation of Enterobacteriales. When the synbiotic administration was continued for 12 weeks after the end of antibiotic treatment, the rise of Verrucomicrobiales was maintained, whereas the preservation of Lactobacillales and boost of Bifidobacteriales was lost. The abundance of Clostridiales was enhanced by long-term synbiotic treatment after short-term exposure to antibiotics, while the antibiotic-depleted Bacteroidales underwent a delayed recovery. CONCLUSIONS: There are complex synergistic and antagonistic interactions of synbiotics and antibiotics in influencing distinct bacterial orders of the fecal microbiota. The impact of a short-term antibiotic exposure is profoundly different when analyzed after synbiotic pretreatment or following prolonged synbiotic administration in the post-antibiotic period.

High-fat diet induces depression-like behaviour in mice associated with changes in microbiome, neuropeptide Y, and brain metabolome.

Objectives: The biological mechanisms linking diet-related obesity and depression remain unclear. Therefore, we examined the impact of high-fat diet (HFD) on murine behaviour, intestinal microbiome, brain metabolome, neuropeptide Y (NPY) expression, and dipeptidyl peptidase-4 (DPP-4) activity.Methods: Male C57Bl/6J mice were fed an HFD (60 kJ% from fat) or control diet (12 kJ% from fat) for 8 weeks, followed by behavioural phenotyping. Caecal microbiome was analysed by 16S rDNA sequencing, brain metabolome by 1H nuclear magnetic resonance, NPY expression by PCR and immunoassay, and dipeptidyl peptidase-4 (DPP-4) activity by enzymatic assay. The effect of a 4-week treatment with imipramine (7 mg/kg/day) and the DPP-4 inhibitor sitagliptin (50 mg/kg/day) on HFD-induced behavioural changes was also tested.Results: HFD led to a depression-like phenotype as revealed by reduced sociability and sucrose preference. In the caecum, HFD diminished the relative abundance of Bacteroidetes and increased the relative abundance of Firmicutes and Cyanobacteria. In the brain, HFD modified the metabolome of prefrontal cortex and striatum, changing the relative concentrations of molecules involved in energy metabolism (e.g. lactate) and neuronal signalling (e.g. γ-aminobutyric acid). The expression of NPY in hypothalamus and hippocampus was decreased by HFD, whereas plasma NPY and DPP-4-like activity were increased. The HFD-induced anhedonia remained unaltered by imipramine and sitagliptin.Discussion: The depression-like behaviour induced by prolonged HFD in mice is associated with distinct alterations of intestinal microbiome, brain metabolome, NPY system, and DPP-4-like activity. Importantly, the HFD-evoked behavioural disturbance remains unaltered by DPP-4 inhibition and antidepressant treatment with imipramine.

Diverse action of lipoteichoic acid and lipopolysaccharide on neuroinflammation, blood-brain barrier disruption, and anxiety in mice.

Microbial metabolites are known to affect immune system, brain, and behavior via activation of pattern recognition receptors such as Toll-like receptor 4 (TLR4). Unlike the effect of the TLR4 agonist lipopolysaccharide (LPS), the role of other TLR agonists in immune-brain communication is insufficiently understood. We therefore hypothesized that the TLR2 agonist lipoteichoic acid (LTA) causes immune activation in the periphery and brain, stimulates the hypothalamic-pituitary-adrenal (HPA) axis and has an adverse effect on blood-brain barrier (BBB) and emotional behavior. Since LTA preparations may be contaminated by LPS, an extract of LTA (LTAextract), purified LTA (LTApure), and pure LPS (LPSultrapure) were compared with each other in their effects on molecular and behavioral parameters 3h after intraperitoneal (i.p.) injection to male C57BL/6N mice. The LTAextract (20mg/kg) induced anxiety-related behavior in the open field test, enhanced the circulating levels of particular cytokines and the cerebral expression of cytokine mRNA, and blunted the cerebral expression of tight junction protein mRNA. A dose of LPSultrapure matching the amount of endotoxin/LPS contaminating the LTAextract reproduced several of the molecular and behavioral effects of LTAextract. LTApure (20mg/kg) increased plasma levels of tumor necrosis factor-α (TNF-α), interleukin-6 and interferon-γ, and enhanced the transcription of TNF-α, interleukin-1ß and other cytokines in the amygdala and prefrontal cortex. These neuroinflammatory effects of LTApure were associated with transcriptional down-regulation of tight junction-associated proteins (claudin 5, occludin) in the brain. LTApure also enhanced circulating corticosterone, but failed to alter locomotor and anxiety-related behavior in the open field test. These data disclose that TLR2 agonism by LTA causes peripheral immune activation and initiates neuroinflammatory processes in the brain that are associated with down-regulation of BBB components and activation of the HPA axis, although emotional behavior (anxiety) is not affected. The results obtained with an LTA preparation contaminated with LPS hint at a facilitatory interaction between TLR2 and TLR4, the adverse impact of which on long-term neuroinflammation, disruption of the BBB and mental health warrants further analysis.

Cognitive impairment by antibiotic-induced gut dysbiosis: Analysis of gut microbiota-brain communication.

Emerging evidence indicates that disruption of the gut microbial community (dysbiosis) impairs mental health. Germ-free mice and antibiotic-induced gut dysbiosis are two approaches to establish causality in gut microbiota-brain relationships. However, both models have limitations, as germ-free mice display alterations in blood-brain barrier and brain ultrastructure and antibiotics may act directly on the brain. We hypothesized that the concerns related to antibiotic-induced gut dysbiosis can only adequately be addressed if the effect of intragastric treatment of adult mice with multiple antibiotics on (i) gut microbial community, (ii) metabolite profile in the colon, (iii) circulating metabolites, (iv) expression of neuronal signaling molecules in distinct brain areas and (v) cognitive behavior is systematically investigated. Of the antibiotics used (ampicillin, bacitracin, meropenem, neomycin, vancomycin), ampicillin had some oral bioavailability but did not enter the brain. 16S rDNA sequencing confirmed antibiotic-induced microbial community disruption, and metabolomics revealed that gut dysbiosis was associated with depletion of bacteria-derived metabolites in the colon and alterations of lipid species and converted microbe-derived molecules in the plasma. Importantly, novel object recognition, but not spatial, memory was impaired in antibiotic-treated mice. This cognitive deficit was associated with brain region-specific changes in the expression of cognition-relevant signaling molecules, notably brain-derived neurotrophic factor, N-methyl-d-aspartate receptor subunit 2B, serotonin transporter and neuropeptide Y system. We conclude that circulating metabolites and the cerebral neuropeptide Y system play an important role in the cognitive impairment and dysregulation of cerebral signaling molecules due to antibiotic-induced gut dysbiosis.

Cytotoxicity of Nanoparticles Contained in Food on Intestinal Cells and the Gut Microbiota.

Toxicity of nanoparticles (NPs) upon oral exposure has been studied in animals using physiological changes, behavior, histology, and blood analysis for evaluation. The effects recorded include the combination of the action on cells of the exposed animal and the reaction of the microorganisms that populate the external and internal surfaces of the body. The importance of these microorganisms, collectively termed as microbiota, for the health of the host has been widely recognized. They may also influence toxicity of NPs but these effects are difficult to differentiate from toxicity on cells of the gastrointestinal tract. To estimate the likelihood of preferential damage of the microbiota by NPs the relative sensitivity of enterocytes and bacteria was compared. For this comparison NPs with antimicrobial action present in consumer products were chosen. The comparison of cytotoxicity with Escherichia coli as representative for intestinal bacteria and on gastrointestinal cells revealed that silver NPs damaged bacteria at lower concentrations than enterocytes, while the opposite was true for zinc oxide NPs. These results indicate that silver NPs may cause adverse effects by selectively affecting the gut microbiota. Fecal transplantation from NP-exposed animals to unexposed ones offers the possibility to verify this hypothesis.

Synergistic effects of NOD1 or NOD2 and TLR4 activation on mouse sickness behavior in relation to immune and brain activity markers.

Toll-like receptors (TLRs) and nuclear-binding domain (NOD)-like receptors (NLRs) are sensors of bacterial cell wall components to trigger an immune response. The TLR4 agonist lipopolysaccharide (LPS) is a strong immune activator leading to sickness and depressed mood. NOD agonists are less active but can prime immune cells to augment LPS-induced cytokine production. Since the impact of NOD and TLR co-activation in vivo has been little studied, the effects of the NOD1 agonist FK565 and the NOD2 agonist muramyl dipeptide (MDP), alone and in combination with LPS, on immune activation, brain function and sickness behavior were investigated in male C57BL/6N mice. Intraperitoneal injection of FK565 (0.001 or 0.003mg/kg) or MDP (1 or 3mg/kg) 4h before LPS (0.1 or 0.83mg/kg) significantly aggravated and prolonged the LPS-evoked sickness behavior as deduced from a decrease in locomotion, exploration, food intake and temperature. When given alone, FK565 and MDP had only minor effects. The exacerbation of sickness behavior induced by FK565 or MDP in combination with LPS was paralleled by enhanced plasma protein and cerebral mRNA levels of proinflammatory cytokines (IFN-γ, IL-1ß, IL-6, TNF-α) as well as enhanced plasma levels of kynurenine. Immunohistochemical visualization of c-Fos in the brain revealed that NOD2 synergism with TLR4 resulted in increased activation of cerebral nuclei relevant to sickness. These data show that NOD1 or NOD2 synergizes with TLR4 in exacerbating the immune, sickness and brain responses to peripheral immune stimulation. Our findings demonstrate that the known interactions of NLRs and TLRs at the immune cell level extend to interactions affecting brain function and behavior.

Intranasal Neuropeptide Y Blunts Lipopolysaccharide-Evoked Sickness Behavior but Not the Immune Response in Mice.

Neuropeptide Y (NPY) has been demonstrated to exert stress buffering effects and promote resilience. Non-invasive intranasal (IN) application of NPY to rodents is able to mitigate traumatic stress-induced behavioral changes as well as dysfunction of the hypothalamic-pituitary-adrenal (HPA) axis. However, it is unknown whether IN NPY could prevent the behavioral, pro-inflammatory and neurochemical responses to peripheral immune activation by the Toll-like receptor 4 (TLR4) stimulant lipopolysaccharide (LPS). Therefore, we analyzed the effects of IN NPY (100 µg) on the behavioral sickness response (reduced locomotion and exploration) and the underlying molecular mechanisms, 3 h and 21 h after intraperitoneal injections of LPS (0.03 mg/kg) in male C57BL/6N mice. The acute behavioral sickness response was significantly dampened by pretreatment with IN NPY 3 h after LPS injection. This effect was accompanied by diminished weight loss and lowered plasma corticosterone (CORT) levels 21 h after LPS injection. In contrast, acute circulating cytokine levels and hypothalamic cytokine mRNA expression remained unaltered by IN NPY, which indicates that the peripheral and cerebral immune response to LPS was left undisturbed. Our findings are in agreement with the reported activity of NPY to dampen the response of the HPA axis to stress. We propose that IN NPY ablates sickness behavior at a site beyond the peripheral and cerebral cytokine response, an action that is associated with reduced activity of the HPA axis as determined by decreased plasma CORT.These results indicate that IN NPY administration may be relevant to the management of neuropsychiatric disorders arising from immune-induced neuroendocrine dysfunction.

Gut Microbiota and the Neuroendocrine System.

The microbial ecosystem that inhabits the gastrointestinal tract of all mammals-the gut microbiota-has been in a symbiotic relationship with its hosts over many millennia. Thanks to modern technology, the myriad of functions that are controlled or modulated by the gut microbiota are beginning to unfold. One of the systems that is emerging to closely interact with the gut microbiota is the body's major neuroendocrine system that controls various body processes in response to stress, the hypothalamic-pituitary-adrenal (HPA) axis. This interaction is of pivotal importance; as various disorders of the microbiota-gut-brain axis are associated with dysregulation of the HPA axis. The present contribution describes the bidirectional communication between the gut microbiota and the HPA axis and delineates the potential underlying mechanisms. In this regard, it is important to note that the communication between the gut microbiota and the HPA axis is closely interrelated with other systems, such as the immune system, the intestinal barrier and blood-brain barrier, microbial metabolites, and gut hormones, as well as the sensory and autonomic nervous systems. These communication pathways will be exemplified through preclinical models of early life stress, beneficial roles of probiotics and prebiotics, evidence from germ-free mice, and antibiotic-induced modulation of the gut microbiota.

Visceral hyperalgesia caused by peptide YY deletion and Y2 receptor antagonism.

Altered levels of colonic peptide YY (PYY) have been reported in patients suffering from functional and inflammatory bowel disorders. While the involvement of neuropeptide Y (NPY) and Y receptors in the regulation of nociception is well established, the physiological role of PYY in somatic and visceral pain is poorly understood. In this work, the role of PYY in pain sensitivity was evaluated using PYY knockout (PYY(-/-)) mice and Y2 receptor ligands. PYY(-/-) mice were more sensitive to somatic thermal pain compared to wild type (WT) mice. Visceral pain was assessed by evaluating pain-related behaviors, mouse grimace scale (MGS) and referred hyperalgesia after intrarectal administration of allyl isothiocyanate (AITC, 1 or 2%) or its vehicle, peanut oil. The pain-related behaviors induced by AITC were significantly exaggerated by PYY deletion, whereas the MGS readout and the referred hyperalgesia were not significantly affected. The Y2 receptor antagonist, BII0246, increased pain-related behaviors in response to intrarectal AITC compared to vehicle treatment while the Y2 receptor agonist, PYY(3-36), did not have a significant effect. These results indicate that endogenous PYY has a hypoalgesic effect on somatic thermal and visceral chemical pain. The effect on visceral pain seems to be mediated by peripheral Y2 receptors.

Environmental enrichment induces behavioural disturbances in neuropeptide Y knockout mice.

Environmental enrichment (EE) refers to the provision of a complex and stimulating housing condition which improves well-being, behaviour and brain function of laboratory animals. The mechanisms behind these beneficial effects of EE are only partially understood. In the current report, we describe a link between EE and neuropeptide Y (NPY), based on findings from NPY knockout (KO) mice exposed to EE. Relative to EE-housed wildtype (WT) animals, NPY KO mice displayed altered behaviour as well as molecular and morphological changes in amygdala and hippocampus. Exposure of WT mice to EE reduced anxiety and decreased central glucocorticoid receptor expression, effects which were absent in NPY KO mice. In addition, NPY deletion altered the preference of EE items, and EE-housed NPY KO mice responded to stress with exaggerated hyperthermia, displayed impaired spatial memory, had higher hippocampal brain-derived neurotrophic factor mRNA levels and altered hippocampal synaptic plasticity, effects which were not seen in WT mice. Accordingly, these findings suggest that NPY contributes to the anxiolytic effect of EE and that NPY deletion reverses the beneficial effects of EE into a negative experience. The NPY system could thus be a target for "enviromimetics", therapeutics which reproduce the beneficial effects of enhanced environmental stimulation.

Toll-like receptor 4 contributes to the inhibitory effect of morphine on colonic motility in vitro and in vivo.

Opioids rank among the most potent analgesic drugs but gastrointestinal side effects, especially constipation, limit their therapeutic utility. The adverse effects of opioids have been attributed to stimulation of opioid receptors, but emerging evidence suggests that opioids interact with the innate immune receptor Toll-like receptor 4 (TLR4) and its signalling pathway. As TLR4 signalling affects gastrointestinal motility, we examined the involvement of TLR4 in morphine-induced depression of peristaltic motility in the guinea-pig intestine in vitro and male C57BL/6N mice in vivo. While the TLR4 antagonist TAK-242 (0.1 µM and 1 µM) did not alter the morphine-induced inhibition of peristalsis in the isolated guinea-pig small intestine, the morphine-induced decrease in pellet propulsion velocity in colonic segments was attenuated by TAK-242 (0.1 µM). The ability of TAK-242 (4 mg/kg) to mitigate the morphine-induced suppression of colonic motility was replicated in mice in vivo by measuring the expulsion time of beads inserted in the distal colon. The inhibition of upper gastrointestinal transit of mice by morphine was not affected by pre-treatment with TAK-242 (4 mg/kg) in vivo. This is the first report that morphine-induced inhibition of colonic peristalsis is alleviated by TLR4 antagonism. We therefore conclude that TLR4 may contribute to opioid-induced constipation.