Gingival tissue autophagy pathway gene expression profiles in periodontitis and aging.

OBJECTIVE: We hypothesized that autophagy-related genes will be differentially expressed in periodontitis, suggesting an impaired gingival autophagic response associated with disease. BACKGROUND: Autophagy is a cellular physiologic mechanism to maintain tissue homeostasis, while deficient autophagic responses increase inflammation and susceptibility to infection. METHODS: Rhesus monkeys [<3 years to 23 years of age (n = 34)] were examined for periodontal health and naturally occurring periodontitis. Gingival tissues samples were obtained from healthy or diseased sites, total RNA was isolated, and the Rhesus Gene Chip 1.0 ST (Affymetrix) was used for gene expression analysis of 150 autophagy-related genes. RESULTS: Comparison of expression levels with adult healthy tissues demonstrated a rather limited number of individual genes that were significantly different across the age-groups. In contrast, with periodontitis in the adults and aged animals, about 15% of the genes were significantly increased or decreased. The differences were reflected in the mTOR complex (5/12), ULK1/ATG1 complex (5/9), PI3K complex (5/21), ATG9 complex (2/7), ATG12 conjugation/LC3 lipidation (7/22), and lysosome fusion/vesicle degradation [LF/VD (5/10)] activities within the broader autophagic pathway. The genes most greatly altered in gingival tissues of naturally occurring periodontitis were identified in the ATG12 and LF/VD pathways that approximated 50% of the genes in each of those categories. While healthy gingival aging did not appear to reflect altered autophagy gene expression, substantial differences were noted with periodontitis irrespective of the age of the animals. Future studies into the role of autophagy in periodontitis and could offer potential new therapeutic strategies to prevent and/or treat periodontal disease.

Microbiome Profiles of Ligature-Induced Periodontitis in Nonhuman Primates across the Life Span.

This investigation compared the microbiomes colonizing teeth during the initiation, progression, and resolution of periodontitis in nonhuman primates (Macaca mulatta) at different ages. Subgingival plaque samples were collected at baseline; 0.5, 1, and 3 months following ligature-induced periodontitis; and following naturally occurring disease resolution at 5 months. Samples were analyzed using 16S amplicon sequencing to identify bacterial profiles across age groups: young (<3 years of age), adolescent (3 to 7 years), adult (12 to 15 years), and aged (17 to 23 years). α-Diversity of the microbiomes was greater in the adult/aged samples than in the young/adolescent samples. ß-Diversity of the samples demonstrated clear age group differences, albeit individual variation in microbiomes between animals within the age categories was noted. Phylum distributions differed between the young/adolescent animals and the adult/aged animals at each of the time points, showing an enrichment of the phyla Spirochetes, Fusobacteria, and Bacteroidetes associated with periodontitis. Major differences in the top 50 operational taxonomic units (OTUs) were noted in the young and adolescent microbiomes during initiation and progression postligation compared to the adult and aged animals. The proportions of a large number of species in the top 50 OTUs were lower at baseline and in resolved disease microbiomes in the young samples, while profiles in adolescent animals were more consistent with the disease microbiomes. Microbiome profiles for resolution for adults and aged animals appeared more resilient and generally maintained a pattern similar to that of disease. Use of the model can expand our understanding of the crucial interactions of the oral microbiome and host responses in periodontitis.

Periodontal disease susceptible matrilines in the Cayo Santiago Macaca mulatta macaques.

OBJECTIVE AND BACKGROUND: The expression of periodontitis, including age of onset, extent, and severity is considered to represent an interaction of the individual's oral microbiome and host response to the microbial challenge that is modified by both genetics and environmental factors. The aim of this study was to determine the distribution of periodontitis in a population of nonhuman primates, to document features of familial distribution that could reflect heritability and transmission of microbes with enhanced virulence. MATERIAL AND METHODS: This report presents our findings from evaluation of periodontal disease bone defects in skulls from 569 animals (5-31 years of age) derived from the skeletons of the rhesus monkeys (Macaca mulatta) of Cayo Santiago derived from eight matrilines over 6-9 generations. The distance from the base of alveolar bone to the cemento-enamel junction on 1st /2nd premolars and 1st /2nd molars from all four quadrants was evaluated as a measure of periodontal disease. Additionally, we documented the presence of periodontitis in 79 living descendants within these matrilines. RESULTS: The results demonstrated an increased extent and severity of periodontitis with aging across all matrilines. Extensive heterogeneity in disease expression was observed among the animals and this was linked to specific periodontitis susceptible matrilines. Moreover, we identified some matrilines in which the members appeared to show some resistance to more severe disease, even with aging. CONCLUSION: Linking these disease variations to multigenerational matriarchal family units supported familial susceptibility of periodontitis. This familial disease relationship was reinforced by the distribution of naturally-occurring periodontitis in the living descendants.

Bone biology-related gingival transcriptome in ageing and periodontitis in non-human primates.

AIM: Cellular and molecular immunoinflammatory changes in gingival tissues drive alveolar bone loss in periodontitis. Since ageing is a risk factor for periodontitis, we sought to identify age-related gingival transcriptome changes associated with bone metabolism in both healthy and in naturally occurring periodontitis. MATERIALS AND METHODS: Adult (12-16 years) and aged (18-23 years) non-human primates (M. mulatta) (n = 24) were grouped into healthy and periodontitis. Gingival tissue samples were obtained and subjected to microarray analysis using the Gene Chip Macaque Genome Array. Gene expression profiles involved in osteoclast/osteoblast proliferation, adhesion and function were evaluated and compared across and between the age groups. QPCR was also performed on selected genes to validate microarray data. RESULTS: Healthy aged tissues showed a gene profile expression that suggest enhancement of osteoclastic adhesion, proliferation/survival and function (SPP1, TLR4, MMP8 and TFEC) and impaired osteoblastic activity (SMEK3P and SMAD5). The gingival transcriptome in both adult and aged animals with naturally occurring periodontitis (FOS, IL6, TLR4, MMP9, MMP10 and SPP1 genes) was consistent with a local inflammatory response driving towards bone/connective tissue destruction. CONCLUSION: A pro-osteoclastogenic gingival transcriptome is associated with periodontitis irrespective of age; however; a greater bone-destructive molecular environment is associated with ageing in healthy tissues.

The ticking clock of Cayo Santiago macaques and its implications for understanding human circadian rhythm disorders.

The circadian clock disorders in humans remain poorly understood. However, their impact on the development and progression of major human conditions, from cancer to insomnia, metabolic or mental illness becomes increasingly apparent. Addressing human circadian disorders in animal models is, in part, complicated by inverse temporal relationship between the core clock and specific physiological or behavioral processes in diurnal and nocturnal animals. Major advantages of a macaque model for translational circadian research, as a diurnal vertebrate phylogenetically close to humans, are further emphasized by the discovery of the first familial circadian disorder in non-human primates among the rhesus monkeys originating from Cayo Santiago. The remarkable similarity of their pathological phenotypes to human Delayed Sleep Phase Disorder (DSPD), high penetrance of the disorder within one branch of the colony and the large number of animals available provide outstanding opportunities for studying the mechanisms of circadian disorders, their impact on other pathological conditions, and for the development of novel and effective treatment strategies.

Familial periodontal disease in the Cayo Santiago rhesus macaques.

Substantial ongoing research continues to explore the contribution of genetics and environment to the onset, extent and severity of periodontal disease(s). Existing evidence supports that periodontal disease appears to have an increased prevalence in family units with a member having aggressive periodontitis. We have been using the nonhuman primate as a model of periodontal disease for over 25 years with these species demonstrating naturally occurring periodontal disease that increases with age. This report details our findings from evaluation of periodontal disease in skulls from 97 animals (5-31 years of age) derived from the skeletons of the rhesus monkeys (Macaca mulatta) on Cayo Santiago. Periodontal disease was evaluated by determining the distance from the base of the alveolar bone defect to the cemento-enamel junction on 1st/2nd premolars and 1st/2nd molars from all four quadrants. The results demonstrated an increasing extent and severity of periodontitis with aging across the population of animals beyond only compensatory eruption. Importantly, irrespective of age, extensive heterogeneity in disease expression was observed among the animals. Linking these variations to multi-generational matriarchal family units supported familial susceptibility of periodontitis. As the current generations of animals that are descendants from these matrilines are alive, studies can be conducted to explore an array of underlying factors that could account for susceptibility or resistance to periodontal disease.

Comparative analysis of gingival tissue antigen presentation pathways in ageing and periodontitis.

AIM: Gingival tissues of periodontitis lesions contribute to local elevations in mediators, including both specific T cell and antibody immune responses to oral bacterial antigens. Thus, antigen processing and presentation activities must exist in these tissues to link antigen-presenting cells with adaptive immunity. We hypothesized that alterations in the transcriptome of antigen processing and presentation genes occur in ageing gingival tissues and that periodontitis enhances these differences reflecting tissues less capable of immune resistance to oral pathogens. MATERIALS AND METHODS: Rhesus monkeys (n = 34) from 3 to 23 years of age were examined. A buccal gingival sample from healthy or periodontitis sites was obtained, total RNA isolated, and microarray analysis was used to describe the transcriptome. RESULTS: The results demonstrated increased transcription of genes related to the MHC class II and negative regulation of NK cells with ageing in healthy gingival tissues. In contrast, both adult and ageing periodontitis tissues showed decreased transcription of genes for MHC class II antigens, coincident with up-regulation of MHC class I-associated genes. CONCLUSION: These transcriptional changes suggest a response of healthy ageing tissues through the class II pathway (i.e. endocytosed antigens) and altered responses in periodontitis that could reflect host-associated self-antigens or targeting cytosolic intracellular microbial pathogens.

Cytokine gene expression profiles during initiation, progression and resolution of periodontitis.

AIM: Variations in the expression of cytokines during the progression of periodontitis remain ill-defined. We evaluated the expression of 19 cytokine genes related to T-cell phenotype/function during initiation, progression and resolution of periodontitis, and related these to the expression of soft and bone tissue destruction genes (TDGs). MATERIALS AND METHODS: A ligature-induced periodontitis model was used in rhesus monkeys (M. mulatta) (n = 18). Gingival tissues were taken at baseline pre-ligation, 2 weeks and 1 month (Initiation) and 3 months (progression) post ligation. Ligatures were removed and samples taken 2 months later (resolution). Total RNA was isolated and the Rhesus Gene 1.0 ST (Affymetrix) used for gene expression analysis. Significant expression changes were validated by qRT-PCR. RESULTS: Disease initiation/progression was characterized by overexpression of Th17/Treg cytokine genes (IL-1ß, IL-6, TGFß and IL-21) and down-regulation of Th1/Th2 cytokine genes (IL-18 and IL-25). Increased IL-2 and decreased IL-10 levels were seen during disease resolution. Several Th17/Treg cytokine genes positively correlated with TDGs, whereas most Th1/Th2 genes exhibited a negative correlation. CONCLUSION: Initiation, progression and resolution of periodontitis involve over- and underexpression of cytokine genes related to various T-helper subsets. In addition, variations in individual T-helper response subset/genes during disease progression correlated with protective/destructive outcomes.

Effects of aging on apoptosis gene expression in oral mucosal tissues.

Apoptotic processes are important for physiologic renewal of an intact epithelial barrier and contribute some antimicrobial resistance for bacteria and viruses, as well as anti-inflammatory effects that benefits the mucosa. The oral cavity presents a model of host-bacterial interactions at mucosal surfaces, in which a panoply of microorganisms colonizes various niches in the oral cavity and creates complex multispecies biofilms that challenge the gingival tissues. This report details gene expression in apoptotic pathways that occur in oral mucosal tissues across the lifespan, using a nonhuman primate model. Macaca mulatta primates from 2 to 23 years of age (n = 23) were used in a cross-sectional study to obtain clinical healthy gingival tissues specimens. Further, mRNA was prepared and evaluated using the Affymetrix Rhesus GeneChip and 88 apoptotic pathway genes were evaluated. The results identified significant positive correlations with age in 12 genes and negative correlations with an additional five genes. The gene effects were predicted to alter apoptosis receptor levels, extrinsic apoptotic pathways through caspases, cytokine effects on apoptotic events, Ca(+2)-induced death signaling, cell cycle checkpoints, and potential effects of survival factors. Both the positively and negatively correlated genes within the apoptotic pathways provided evidence that healthy tissues in aging animals exhibit decreased apoptotic potential compared to younger animals. The results suggested that decreased physiologic apoptotic process in the dynamic septic environment of the oral mucosal tissues could increase the risk of aging tissues to undergo destructive disease processes through dysregulated inflammatory responses to the oral microbial burden.

Demographic variability and density-dependent dynamics of a free-ranging rhesus macaque population.

Density-dependence is hypothesized as the major mechanism of population regulation. However, the lack of long-term demographic data has hampered the use of density-dependent models in nonhuman primates. In this study, we make use of the long-term demographic data from Cayo Santiago's rhesus macaques to parameterize and analyze both a density-independent and a density-dependent population matrix model, and compare their projections with the observed population changes. We also employ a retrospective analysis to determine how variance in vital rates, and covariance among them, contributed to the observed variation in long-term fitness across different levels of population density. The population exhibited negative density-dependence in fertility and the model incorporating this relationship accounted for 98% of the observed population dynamics. Variation in survival and fertility of sexually active individuals contributed the most to the variation in long-term fitness, while vital rates displaying high temporal variability exhibited lower sensitivities. Our findings are novel in describing density-dependent dynamics in a provisioned primate population, and in suggesting that selection is acting to lower the variance in the population growth rate by minimizing the variation in adult survival at high density. Because density-dependent mechanisms may become stronger in wild primate populations due to increasing habitat loss and food scarcity, our study demonstrates that it is important to incorporate variation in population size, as well as demographic variability into population viability analyses for a better understanding of the mechanisms regulating the growth of primate populations.

Comparative Analysis of Gene Expression Patterns for Oral Epithelial Cell Functions in Periodontitis.

The structure and function of epithelial cells are critical for the construction and maintenance of intact epithelial surfaces throughout the body. Beyond the mechanical barrier functions, epithelial cells have been identified as active participants in providing warning signals to the host immune and inflammatory cells and in communicating various detailed information on the noxious challenge to help drive specificity in the characteristics of the host response related to health or pathologic inflammation. Rhesus monkeys were used in these studies to evaluate the gingival transcriptome for naturally occurring disease samples (GeneChip® Rhesus Macaque Genome Array) or for ligature-induced disease (GeneChip® Rhesus Gene 1.0 ST Array) to explore up to 452 annotated genes related to epithelial cell structure and functions. Animals were distributed by age into four groups: ≤ 3 years (young), 3-7 years (adolescent), 12-16 years (adult), and 18-23 years (aged). For naturally occurring disease, adult and aged periodontitis animals were used, which comprised 34 animals (14 females and 20 males). Groups of nine animals in similar age groups were included in a ligature-induced periodontitis experiment. A buccal gingival sample from either healthy or periodontitis-affected tissues were collected, and microarray analysis performed. The overall results of this investigation suggested a substantial alteration in epithelial cell functions that occurs rapidly with disease initiation. Many of these changes were prolonged throughout disease progression and generally reflect a disruption of normal cellular functions that would presage the resulting tissue destruction and clinical disease measures. Finally, clinical resolution may not signify biological resolution and represent a continued risk for disease that may require considerations for additional biologically specific interventions to best manage further disease.

Limited microbiome differences in captive and semi-wild primate populations consuming similar diets.

Gut microbial communities are shaped by a myriad of extrinsic factors, including diet and the environment. Although distinct human populations consistently exhibit different gut microbiome compositions, variation in diet and environmental factors are almost always coupled, making it difficult to disentangle their relative contributions to shaping the gut microbiota. Data from discrete animal populations with similar diets can help reduce confounds. Here, we assessed the gut microbiota of free-ranging and captive rhesus macaques with at least 80% diet similarity to test the hypothesis that hosts in difference environments will have different gut microbiomes despite a shared diet. Although we found that location was a significant predictor of gut microbial composition, the magnitude of observed differences was relatively small. These patterns suggest that a shared diet may limit the typical influence of environmental microbial exposure on the gut microbiota.

Long-distance transportation of primate embryos developing in culture: a preliminary study.

Non-human primate embryos are invaluable for conducting research relevant to human infertility and stem cells, but their availability is restricted. In this preliminary study, rhesus monkey embryos were produced by IVF at the Caribbean Primate Research Centre and shipped in tubes of gassed culture medium within a battery-powered transport incubator by overnight courier to Wayne State University in Michigan. Upon arrival, the embryos were incubated in fresh culture medium to evaluate further development. In 11 shipments comprising 98 cleavage-stage embryos developing from oocytes that were mature (MII) upon collection, 51 (52%) reached advanced preimplantation stages (morula to hatched blastocyst) during prolonged culture following transportation. However, most embryos produced from oocytes that were immature (MI) at collection arrested and only 5/51 (10%) reached advanced stages of development. This study demonstrates that non-cryopreserved primate embryos can be routinely transported between distant sites without loss of developmental ability. In this way, the processes of production and study of non-cryopreserved primate embryos need not be restricted to the same or nearby laboratories. This will expand the use of these embryos for research and facilitate generation of translationally relevant information.

Oral Microbiome and Gingival Tissue Apoptosis and Autophagy Transcriptomics.

Objective: This study focused on documenting characteristics of the gingival transcriptome during various stages of periodontitis targeting genes associated with apoptotic and autophagic pathways and changes that specifically associate with features of the oral microbiome. Methods:Macaca mulatta (n = 18; 12-23 years) were examined at baseline and 0.5, 1, and 3 months of disease progression, as well as 5 months with clinical disease resolution. 16S sequencing and microarray analyses examined changes in the microbiome and gingival transcriptome, respectively, at each time point from every animal. Results: Specific patterns of apoptotic and autophagic genes were identified related to the initiation and progression of disease. The analysis also provided insights on the principal bacteria within the complex microbiome whose abundance was significantly correlated with differences in apoptotic and autophagic gene expression. Bacteria were identified that formed associated complexes with similar effects on the host gene expression profiles. A complex of Leptotrichia_unclassifed, Capnocytophaga_unclassified, Prevotella sp. 317, and Veillonellaceae_[G-1] sp. 155 were significantly negatively correlated with both apoptosis and autophagy. Whereas, Veillonellaceae_[G-1], Porphyromonadaceae, and F. alocis 539 were significantly positively correlated with both pathways, albeit this relationship was primarily associated with pro-apoptotic genes. Conclusions: The findings provide evidence for specific bacteria/bacterial complexes within the oral microbiome that appear to have a more substantive effect on regulating apoptotic and autophagic pathways in the gingival tissues with periodontitis.

Fatal granulomatous meningoencephalitis associated to mycobacterium mucogenicum-like microorganism: a case report.

Mycobacterium mucogenicum is rarely associated to human infections. However, in the last year, a few reports of sepsis and fatal cases of central nervous systems have been documented. Here we report a fatal case of granulomatous meningoencephalitis of three weeks of evolution where DNA from a M. mucogenicum-like microorganism was identified postmortem in samples of brain tissue.

Correction: Activation of Notch-1 in oral epithelial cells by P. gingivalis triggers the expression of the antimicrobial protein PLA2-IIA.

The sequence for the Reverse primer used to amplify the human gene PLA2G2A presented in table 1 is incorrect. The following, is the correct sequence: Reverse 5' - GCTCCCTCTGCAGTGTTTATT -3.

Maculas, monkeys, models, AMD and aging.

Age related macular degeneration (AMD) signs may be found reliably in monkeys (Macaca mulatta) bred selectively in Florida after 14 generations of inbreeding in a closed colony at the University of Puerto Rico. Progression, ultrastructure and functional losses are parallel to those found in humans.

Activation of Notch-1 in oral epithelial cells by P. gingivalis triggers the expression of the antimicrobial protein PLA2-IIA.

P. gingivalis (Pg) is an oral pathogen with the ability to induce oral dysbiosis and periodontal disease. Nevertheless, the mechanisms by which mucosal responses to the oral microbiota in the presence of specific pathogens such as Pg could abrogate the host-microbe symbiotic relationship leading to periodontitis remain unclear. Herein, we identified the Notch-1/PLA2-IIA axis as a new molecular pathway through which Pg could be specifically modulating oral epithelial antimicrobial and inflammatory responses. Pg activated Notch-1, and inhibition or silencing of Notch-1 completely abrogated Pg-induced PLA2-IIA in oral epithelial cells (OECs). Activation of Notch-1 and PLA2-IIA production were associated with Pg-produced gingipains. Other oral Gram-positive and Gram-negative species failed to induce similar responses. Pg enhanced OEC antimicrobial activity through PLA2-IIA. Increased Notch-1 activation correlated with higher PLA2-IIA gingival expression and changes in the abundance of specific oral bacteria phyla during periodontal disease. Oral bacterial species exhibited differential antimicrobial susceptibility to PLA2-IIA. These findings support previous evidence suggesting an important role for epithelial Notch-1 activation and PLA2-IIA production during health and disease at mucosal surfaces, and provide new mechanistic information concerning the regulation of epithelial antimicrobial and pro-inflammatory responses modulated by oral pathogenic bacteria associated with periodontal disease.

Gene expression analysis of neuropeptides in oral mucosa during periodontal disease in non-human primates.

BACKGROUND: Neuropeptides (NPs) are innate pivotal regulators of the immunoinflammatory response. Nevertheless, their role in the pathogenesis of periodontal disease remains unknown. Changes in gene expression of 10 NPs and 16 NP receptors (NPRs) coincident with the initiation, progression, and resolution of periodontitis were determined. METHODS: The ligature-induced periodontitis model was used in rhesus monkeys (n = 18). Gingival tissue samples were taken at baseline (preligatures), at 2 weeks and at 1 month (initiation), and at 3 months (progression) postligation. Ligatures were removed and samples taken 2 months later (resolution). Total RNA was isolated from tissues and NP/NPR gene expression microarray analysis was performed. Gene expression changes were validated by quantitative polymerase chain reaction and immunohistochemistry. RESULTS: Unexpectedly, the expression of pro-inflammatory NPs/NPRs did not change during periodontitis or with resolution. However, increased expression of the anti-inflammatory NPs adrenomedullin (ADM) and galanin (GAL), and the NPRs calcitonin receptor-like (CALCRL) and receptor activity-modifying protein-2 and -3 (RAMP2 and RAMP3) were observed during initiation and progression of disease. The expression of the same NPs/NPRs exhibited a significant positive correlation with both molecular (interleukin-1ß, matrix mettaloproteinase-9, and receptor activator of nuclear factor-kappa B ligand) and clinical measures of gingival inflammation and tissue destruction. CONCLUSION: Initiation and progression of periodontitis involve significant overexpression of ADM, GAL, CALCRL, RAMP2, and RAMP3. These anti-inflammatory NPs/NPRs could play a role in the unresolved infection and inflammation that normally drives tissue destruction in periodontitis. Both ADM and GAL potentially are new candidates to consider as biomolecules associated with periodontal disease activity.