Emergence of watermelon chlorotic stunt virus in melon and watermelon in the southwestern United States.

Watermelon (Citrullus lanatus) and melon (Cucumis melo) plants with leaves exhibiting mosaic symptoms or chlorotic spotting, respectively, along with limited foliar distortion, predominantly on newer growth, were observed in commercial fields throughout Yuma County, AZ, and Imperial County, CA, in fall 2023. Older leaves also exhibited yellowing typical of infection by whitefly-transmitted viruses common in the region, and whiteflies (Bemisia tabaci) were prevalent in fields. Symptomatic plants were tested using a multiplex RT-PCR for cucurbit yellow stunting disorder virus (CYSDV), cucurbit chlorotic yellows virus (CCYV), squash vein yellowing virus (SqVYV), and cucurbit aphid-borne yellows virus (CABYV) (Mondal et al., 2023), and separately for cucurbit leaf crumple virus (CuLCrV; F: TCAAAGGTTTCCCGCTCTGC, R: TCAAAGGTTTCCCGCTCTGC). Most plants were infected with CYSDV, which has been widely prevalent during the fall production season since its emergence in 2006, but not with the other tested viruses. Although the yellowing of older leaves near the crown was typical of symptoms resulting from CYSDV infection, the unusual symptoms on newer growth suggested the possibility of infection by a begomovirus. Rolling circle amplification and DNA sequencing of nucleic acid extract from a symptomatic melon plant collected in Dome Valley, AZ, identified the presence of watermelon chlorotic stunt virus (WmCSV), a bipartite begomovirus (Geminiviridae) (Jones et al., 1988; Lecoq, 2017), but no other begomoviruses. Sequencing of the complete WmCSV genome from this melon plant determined that DNA A (GenBank accession #PQ399661) shared 99% identity with WmCSV isolates from cactus (MW588390) and melon (KY124280) in Sonora, Mexico, and DNA B (PQ399662) shared 96% and 94% identity with WmCSV isolates from watermelon in Palestine (KC462553) and Sonora (KY124281), respectively. PCR with primers targeting WmCSV DNA A (F: CATGGAGATGAGGTTCCCCATTCT and R: GCTCGTAGGTCGATTCAACGGCCT) and DNA B (F: AGATACAACGTATGGGCAGCATT and R: TACAGATCCCARTCGATGAGACT) was used for secondary confirmation. Sequencing of amplified products confirmed both WmCSV DNA A and B in 12/15 initial melon samples. PCR using the DNA A or B primers confirmed the presence of WmCSV from additional watermelon and melon samples collected from Yuma County (31 positive/37 tested) and Imperial County (20/22). This is the first report of WmCSV in cucurbits in the United States (U.S.); the virus was previously identified in watermelon (Domínguez-Durán et al., 2018) and cactus (Opuntia auberi) from Sonora, Mexico, and from one cactus (O. cochenillifera), lamb's ears (Stachys byzantine), and an unknown Solanum plant from a botanical garden in Arizona (Fontanelle et al., 2021). The geographic distribution of WmCSV and the presence of similar symptoms in melon in 2022 suggests that it may have been present in the U.S. for at least a year. Interestingly, nearly all melon and some watermelon plants infected with WmCSV were co-infected with CYSDV. Most fall cucurbits in the Sonoran Desert production region become infected with CYSDV, and many are also infected with CCYV and/or SqVYV (Mondal et al., 2023). However, incidence of CCYV (4/63) and SqVYV (2/63) in the region was extremely low during fall 2023. Research is in progress to determine the potential impact of WmCSV on the cucurbit virus complex in the Sonoran Desert and the U.S. as a whole, and to understand the epidemiological factors that influence WmCSV infection and spread.

Short-Term Host Selection Pressure Has Little Effect on the Evolution of a Monoclonal Population of Verticillium dahliae Race 1.

Understanding pathogen evolution over time is vital for plant breeding and deployment of host resistance. In the context of a soilborne pathogen, the potential of host-directed evolution of a Verticillium dahliae race 1 isolate and genotypic variation of V. dahliae associated with two major hosts (lettuce and tomato) were determined. In total, 427 isolates were recovered over 6 years from a resistance screening nursery infested with a single V. dahliae race 1 isolate. In a separate study, an additional 206 isolates representing 163 and 43 isolates from commercial lettuce and tomato fields, respectively, were collected. Analyses of isolates recovered from the screening nursery over 6 years revealed no changes in the race and mating type composition but did uncover seven simple sequence repeat (SSR) variant genotypes. No significant genotypic variation in V. dahliae was observed between or within fields of either lettuce or tomato but pathogen populations were significantly differentiated between these two hosts. Replicated virulence assays of variant SSR genotypes on lettuce differential cultivars suggested no significant difference in virulence from the wild-type race 1 isolate introduced into the field. This suggests that deployed race 1 host resistance will be robust against the widespread race 1 populations in lettuce-growing regions at least for 6 years unless novel pathogen genotypes or races are introduced into the system.

Globally invading populations of the fungal plant pathogen Verticillium dahliae are dominated by multiple divergent lineages.

The spread of aggressive fungal pathogens into previously non-endemic regions is a major threat to plant health and food security. Analyses of the spatial and genetic structure of plant pathogens offer valuable insights into their origin, dispersal mechanisms and evolution, and have been useful to develop successful disease management strategies. Here, we elucidated the genetic diversity, population structure and demographic history of worldwide invasion of the ascomycete Verticillium dahliae, a soil-borne pathogen, using a global collection of 1100 isolates from multiple plant hosts and countries. Seven well-differentiated genetic clusters were revealed through discriminant analysis of principal components (DAPC), but no strong associations between these clusters and host/geographic origin of isolates were found. Analyses of clonal evolutionary relationships among multilocus genotypes with the eBURST algorithm and analyses of genetic distances revealed that genetic clusters represented several ancient evolutionary lineages with broad geographic distribution and wide host range. Comparison of different scenarios of demographic history using approximate Bayesian computations revealed the branching order among the different genetic clusters and lineages. The different lineages may represent incipient species, and this raises questions with respect to their evolutionary origin and the factors allowing their maintenance in the same areas and same hosts without evidence of admixture between them. Based on the above findings and the biology of V. dahliae, we conclude that anthropogenic movement has played an important role in spreading V. dahliae lineages. Our findings have implications for the development of management strategies such as quarantine measures and crop resistance breeding.

Dynamics of verticillium species microsclerotia in field soils in response to fumigation, cropping patterns, and flooding.

Verticillium dahliae is a soilborne, economically significant fungal plant pathogen that persists in the soil for up to 14 years as melanized microsclerotia (ms). Similarly, V. longisporum is a very significant production constraint on members of the family Brassicaceae. Management of Verticillium wilt has relied on methods that reduce ms below crop-specific thresholds at which little or no disease develops. Methyl bromide, a broad-spectrum biocide, has been used as a preplant soil fumigant for over 50 years to reduce V. dahliae ms. However, reductions in the number of ms in the vertical and horizontal soil profiles and the rate at which soil recolonization occurs has not been studied. The dynamics of ms in soil before and after methyl bromide+chloropicrin fumigation were followed over 3 years in six 8-by-8-m sites in two fields. In separate fields, the dynamics of ms in the 60-cm-deep vertical soil profile pre- and postfumigation with methyl bromide+chloropicrin followed by various cropping patterns were studied over 4 years. Finally, ms densities were assessed in six 8-by-8-m sites in a separate field prior to and following a natural 6-week flood. Methyl bromide+chloripicrin significantly reduced but did not eliminate V. dahliae ms in either the vertical or horizontal soil profiles. In field studies, increases in ms were highly dependent upon the crop rotation pattern followed postfumigation. In the vertical soil profile, densities of ms were highest in the top 5 to 20 cm of soil but were consistently detected at 60-cm depths. Six weeks of natural flooding significantly reduced (on average, approximately 65% in the total viable counts of ms) but did not eliminate viable ms of V. longisporum.

Screening of Wild and Cultivated Capsicum Germplasm Reveals New Sources of Verticillium Wilt Resistance.

Verticillium wilt caused by Verticillium dahliae is an important soilborne disease of pepper (Capsicum species) worldwide. Most commercial pepper cultivars lack resistance to this pathogen. Our objective was to identify resistance to two V. dahliae isolates in wild and cultivated Capsicum accessions from the core collection of the National Plant Germplasm System of the USDA. Screening of 397 Capsicum accessions against two V. dahliae isolates (Vdca59 and VdCf45) was performed in a greenhouse. Seventy-eight accessions selected from this screen were further evaluated in a follow-up experiment. In total, 21 (26.9%) and 13 (16.6%) Capsicum accessions tested were resistant to Verticillium wilt when inoculated with V. dahliae isolates VdCa59 and VdCf45, respectively. Eight accessions (Grif 9073, PI 281396, PI 281397, PI 438666, PI 439292, PI 439297, PI 555616, and PI 594125) were resistant to Verticillium wilt against both V. dahliae isolates. On the basis of Germplasm Resources Information Network data, two of the Capsicum annuum accessions (Grif 9073 and PI 439297) were also resistant to Phytophthora root rot disease. These sources of multiple disease resistance will be useful to pepper breeding programs.

Host Range of Verticillium isaacii and Verticillium klebahnii from Artichoke, Spinach, and Lettuce.

Verticillium is a genus that includes major vascular wilt pathogens. Recently, multilocus phylogenetic analyses of the genus identified five new species, including Verticillium isaacii and V. klebahnii, both of which occur in agricultural soils in coastal California and have been isolated from asymptomatic and diseased spinach and lettuce plants. Little data are available regarding their pathogenicity and virulence on a broader range of crops important to the region. Four isolates each of V. isaacii and V. klebahnii along with two reference isolates of V. dahliae races 1 and 2 were inoculated on eight crops (artichoke, cauliflower, eggplant, lettuce, pepper, tomato, spinach, and strawberry) in a greenhouse experiment. After 8 weeks, plants were assessed for disease severity to determine the relative host ranges of Verticillium isolates. Additionally, 13 lettuce lines resistant to race 1 and partially resistant to race 2 of V. dahliae were screened against V. isaacii and V. klebahnii to evaluate their responses. Three of four V. isaacii and four of four V. klebahnii isolates tested were nonpathogenic on all crops tested except those indicated below. One V. isaacii isolate caused wilt on artichoke and 'Salinas' lettuce and most isolates of both species caused varying degrees of Verticillium wilt on strawberry. Lettuce lines resistant to V. dahliae race 1 and partially resistant to V. dahliae race 2 also exhibited resistance to all of the isolates of V. isaacii and V. klebahnii. Thus, at least some isolates in the populations of V. isaacii and V. klebahnii have the potential to become significant pathogens of coastal California crops. However, resistance developed against V. dahliae also offers resistance to the pathogenic isolates of both species, at least in lettuce.

Nondefoliating and Defoliating Strains from Cotton Correlate with Races 1 and 2 of Verticillium dahliae.

Verticillium wilt, caused by Verticillium dahliae, is an important disease of cotton worldwide. Isolates of V. dahliae can be characterized as race 1 or race 2 based on the responses of differential cultivars of tomato and lettuce, or as defoliating or nondefoliating based on symptom expression in cotton. To investigate the frequency and distribution of races and defoliation phenotypes of cotton-associated V. dahliae, 317 isolates from China, Israel, Turkey, and the United States were tested by polymerase chain reaction (PCR) using defoliating, nondefoliating, and race 1- and race 2-specific primers DF/DR, NDF/NDR, VdAve1F/VdAve1R, and VdR2F/VdR2R, respectively. Of the total, 97.2% of isolates genotyped as defoliating were also characterized as race 2, while 90.8% of isolates genotyped as nondefoliating were also genotyped as race 1. To verify these results, three cotton cultivars-'FM 2484B2F' (highly resistant), '98M-2983' (highly susceptible), and 'CA4002' (partially resistant)-used as differentials were each inoculated with 10 isolates characterized by PCR: six defoliating/race 2 strains (GH1005, GH1021, HN, XJ2008, XJ592, and reference strain Ls17) and four nondefoliating/race 1 strains (GH1015, GH1016, GH1020, and reference strain Ls16). All defoliating/race 2 isolates except for Ls17 caused defoliation on 98M-2983 and CA4002. Isolate Ls17 caused defoliation on 98M-2983 only. The nondefoliating/race 1 isolates caused Verticillium wilt symptoms devoid of defoliation on 98M-2983. The greenhouse assays confirmed the molecular identification of race and defoliation phenotype. Although the existence of races has not been previously established among V. dahliae isolates from cotton, the long-established nondefoliating and defoliating population structure corresponded with V. dahliae races 1 and 2, respectively.

Verticillium dahliae race 2-specific PCR reveals a high frequency of race 2 strains in commercial spinach seed lots and delineates race structure.

Two pathogenic races of Verticillium dahliae have been described on lettuce and tomato. Host resistance to race 1 is governed by plant immune receptors that recognize the race 1-specific fungal effector Ave1. Only partial resistance to race 2 exists in lettuce. Although polymerase chain reaction (PCR) assays are available to identify race 1, no complementary test exists to positively identify race 2, except for lengthy pathogenicity assays on host differentials. Using the genome sequences of two isolates of V. dahliae, one each from races 1 and 2, we identified potential markers and PCR primers to distinguish the two races. Several primer pairs based on polymorphisms between the races were designed and tested on reference isolates of known race. One primer pair, VdR2F-VdR2R, consistently yielded a 256-bp amplicon in all race 2 isolates exclusively. We screened DNA from 677 V. dahliae isolates, including 340 from spinach seedlots, with the above primer pair and a previously published race 1-specific primer pair. DNA from isolates that did not amplify with race 1-specific PCRs amplified with the race 2-specific primers. To validate this, two differential lines of lettuce were inoculated with 53 arbitrarily selected isolates from spinach seed and their pathogenicity and virulence were assessed in a greenhouse. The reactions of the differential cultivars strongly supported the PCR data. V. dahliae race structure was investigated in crops in coastal California and elsewhere using primers specific to the two races. All artichoke isolates from California were race 1, whereas nearly all tomato isolates were race 2. Isolates from lettuce, pepper, and strawberry from California as well as isolates from spinach seed from two of four countries comprised both races, whereas only race 2 was observed in cotton, mint, olive, and potato. This highlights the importance of identifying resistance against race 2 in different hosts. The technique developed in this study will benefit studies in ecology, population biology, disease surveillance, and epidemiology at local and global scales, and resistance breeding against race 2 in lettuce and other crops.

Phenotypic and Molecular Diversity of Cochliobolus sativus Populations from Wheat.

Spot blotch, caused by Cochliobolus sativus, is a devastating foliar disease of wheat in Nepal and in the Northern Great Plains of the United States. However, limited information on variation in virulence and genetic structure of C. sativus from wheat is available. In this study, pathogenic variation of 96 isolates of C. sativus from the Hill and Plain areas in Nepal (n = 48) and in the Central and Northern areas in North Dakota (n = 48) were evaluated on 12 differential wheat lines. DNA polymorphisms in all isolates were analyzed using eight selected amplified fragment length polymorphism primer combinations. Phenotypic data analysis showed the isolates varied greatly and were classified into 47 pathotypes. Cluster analysis indicated the isolates fell into three distinct groups with low, intermediate, and high virulence. Population genetic analysis revealed significant linkage disequilibrium ( = 0.066 to 0.292), indicating that sexual reproduction plays little or no role in evolution and disease epidemiology in wheat fields. Furthermore, the corrected standardized fixation index (G″ST = 0.05 and 0.02) showed no evidence of genetic differentiation in C. sativus populations. Collectively, these results confirmed high pathogenic and molecular diversity in the C. sativus populations collected from wheat foliar infections and will be useful to assist in developing resistant cultivars to manage this disease.

Pathogenic and genetic diversity of Xanthomonas translucens pv. undulosa in North Dakota.

Bacterial leaf streak (BLS), caused by Xanthomonas translucens pv. undulosa, has become more prevalent recently in North Dakota and neighboring states. From five locations in North Dakota, 226 strains of X. translucens pv. undulosa were collected and evaluated for pathogenicity and then selected strains were inoculated on a set of 12 wheat cultivars and other cereal hosts. The genetic diversity of all strains was determined using repetitive sequence-based polymerase chain reaction (rep-PCR) and insertion sequence-based (IS)-PCR. Bacterial strains were pathogenic on wheat and barley but symptom severity was greatest on wheat. Strains varied greatly in aggressiveness, and wheat cultivars also showed differential responses to several strains. The 16S ribosomal DNA sequences of the strains were identical, and distinct from those of the other Xanthomonas pathovars. Combined rep-PCR and IS-PCR data produced 213 haplotypes. Similar haplotypes were detected in more than one location. Although diversity was greatest (≈92%) among individuals within a location, statistically significant (P ≤ 0.001 or 0.05) genetic differentiation among locations was estimated, indicating geographic differentiation between pathogen populations. The results of this study provide information on the pathogen diversity in North Dakota, which will be useful to better identify and characterize resistant germplasm.

Genetic differentiation at microsatellite loci among populations of Mycosphaerella graminicola from California, Indiana, Kansas, and North Dakota.

Mycosphaerella graminicola causes Septoria tritici blotch (STB) in wheat (Triticum aestivum) and is considered one of the most devastating pathogens of that crop in the United States. Although the genetic structures of M. graminicola populations from different countries have been analyzed using various molecular markers, relatively little is known about M. graminicola populations from geographically distinct areas of the United States and, in particular, of those from spring versus winter wheat. These are exposed to great differences in environmental conditions, length and season of host-free periods, and resistance sources used in geographically separated wheat breeding programs. Thus, there is more likely to be genetic differentiation between populations from spring versus winter wheat than there is among those within each region. To test this hypothesis, 330 single-spore isolates of M. graminicola representing 11 populations (1 from facultative winter wheat in California, 2 from spring wheat in North Dakota, and 8 from winter wheat in Indiana and Kansas) were analyzed for mating type frequency and for genetic variation at 17 microsatellite or simple-sequence repeat (SSR) loci. Analysis of clone-corrected data revealed an equal distribution of both mating types in the populations from Kansas, Indiana, and North Dakota, but a deviation from a 1:1 ratio in the California population. In total, 306 haplotypes were detected, almost all of which were unique in all 11 populations. High levels of gene diversity (H = 0.31 to 0.56) were observed within the 11 populations. Significant (P ≤ 0.05) gametic disequilibrium, as measured by the index of association (rBarD), was observed in California, one Indiana population (IN1), and three populations (KS1, KS2, and KS3) in Kansas that could not be explained by linkage. Corrected standardized fixation index (G″(ST)) values were 0.000 to 0.621 between the 11 populations and the majority of pairwise comparisons were statistically significant (P ≤ 0.001), suggesting some differentiation between populations. Analysis of molecular variance showed that there was a small but statistically significant level of genetic differentiation between populations from spring versus winter wheat. However, most of the total genetic variation (>98%) occurred within spring and winter wheat regions while <2% was due to genetic differentiation between these regions. Taken together, these results provide evidence that sexual recombination occurs frequently in the M. graminicola populations sampled and that most populations are genetically differentiated over the major spring- and winter-wheat-growing regions of the United States.

Association mapping of quantitative resistance to Phaeosphaeria nodorum in spring wheat landraces from the USDA National Small Grains Collection.

Stagonospora nodorum blotch (SNB), caused by Phaeosphaeria nodorum, is a destructive disease of wheat (Triticum aestivum) found throughout the United States. Host resistance is the only economically feasible option for managing the disease; however, few SNB-resistant wheat cultivars are known to exist. In this study, we report findings from an association mapping (AM) of resistance to P. nodorum in 567 spring wheat landraces of diverse geographic origin. The accessions were evaluated for seedling resistance to P. nodorum in a greenhouse. Phenotypic data and 625 polymorphic diversity array technology (DArT) markers have been used for linkage disequilibrium (LD) and association analyses. The results showed that seven DArT markers on five chromosomes (2D, 3B, 5B, 6A, and 7A) were significantly associated with resistance to P. nodorum. Genetic regions on 2D, 3B, and 5B correspond to previously mapped quantitative trait loci (QTL) conferring resistance to P. nodorum whereas the remaining QTL appeared to be novel. These results demonstrate that the use of AM is an effective method for identifying new genomic regions associated with resistance to P. nodorum in spring wheat landraces. Additionally, the novel resistance found in this study could be useful in wheat breeding aimed at controlling SNB.

Identification and Characterization of Novel Isolates of Pyrenophora tritici-repentis from Arkansas.

Tan spot, caused by Pyrenophora tritici-repentis, is an important foliar disease of wheat (Triticum aestivum) worldwide. In a preliminary study, P. tritici-repentis isolates from Arkansas were shown to vary in virulence relative to isolates from other regions of the United States. Therefore, the aim of the current study was to characterize both pathogenic and molecular variations in P. tritici-repentis isolates from Arkansas. The virulence of 93 isolates of P. tritici-repentis was evaluated by inoculating five differential wheat cultivars/lines. Based on virulence phenotypes, 63 isolates were classified as race 1, and 30 isolates were assigned to race 3. A subset of 42 isolates was selected for molecular characterization with the presence or absence of the ToxA and ToxB genes. The results showed that 36 isolates out of 42 tested by polymerase chain reaction (PCR) and Southern analysis lacked the ToxA and ToxB genes. Six isolates harboring the ToxA and ToxB genes induced necrosis and chlorosis on Glenlea and 6B365, respectively. Thirteen ToxA gene-deficient isolates also caused necrosis and chlorosis on Glenlea and 6B365, respectively; however, they did not fit current race classification. In contrast, the remaining 23 ToxA gene-deficient isolates did not cause necrosis, but induced chlorosis on 6B365, showing a disease profile for race 3. When the virulence of AR LonB2 (an isolate with unclassified race) was compared with known races 1, 3, and 5 of P. tritici-repentis on 20 winter wheat cultivars from Arkansas, the virulence phenotypes differed substantially. Taken together, the ToxA and ToxB gene-deficient isolates of P. tritici-repentis that induce necrosis and/or chlorosis may produce a novel toxin(s) on wheat.

Tsn1-mediated host responses to ToxA from Pyrenophora tritici-repentis.

The toxin sensitivity gene Tsn1 interacts with Ptr ToxA (ToxA), a host-selective toxin produced by the necrotrophic fungus Pyrenophora tritici-repentis. The molecular mechanisms associated with cell death in sensitive wheat cultivars following ToxA application are not well understood. To address this question, we used the Affymetrix GeneChip Wheat Genome Array to compare gene expression in a sensitive wheat cultivar possessing the Tsn1 gene with the insensitive wheat cv. Nec103, which lacks the Tsn1 gene. This analysis was performed at early timepoints after infiltration with ToxA (e.g., 0.5 to 12 h postinfiltration [hpi]); at this time, ToxA is known to internalize into mesophyll cells without visible cell death symptoms. Gene expression also was monitored at later timepoints (24 to 48 hpi), when ToxA causes extensive damage in cellular compartments and visible cell death. At both early and late timepoints, numerous defense-related genes were induced (2- to 197-fold increases) and included genes involved in the phenylpropanoid pathway, lignification, and the production of reactive oxygen species (ROS). Furthermore, a subset of host genes functioning in signal transduction, metabolism, and as transcription factors was induced as a consequence of the Tsn1-ToxA interaction. Nine genes known to be involved in the host defense response and signaling pathways were selected for analysis by quantitative real-time polymerase chain reaction, and the expression profiles of these genes confirmed the results obtained in microarray experiments. Histochemical analyses of a sensitive wheat cultivar showed that H(2)O(2) was present in leaves undergoing cell death, indicating that ROS signaling is a major event involved in ToxA-mediated cell death. The results suggest that recognition of ToxA via Tsn1 triggers transcriptional reprogramming events similar to those reported for avirulence-resistance gene interactions, and that host-derived genes play an important role in the modulation of susceptibility to P. tritici-repentis.

Proteome and metabolome analyses reveal differential responses in tomato -Verticillium dahliae-interactions.

Verticillium dahliae colonizes vascular tissue and causes vascular discoloration in susceptible hosts. Two well-defined races exist in V. dahliae populations from tomato and lettuce. In this study, proteins and metabolites obtained from stems of race 1-incompatible (Beefsteak) and -compatible (Early Pak) tomato cultivars were characterized. A total of 814 and 584 proteins in Beefsteak; and 456 and 637 proteins in Early Pak were identified in stem extracts of plants inoculated with races 1 and 2, respectively. A significant number of defense-related proteins were expressed in each tomato-V. dahliae interaction, as anticipated. However, phenylalanine ammonia-lyase (PAL), an important defense-associated enzyme of the phenylpropanoid pathway, in addition to remorin 1, NAD-dependent epimerase/dehydratase, and polyphenol oxidase were uniquely expressed in the incompatible interaction. Compared with the uninoculated control, significant overexpression of gene ontology terms associated with lignin biosynthesis, phenylpropanoid pathway and carbohydrate methylation were identified exclusively in the incompatible interaction. Phenolic compounds known to be involved in plant defense mechanisms were at higher levels in the incompatible relative to the compatible interactions. Based on our findings, PAL and enzymes involved defense-related secondary metabolism and the strengthening of cell walls is likely critical to confer resistance to race 1 of V. dahliae in tomato. SIGNIFICANCE: Verticillium dahliae, a soilborne fungal pathogen and a widely distributed fungal pathogen, colonizes vascular tissue and causes vascular discoloration in roots and stems, leaf wilting, and death of susceptible plant hosts. It causes billions of dollars in annual crop losses all over the world. The study focused on the proteomic and metabalomic of V. dahliae interactions (incompatible with Beefsteak and compatible with Early Pak tomato cultivars). Based on our findings, PAL and enzymes involved defense-related secondary metabolism and the strengthening of cell walls is likely critical to confer resistance to race 1 of V. dahliae in tomato.

Genome-wide association study reveals novel quantitative trait Loci associated with resistance to multiple leaf spot diseases of spring wheat.

Accelerated wheat development and deployment of high-yielding, climate resilient, and disease resistant cultivars can contribute to enhanced food security and sustainable intensification. To facilitate gene discovery, we assembled an association mapping panel of 528 spring wheat landraces of diverse geographic origin for a genome-wide association study (GWAS). All accessions were genotyped using an Illumina Infinium 9K wheat single nucleotide polymorphism (SNP) chip and 4781 polymorphic SNPs were used for analysis. To identify loci underlying resistance to the major leaf spot diseases and to better understand the genomic patterns, we quantified population structure, allelic diversity, and linkage disequilibrium. Our results showed 32 loci were significantly associated with resistance to the major leaf spot diseases. Further analysis identified QTL effective against major leaf spot diseases of wheat which appeared to be novel and others that were previously identified by association analysis using Diversity Arrays Technology (DArT) and bi-parental mapping. In addition, several identified SNPs co-localized with genes that have been implicated in plant disease resistance. Future work could aim to select the putative novel loci and pyramid them in locally adapted wheat cultivars to develop broad-spectrum resistance to multiple leaf spot diseases of wheat via marker-assisted selection (MAS).

Maintenance of sex-related genes and the co-occurrence of both mating types in Verticillium dahliae.

Verticillium dahliae is a cosmopolitan, soilborne fungus that causes a significant wilt disease on a wide variety of plant hosts including economically important crops, ornamentals, and timber species. Clonal expansion through asexual reproduction plays a vital role in recurring plant epidemics caused by this pathogen. The recent discovery of recombination between clonal lineages and preliminary investigations of the meiotic gene inventory of V. dahliae suggest that cryptic sex appears to be rare in this species. Here we expanded on previous findings on the sexual nature of V. dahliae. Only 1% of isolates in a global collection of 1120 phytopathogenic V. dahliae isolates contained the MAT1-1 idiomorph, whereas 99% contained MAT1-2. Nine unique multilocus microsatellite types comprised isolates of both mating types, eight of which were collected from the same substrate at the same time. Orthologs of 88 previously characterized sex-related genes from fungal model systems in the Ascoymycota were identified in the genome of V. dahliae, out of 93 genes investigated. Results of RT-PCR experiments using both mating types revealed that 10 arbitrarily chosen sex-related genes, including MAT1-1-1 and MAT1-2-1, were constitutively expressed in V. dahliae cultures grown under laboratory conditions. Ratios of non-synonymous (amino-acid altering) to synonymous (silent) substitutions in V. dahliae MAT1-1-1 and MAT1-2-1 sequences were indistinguishable from the ratios observed in the MAT genes of sexual fungi in the Pezizomycotina. Patterns consistent with strong purifying selection were also observed in 18 other arbitrarily chosen V. dahliae sex-related genes, relative to the patterns in orthologs from fungi with known sexual stages. This study builds upon recent findings from other laboratories and mounts further evidence for an ancestral or cryptic sexual stage in V. dahliae.