Molecular insights using spatial transcriptomics of the distal lung in congenital diaphragmatic hernia.

Abnormal pulmonary vascular development and function in congenital diaphragmatic hernia (CDH) is a significant factor leading to pulmonary hypertension. The lung is a very heterogenous organ and has marked cellular diversity that is differentially responsive to injury and therapeutic agents. Spatial transcriptomics provides the unmatched capability of discerning the differences in the transcriptional signature of these distinct cell subpopulations in the lung with regional specificity. We hypothesized that the distal lung parenchyma (selected as a region of interest) would show a distinct transcriptomic profile in the CDH lung compared with control (normal lung). We subjected lung sections obtained from male and female CDH and control neonates to spatial transcriptomics using the Nanostring GeoMx platform. Spatial transcriptomic analysis of the human CDH and control lung revealed key differences in the gene expression signature. Increased expression of alveolar epithelial-related genes (SFTPA1 and SFTPC) and angiogenesis-related genes (EPAS1 and FHL1) was seen in control lungs compared with CDH lungs. Response to vitamin A was enriched in the control lungs as opposed to abnormality of the coagulation cascade and TNF-alpha signaling via NF-kappa B in the CDH lung parenchyma. In male patients with CDH, higher expression of COL1A1 (ECM remodeling) and CD163 was seen. Increased type 2 alveolar epithelial cells (AT-2) and arterial and lung capillary endothelial cells were seen in control lung samples compared with CDH lung samples. To the best of our knowledge, this is the first use of spatial transcriptomics in patients with CDH that identifies the contribution of different lung cellular subpopulations in CDH pathophysiology and highlights sex-specific differences.NEW & NOTEWORTHY This is the first use of spatial transcriptomics in patients with congenital diaphragmatic hernia (CDH) that identifies the contribution of different lung cellular subpopulations in CDH pathophysiology and highlights sex-specific differences.

Development of polymorphic markers in the immune gene complex loci of cattle.

The addition of cattle health and immunity traits to genomic selection indices holds promise to increase individual animal longevity and productivity, and decrease economic losses from disease. However, highly variable genomic loci that contain multiple immune-related genes were poorly assembled in the first iterations of the cattle reference genome assembly and underrepresented during the development of most commercial genotyping platforms. As a consequence, there is a paucity of genetic markers within these loci that may track haplotypes related to disease susceptibility. By using hierarchical assembly of bacterial artificial chromosome inserts spanning 3 of these immune-related gene regions, we were able to assemble multiple full-length haplotypes of the major histocompatibility complex, the leukocyte receptor complex, and the natural killer cell complex. Using these new assemblies and the recently released ARS-UCD1.2 reference, we aligned whole-genome shotgun reads from 125 sequenced Holstein bulls to discover candidate variants for genetic marker development. We selected 124 SNPs, using heuristic and statistical models to develop a custom genotyping panel. In a proof-of-principle study, we used this custom panel to genotype 1,797 Holstein cows exposed to bovine tuberculosis (bTB) that were the subject of a previous GWAS study using the Illumina BovineHD array. Although we did not identify any significant association of bTB phenotypes with these new genetic markers, 2 markers exhibited substantial effects on bTB phenotypic prediction. The models and parameters trained in this study serve as a guide for future marker discovery surveys particularly in previously unassembled regions of the cattle genome.

Students' Engagement in and Perceptions of Blended Learning in a Clinical Module in a Veterinary Degree Program.

Blended learning has received much interest in higher education as a way to increase learning efficiency and effectiveness. By combining face-to-face teaching with technology-enhanced learning through online resources, students can manage their own learning. Blended methods are of particular interest in professional degree programs such as veterinary medicine in which students need the flexibility to undertake intra- and extramural activities to develop the range of competencies required to achieve professional qualification. Yet how veterinary students engage with blended learning activities and whether they perceive the approach as beneficial is unclear. We evaluated blended learning through review of student feedback on a 4-week clinical module in a veterinary degree program. The module combined face-to-face sessions with online resources. Feedback was collected by means of a structured online questionnaire at the end of the module and log data collected as part of a routine teaching audit. The features of blended learning that support and detract from students' learning experience were explored using quantitative and qualitative methods. Students perceived a benefit from aspects of face-to-face teaching and technology-enhanced learning resources. Face-to-face teaching was appreciated for practical activities, whereas online resources were considered effective for facilitating module organization and allowing flexible access to learning materials. The blended approach was particularly appreciated for clinical skills in which students valued a combination of visual resources and practical activities. Although we identified several limitations with online resources that need to be addressed when constructing blended courses, blended learning shows potential to enhance student-led learning in clinical courses.

NWChem: Past, present, and future.

Specialized computational chemistry packages have permanently reshaped the landscape of chemical and materials science by providing tools to support and guide experimental efforts and for the prediction of atomistic and electronic properties. In this regard, electronic structure packages have played a special role by using first-principle-driven methodologies to model complex chemical and materials processes. Over the past few decades, the rapid development of computing technologies and the tremendous increase in computational power have offered a unique chance to study complex transformations using sophisticated and predictive many-body techniques that describe correlated behavior of electrons in molecular and condensed phase systems at different levels of theory. In enabling these simulations, novel parallel algorithms have been able to take advantage of computational resources to address the polynomial scaling of electronic structure methods. In this paper, we briefly review the NWChem computational chemistry suite, including its history, design principles, parallel tools, current capabilities, outreach, and outlook.

Radiotherapy versus transoral robotic surgery and neck dissection for oropharyngeal squamous cell carcinoma (ORATOR): an open-label, phase 2, randomised trial.

BACKGROUND: Transoral robotic surgery (TORS) with concurrent neck dissection has supplanted radiotherapy in the USA as the most common treatment for oropharyngeal squamous cell carcinoma (OPSCC), yet no randomised trials have compared these modalities. We aimed to evaluate differences in quality of life (QOL) 1 year after treatment. METHODS: The ORATOR trial was an investigator-initiated, multicentre, international, open-label, parallel-group, phase 2, randomised study. Patients were enrolled at six hospitals in Canada and Australia. We randomly assigned (1:1) patients aged 18 years or older, with Eastern Cooperative Oncology Group scores of 0-2, and with T1-T2, N0-2 (≤4 cm) OPSCC tumour types to radiotherapy (70 Gy, with chemotherapy if N1-2) or TORS plus neck dissection (with or without adjuvant chemoradiotherapy, based on pathology). Following stratification by p16 status, patients were randomly assigned using a computer-generated randomisation list with permuted blocks of four. The primary endpoint was swallowing-related QOL at 1 year as established using the MD Anderson Dysphagia Inventory (MDADI) score, powered to detect a 10-point improvement (a clinically meaningful change) in the TORS plus neck dissection group. All analyses were done by intention to treat. This study is registered with ClinicalTrials.gov (NCT01590355) and is active, but not currently recruiting. FINDINGS: 68 patients were randomly assigned (34 per group) between Aug 10, 2012, and June 9, 2017. Median follow-up was 25 months (IQR 20-33) for the radiotherapy group and 29 months (23-43) for the TORS plus neck dissection group. MDADI total scores at 1 year were mean 86·9 (SD 11·4) in the radiotherapy group versus 80·1 (13·0) in the TORS plus neck dissection group (p=0·042). There were more cases of neutropenia (six [18%] of 34 patients vs none of 34), hearing loss (13 [38%] vs five [15%]), and tinnitus (12 [35%] vs two [6%]) reported in the radiotherapy group than in the TORS plus neck dissection group, and more cases of trismus in the TORS plus neck dissection group (nine [26%] vs one [3%]). The most common adverse events in the radiotherapy group were dysphagia (n=6), hearing loss (n=6), and mucositis (n=4), all grade 3, and in the TORS plus neck dissection group, dysphagia (n=9, all grade 3) and there was one death caused by bleeding after TORS. INTERPRETATION: Patients treated with radiotherapy showed superior swallowing-related QOL scores 1 year after treatment, although the difference did not represent a clinically meaningful change. Toxicity patterns differed between the groups. Patients with OPSCC should be informed about both treatment options. FUNDING: Canadian Cancer Society Research Institute Grant (#701842), Ontario Institute for Cancer Research Clinician-Scientist research grant, and the Wolfe Surgical Research Professorship in the Biology of Head and Neck Cancers grant.

Network meta-analysis comparing techniques and outcomes of stump closure after distal pancreatectomy.

BACKGROUND: The incidence of postoperative pancreatic fistula (POPF) after distal pancreatectomy remains high, and different pancreatic stump closure techniques have been used to reduce the incidence. A network meta-analysis was undertaken to compare the most frequently performed pancreatic stump closure techniques after distal pancreatectomy and determine the technique associated with the lowest POPF rate. METHODS: A systematic search of the Scopus, PubMed, MEDLINE and Embase databases was conducted to identify eligible RCTs. The primary outcome was the occurrence of clinically relevant POPF. Secondary outcomes were duration of operation, blood loss, intrabdominal collections, postoperative complications and 30-day mortality. RESULTS: Sixteen RCTs including 1984 patients and eight different pancreatic stump closure techniques were included in the network meta-analysis. Patch coverage of the pancreatic stump (round ligament or seromuscular patch) after stapler or suture closure ranked best, with the lowest rates of clinically relevant POPF, lowest volume of intraoperative blood loss, fewer intra-abdominal abscesses, and lower rates of overall complications and 30-day mortality. Round ligament patch closure outperformed seromuscular patch closure in preventing clinically relevant POPF with a significantly larger cohort for comparative analysis. Pancreaticoenteric anastomotic closure consistently ranked poorly for most reported postoperative outcomes. CONCLUSION: Patch coverage after stapler or suture closure has the lowest POPF rate and best outcomes among stump closure techniques after distal pancreatectomy.

ANTECEDENTES: La incidencia de fístula pancreática (postoperative pancreatic fistula, POPF) tras una pancreatectomía distal sigue siendo alta y se han utilizado diferentes técnicas para el cierre del muñón pancreático con la intención de reducir su incidencia. Se realizó un metaanálisis en red para comparar las técnicas de cierre del muñón pancreático realizadas con más frecuencia después de la pancreatectomía distal y determinar qué técnica se asocia a una menor tasa de POPF. MÉTODOS: Se realizó una búsqueda sistemática en las bases de datos Scopus, PubMed, Medline y EMBASE de los RCTs que podían ser incluidos en estudio. La variable principal fue la aparición de POPF clínicamente relevante. Las variables secundarias fueron el tiempo operatorio, la pérdida de sangre, las colecciones intraabdominales, las complicaciones postoperatorias y la mortalidad a los 30 días. RESULTADOS: En el metaanálisis se incluyeron 16 RCTs con 1.984 pacientes y 8 técnicas diferentes de cierre del muñón pancreático. Los mejores resultados (menor tasa de POPF clínicamente relevante, menor pérdida sanguínea intraoperatoria, menor número de abscesos intraabdominales, menor tasa de complicaciones generales y menor mortalidad a los 30 días) se obtuvieron con el refuerzo del muñón pancreático con parches (de ligamento redondo o seromuscular), seguidos del grapado quirúrgico o la sutura simple. El cierre con parche del ligamento redondo fue superior al parche seromuscular en la prevención de POPF clínicamente relevante en una cohorte suficiente para el análisis estadístico comparativo. Los peores resultados en la mayoría de las variables postoperatorias se obtuvieron con el cierre simple. CONCLUSIÓN: En la pancreatectomía distal, la menor tasa de POPF y los mejores resultados perioperatorios se obtuvieron con el refuerzo con parches, seguidos del grapado quirúrgico o la sutura simple.

Students with specific learning disabilities experiences of pre-registration physiotherapy education: a qualitative study.

BACKGROUND: Attainment gaps for students with disabilities have been noted in pre-registration physiotherapy courses in the UK. Previous research suggests disclosure, lack of staff knowledge and poor communication between University and placement sites may be relevant, but these are limited to small case studies with students with visual or physical disabilities. The purpose of this study was to explore disabled physiotherapy students' experiences of their education in order to elucidate factors that may influence success. METHODS: Qualitative study drawing on phenomenological traditions. Four focus groups including 15 students with disabilities were conducted. Transcripts were analysed thematically. Procedures for transparency and rigour such as member checking and peer debriefing were implemented. RESULTS: Three major themes were derived from data. "It was quite a relief" explores the personal and social implications of diagnosis. "They're not natural" focuses on academic assessment and the specifics of adjustments made and not made within that context. "My dyslexia doesn't switch off" explores the inaccessibility of the learning environment and dissects the contrast between the 24-h nature of having a specific learning condition and the somewhat piecemeal nature of adjustments during their education. CONCLUSIONS: This study indicates that having a specific learning disability or anxiety creates a number of hurdles to success in physiotherapy education. Most were within the University setting and were perceived to result from staff ignorance or piecemeal approaches to inclusion. A lack of consistency alongside facilitated dialogue and acknowledgement of enhancements results in frustration, ambiguity towards disclosure and reinforcement of a deficit model. Such an approach belies the intention of the profession and the NHS and does not maximise the potential of widening participation.

The interaction of Lolium latent virus major coat protein with ankyrin repeat protein NbANKr redirects it to chloroplasts and modulates virus infection.

The Lolium latent virus (LoLV) major coat protein sequence contains a typical chloroplast transit peptide (cTP) domain. In infected Nicotiana benthamiana leaf tissue, LoLV coat proteins can be detected at the chloroplast. In transient expression, several N-terminal deletions of the CP sequence, increasing in length, result in disruption of the domain functionality, markedly affecting intracellular localization. A yeast two-hybrid-based study using LoLV CP as bait identified several potentially interacting Arabidopsis host proteins, most of them with chloroplast-linked pathways. One of them, an ankyrin repeat protein, was studied in detail. The N. benthamiana homologue (NbANKr) targets chloroplasts, is able to co-localize with LoLV CP at chloroplast membranes in transient expression and shows a robust interaction with LoLV CP in vivo by BiFC, which has been confirmed by yeast two-hybrid data. Silencing NbANKr genes in N. benthamiana plants, prior to challenging with LoLV by mechanical inoculation, affects LoLV infection, significantly reducing the level of viral RNA in young leaves, compared to levels in control plants, and suggesting an inhibition of virus movement. Silencing of NbANKr has no obvious effect on plant phenotype, but is able to interfere with LoLV infection, opening the way for a new strategy for virus infection control.

Impact of portal vein infiltration and type of venous reconstruction in surgery for borderline resectable pancreatic cancer.

BACKGROUND: The International Study Group of Pancreatic Surgery (ISGPS) recommends operative exploration and resection of pancreatic cancers in the presence of reconstructable mesentericoportal axis involvement. However, there is no consensus on the ideal method of vascular reconstruction. The effect of depth of tumour invasion of the vessel wall on outcome is also unknown. METHODS: This was a retrospective cohort study of pancreaticoduodenectomy with vein resection for T3 adenocarcinoma of the head of the pancreas across nine centres. Outcome measures were overall survival based on the impact of the depth of tumour infiltration of the vessel wall, and morbidity, in-hospital mortality and overall survival between types of venous reconstruction: primary closure, end-to-end anastomosis and interposition graft. RESULTS: A total of 229 patients underwent portal vein resection; 129 (56·3 per cent) underwent primary closure, 64 (27·9 per cent) had an end-to-end anastomosis and 36 (15·7 per cent) an interposition graft. There was no difference in overall morbidity (26 (20·2 per cent), 14 (22 per cent) and 9 (25 per cent) respectively; P = 0·817) or in-hospital mortality (6 (4·7 per cent), 2 (3 per cent) and 2 (6 per cent); P = 0·826) between the three groups. One hundred and six patients (47·5 per cent) had histological evidence of vein involvement; 59 (26·5 per cent) had superficial invasion (tunica adventitia) and 47 (21·1 per cent) had deep invasion (tunica media or intima). Median survival was 18·8 months for patients who had primary closure, 27·6 months for those with an end-to-end anastomosis and 13·0 months among patients with an interposition graft. There was no significant difference in median survival between patients with superficial, deep or no histological vein involvement (20·8, 21·3 and 13·3 months respectively; P = 0·111). Venous tumour infiltration was not associated with decreased overall survival on multivariable analysis. CONCLUSION: In this study, there was no difference in morbidity between the three modes of venous reconstruction, and overall survival was similar regardless of tumour infiltration of the vein.

Root morphology and seed and leaf ionomic traits in a Brassica napus L. diversity panel show wide phenotypic variation and are characteristic of crop habit.

BACKGROUND: Mineral nutrient uptake and utilisation by plants are controlled by many traits relating to root morphology, ion transport, sequestration and translocation. The aims of this study were to determine the phenotypic diversity in root morphology and leaf and seed mineral composition of a polyploid crop species, Brassica napus L., and how these traits relate to crop habit. Traits were quantified in a diversity panel of up to 387 genotypes: 163 winter, 127 spring, and seven semiwinter oilseed rape (OSR) habits, 35 swede, 15 winter fodder, and 40 exotic/unspecified habits. Root traits of 14 d old seedlings were measured in a 'pouch and wick' system (n = ~24 replicates per genotype). The mineral composition of 3-6 rosette-stage leaves, and mature seeds, was determined on compost-grown plants from a designed experiment (n = 5) by inductively coupled plasma-mass spectrometry (ICP-MS). RESULTS: Seed size explained a large proportion of the variation in root length. Winter OSR and fodder habits had longer primary and lateral roots than spring OSR habits, with generally lower mineral concentrations. A comparison of the ratios of elements in leaf and seed parts revealed differences in translocation processes between crop habits, including those likely to be associated with crop-selection for OSR seeds with lower sulphur-containing glucosinolates. Combining root, leaf and seed traits in a discriminant analysis provided the most accurate characterisation of crop habit, illustrating the interdependence of plant tissues. CONCLUSIONS: High-throughput morphological and composition phenotyping reveals complex interrelationships between mineral acquisition and accumulation linked to genetic control within and between crop types (habits) in B. napus. Despite its recent genetic ancestry (<10 ky), root morphology, and leaf and seed composition traits could potentially be used in crop improvement, if suitable markers can be identified and if these correspond with suitable agronomy and quality traits.

High-throughput phenotyping (HTP) identifies seedling root traits linked to variation in seed yield and nutrient capture in field-grown oilseed rape (Brassica napus L.).

Background and Aims Root traits can be selected for crop improvement. Techniques such as soil excavations can be used to screen root traits in the field, but are limited to genotypes that are well-adapted to field conditions. The aim of this study was to compare a low-cost, high-throughput root phenotyping (HTP) technique in a controlled environment with field performance, using oilseed rape (OSR; Brassica napus) varieties. Methods Primary root length (PRL), lateral root length and lateral root density (LRD) were measured on 14-d-old seedlings of elite OSR varieties (n = 32) using a 'pouch and wick' HTP system (∼40 replicates). Six field experiments were conducted using the same varieties at two UK sites each year for 3 years. Plants were excavated at the 6- to 8-leaf stage for general vigour assessments of roots and shoots in all six experiments, and final seed yield was determined. Leaves were sampled for mineral composition from one of the field experiments. Key Results Seedling PRL in the HTP system correlated with seed yield in four out of six (r = 0·50, 0·50, 0·33, 0·49; P < 0·05) and with emergence in three out of five (r = 0·59, 0·22, 0·49; P < 0·05) field experiments. Seedling LRD correlated positively with leaf concentrations of some minerals, e.g. calcium (r = 0·46; P < 0·01) and zinc (r = 0·58; P < 0·001), but did not correlate with emergence, general early vigour or yield in the field. Conclusions Associations between PRL and field performance are generally related to early vigour. These root traits might therefore be of limited additional selection value, given that vigour can be measured easily on shoots/canopies. In contrast, LRD cannot be assessed easily in the field and, if LRD can improve nutrient uptake, then it may be possible to use HTP systems to screen this trait in both elite and more genetically diverse, non-field-adapted OSR.

Hypoxanthine uptake by skeletal muscle microvascular endothelial cells from equilibrative nucleoside transporter 1 (ENT1)-null mice: effect of oxidative stress.

Adenosine is an endogenous regulator of vascular tone. This activity of adenosine is terminated by its uptake and metabolism by microvascular endothelial cells (MVEC). The predominant transporter involved is ENT1 (equilibrative nucleoside transporter subtype 1). MVEC also express the nucleobase transporter (ENBT1) which is involved in the cellular flux of adenosine metabolites such as hypoxanthine. Changes in either of these transport systems would impact the bioactivity of adenosine and its metabolism, including the formation of oxygen free radicals. MVEC isolated from skeletal muscle of ENT1(+/+) and ENT1(-/-) mice were subjected to oxidative stress induced by simulated ischemia/reperfusion or menadione. The functional activities of ENT1 and ENBT1 were assessed based on zero-trans influx kinetics of radiolabeled substrates. There was a reduction in the rate of ENBT1-mediated hypoxanthine uptake by ENT1(+/+) MVEC treated with menadione or after exposure to conditions that simulate ischemia/reperfusion. In both cases, the superoxide dismutase mimetic MnTMPyP attenuated the loss of ENBT1 activity, implicating superoxide radicals in the response. In contrast, MVEC isolated from ENT1(-/-) mice showed no reduction in ENBT1 activity upon treatment with menadione or simulated ischemia/reperfusion, but they did have a significantly higher level of catalase activity relative to ENT1(+/+) MVEC. These data suggest that ENBT1 activity is decreased in MVEC in response to the increased superoxide radical that is associated with ischemia/reperfusion injury. MVEC isolated from ENT1(-/-) mice do not show this reduction in ENBT1, possibly due to increased catalase activity.

First Report of Plantago asiatica mosaic virus in Imported Asiatic and Oriental Lilies (Lilium hybrids) in the United States.

Asiatic and Oriental hybrid lilies (Lilium sp., Liliaceae) are bulbous ornamentals valued for their flowers. Bulbs of several varieties of each lily type, imported from the Netherlands, were purchased in spring 2013 from retail nurseries and grown in a cool greenhouse; additional bulbs were obtained in 2014. After flowering in 2013, but prior to leaf senescence, necrotic streaking was observed in midstem leaves of several plants. RNA extracted from leaves of several individual plants was subjected to reverse-transcription-polymerase chain reaction (RT-PCR) assay using NSNC-odT primed cDNA and PCR with primers PxDeg/BNSNC or potyS/BNSNC to amplify potexvirus/carlavirus and potyvirus products respectively (2,3,4). Sequencing of a c. 1.7-kb PCR product from one lily identified Lily symptomless virus (LSV). Mechanical inoculation of pooled lily leaf samples to Nicotiana benthamiana, N. glutinosa, and Chenopodium quinoa (not hosts of LSV) yielded chlorotic or necrotic local lesions on C. quinoa and systemic mosaic with necrotic spotting, streaking, or apical necrosis on N. benthamiana; electron microscopy revealed potexvirus-like flexuous particles. RT-PCR from C. quinoa and N. benthamiana with PxDeg/BNSNC yielded a c. 1.3-kb product, which was cloned and sequenced; the consensus sequence (KM205357) had 98.7% nucleotide identity to a Dutch isolate of Plantago asiatica mosaic virus (PlAMV, KF471012; 78.5 to 87.8% to other isolates), and 99.0% coat protein amino acid identity to KF471012 (88.9 to 93.2% to other isolates). The 2013 lilies were stored overwinter at 4°C, and RNA was extracted from roots of individual bulbs. Primers PlAMV CP-F2 (TTCGTCACCCTCAGCGG) and PlAMV CP-R3 (AAACGGTAAAATACACACCGGG) were designed based on alignment of KM205357 with all PlAMV sequences available in GenBank. RT-PCR using PlAMV CP-F2/CP-R3 yielded products of the expected 511 bp from 20 bulbs and no product from a no-template control. ELISA of root and bulbscale samples using PlAMV-lily specific antibody and conjugate (a gift of R. Miglino, BKD, The Netherlands) confirmed PlAMV in seven of 20 bulbs positive by RT-PCR. Bioassay of PCR-positive lilies on N. benthamiana, C. quinoa, and Tetragonia expansa confirmed infection in three out of eight by both symptoms and ELISA. Altogether nine out of 13 Asiatic lilies (four of four cultivars: America, Connecticut King, Grand Cru, and Pink Pixie) and 11 Oriental lilies (cvs. Stargazer and Starfighter) were found to be infected with PlAMV by RT-PCR, of which seven were confirmed by bioassay and/or ELISA. Bulbs obtained in 2014 were tested only by ELISA; five of 18 Asiatic lilies (three of six cultivars: Connecticut King, Crimson Pixie, and Yellow Electric) and three of 13 Oriental lilies (three of six cultivars: Anastasia, Casa Blanca, and Garden Party) were found to be infected. PlAMV was reported in lilies in the Netherlands in 2010, with losses of up to 80% in greenhouse cut-flower production (1). The Nandina mosaic isolate (PlAMV-NMV) has been known in the United States since 1976 (5), but PlAMV infection of lily has not previously been documented in the United States. Both RT-PCR and ELISA tests also detected PlAMV-NMV. The degree of damage observed in the Netherlands suggests that growers should seek bulb stocks free of PlAMV. References: (1) Anonymous. https://www.vwa.nl/txmpub/files/?p_file_id=2001424 , accessed June 11, 2014. (2) S. Chen et al. Acta Biochim. Biophys. Sin. 43:465, 2011. (3) J. Hammond et al. Arch. Virol. 151:477, 2006. (4) J. Hammond and M. Reinsel. Acta Hort. 901:119, 2011. (5) P. Moreno et al. Proc. Am. Phytopathol. Soc. 3:319, 1976.

Antigenic variation of foot-and-mouth disease virus serotype A.

The current measures to control foot-and-mouth disease (FMD) include vaccination, movement control and slaughter of infected or susceptible animals. One of the difficulties in controlling FMD by vaccination arises due to the substantial diversity found among the seven serotypes of FMD virus (FMDV) and the strains within these serotypes. Therefore, vaccination using a single vaccine strain may not fully cross-protect against all strains within that serotype, and therefore selection of appropriate vaccines requires serological comparison of the field virus and potential vaccine viruses using relationship coefficients (r1 values). Limitations of this approach are that antigenic relationships among field viruses are not addressed, as comparisons are only with potential vaccine virus. Furthermore, inherent variation among vaccine sera may impair reproducibility of one-way relationship scores. Here, we used antigenic cartography to quantify and visualize the antigenic relationships among FMD serotype A viruses, aiming to improve the understanding of FMDV antigenic evolution and the scope and reliability of vaccine matching. Our results suggest that predicting antigenic difference using genetic sequence alone or by geographical location is not currently reliable. We found co-circulating lineages in one region that were genetically similar but antigenically distinct. Nevertheless, by comparing antigenic distances measured from the antigenic maps with the full capsid (P1) sequence, we identified a specific amino acid substitution associated with an antigenic mismatch among field viruses and a commonly used prototype vaccine strain, A22/IRQ/24/64.

First Detection of Ligustrum necrotic ringspot virus, Cucumber mosaic virus, and Alternanthera mosaic virus in Mazus reptans in the United States.

Mazus reptans N.E. Br (creeping mazus; Phrymaceae) is a perennial flowering groundcover plant. A plant of M. reptans 'Alba' with mild mosaic symptoms was obtained from a Maryland nursery in 2010. Electron microscopy (EM) revealed slightly flexuous particles of 595 to 674 nm in length and smaller fragments, typical of carlaviruses. This sample was analyzed using a recently-developed Universal Plant Virus Microarray (UPVM [4]), and UPVM results confirmed by RT-PCR and sequencing. For UPVM analysis, complementary DNA (cDNA) was prepared from total nucleic acid extracts using a combination of oligo(dT) and random (6- to 9-mer) primers and high copy sequences (primarily ribosomal) were reduced using duplex-specific nuclease. Treated cDNA was labeled by incorporation of amino-allyl dUTP, followed by coupling of Cy3 dye and hybridization to a UPVM slide (4). Analysis of UPVM hybridization results using associated Uchip and T-Predict software (4) identified Ligustrum necrotic ringspot virus (LNRV; Carlavirus) and Cucumber mosaic virus subgroup I (CMV sgI; Cucumovirus). To confirm the UPVM results, we used NSNC-odT (3) primed cDNA, and LNRV-specific primer Lig1 (GTTGATCCTTTAGGTTTACAGGT) paired with NSNC-odT to amplify the 3' region of the LNRV genome. We used random-primed cDNA with generic cucumovirus coat protein (CP) primers CPTALL-5/CPTALL-3 (2), and CMV subgroup (sg)-specific primers CMV I(F)/CMV I(R) and CMV II(F)/CMV II(R) (1) to amplify the full CMV CP gene or internal portions. A ~1.35 kb PCR product from the LNRV-specific amplification was cloned, sequenced (GenBank Accession No. KJ187250), and found to have 84.6% nt identity to the LNRV-type (EU074853), with 97.0% CP amino acid (AA) identity and 94.7% nucleic acid binding protein (NABP) AA identity to LNRV-Impatiens (GQ411367) excluding an additional 14 N-terminal AA present in the NABP of both the type and impatiens isolates. CMV sgI-specific primers yielded a product of ~600 bp, and generic primers CPTALL-5/CPTALL-3 a ~940 bp product; no product was obtained with sgII-specific primers. The full CP gene product was cloned and sequenced (KJ486271), and had 99% nt identity to CMV-Fny (U20668), a subgroup I isolate, and <75% to characterized sgII isolates (5); CMV-Mazus CP had 100% AA identity to CMV-Fny, and <82.6% to the sgII isolates. One plant of purple M. reptans obtained in 2012, and four purple-flowered and three 'Alba' in 2014 from three separate sources, also showed mild mosaic. LNRV was detected by EM of carlavirus-like particles (2012 sample), and in all eight plants by LNRV-specific PCR and sequencing (KJ187247 for 2012 sample). Alternanthera mosaic virus (AltMV; Potexvirus) was also detected from two plants of 'Alba' by PCR, sequencing, bioassay (Nicotiana benthamiana, Chenopodium quinoa), and ELISA (3). To our knowledge, this is the first report of LNRV, CMV, or AltMV in M. reptans, a commonly grown groundcover plant. While CMV and AltMV are known to have wide host ranges, LNRV has previously been reported only from Ligustrum and Impatiens sp. The mild symptoms hinder symptom-based detection, and M. reptans may thus serve as a conduit for LNRV, CMV, and AltMV infection of other ornamentals. References: (1) S. Chen et al. Acta Biochim. Biophys. Sin. 43:465, 2011. (2) S. K. Choi et al. J. Virol. Meth. 83:67, 1999. (3) J. Hammond et al. Arch. Virol. 151:477, 2006. (4) J. Hammond et al. Phytopathology 102(S4):49, 2012. (5) J. Thompson and M. Tepfer. J. Gen. Virol. 90:2293, 2009.

An investigation of the impact of regular use of the Wii Fit to improve motor and psychosocial outcomes in children with movement difficulties: a pilot study.

BACKGROUND: Children with Developmental Co-ordination Disorder (DCD) experience poor motor and psychosocial outcomes. Interventions are often limited within the healthcare system, and little is known about how technology might be used within schools or homes to promote the motor skills and/or psychosocial development of these children. This study aimed to evaluate whether short, regular school-based sessions of movement experience using a commercially available home video game console (Nintendo's Wii Fit) would lead to benefits in both motor and psychosocial domains in children with DCD. METHODS: A randomized crossover controlled trial of children with movement difficulties/DCD was conducted. Children were randomly assigned to an intervention (n = 10) or comparison (n = 8) group. The intervention group spent 10 min thrice weekly for 1 month using Wii Fit during the lunch break, while the comparison group took part in their regular Jump Ahead programme. Pre- and post-intervention assessments considered motor proficiency, self-perceived ability and satisfaction and parental assessment of emotional and behavioural problems. RESULTS: Significant gains were seen in motor proficiency, the child's perception of his/her motor ability and reported emotional well-being for many, but not all children. CONCLUSIONS: This study provides preliminary evidence to support the use of the Wii Fit within therapeutic programmes for children with movement difficulties. This simple, popular intervention represents a plausible method to support children's motor and psychosocial development. It is not possible from our data to say which children are most likely to benefit from such a programme and particularly what the dose and duration should be. Further research is required to inform across these and other questions regarding the implementation of virtual reality technologies in therapeutic services for children with movement difficulties.

The impact of urgency of umbilical hernia repair on adverse outcomes in patients with cirrhosis: a population-based cohort study from England.

INTRODUCTION: Umbilical hernia is common in patients with cirrhosis; however, there is a paucity of dedicated studies on postoperative outcomes in this group of patients. This population-based cohort study aimed to determine the outcomes after emergency and elective umbilical hernia repair in patients with cirrhosis. METHODS: Two linked electronic healthcare databases from England were used to identify all patients undergoing umbilical hernia repair between January 2000 and December 2017. Patients were grouped into those with and without cirrhosis and stratified by severity into compensated and decompensated cirrhosis. Length of stay, readmission, 90-day case fatality rate and the odds ratio of 90-day postoperative mortality were defined using logistic regression. RESULTS: In total, 22,163 patients who underwent an umbilical hernia repair were included and 297 (1.34%) had cirrhosis. More patients without cirrhosis had an elective procedure, 86% compared with 51% of those with cirrhosis (P < 0.001). In both the elective and emergency settings, patients with cirrhosis had longer hospital length of stay (elective: 0 vs 1 day, emergency: 2 vs 4 days, P < 0.0001) and higher readmission rates (elective: 4.87% vs 11.33%, emergency:11.39% vs 29.25%, P < 0.0001) than those without cirrhosis. The 90-day case fatality rates were 2% and 0.16% in the elective setting, and 19% and 2.96% in the emergency setting in patients with and without cirrhosis respectively. CONCLUSION: Emergency umbilical hernia repair in patients with cirrhosis is associated with poorer outcomes in terms of length of stay, readmissions and mortality at 90 days.

Exploring the Association of Male Sex With Adverse Outcomes in Severe Bronchopulmonary Dysplasia: A Retrospective, Multicenter Cohort Study.

BACKGROUND: Bronchopulmonary dysplasia (BPD) is a significant contributor to morbidity and death in infants who are born premature. Male sex is an independent risk factor for the development of BPD. However, whether male sex is associated with adverse outcomes that occur after formal diagnosis of severe BPD prior to hospital discharge remains unclear. RESEARCH QUESTION: Is male sex associated with a higher risk of adverse outcomes in infants with established severe BPD? STUDY DESIGN AND METHODS: A retrospective, multicenter cohort study of infants enrolled in the BPD Collaborative Registry from January 1, 2015, to June 29, 2022, was performed. Demographics, clinical characteristics, and outcomes were stratified by sex (ie, male vs female). Regression modeling was used to estimate the association of sex with the primary composite outcome of death or tracheostomy at hospital discharge. RESULTS: We identified 1,156 infants with severe BPD, defined at 36 weeks postmenstrual age by the National Institutes of Health 2001 consensus definition. The cohort was predominantly male (59% male infants, 41% female infants). However, rates of mechanical ventilation at 36 weeks postmenstrual age (ie, type 2 severe BPD) did not differ by sex. Overall mortality rates within the cohort were low (male infants, 5.3%; female infants, 3.6%). The OR of death or tracheostomy for male-to-female infants was 1.0 (95% CI, 0.7-1.5). INTERPRETATION: Our results lead us to speculate that, although sex is an important variable that contributes to the development and pathogenesis of severe BPD, it does not appear to be associated with adverse outcomes in this cohort of infants with established disease. The surprising results raise important questions surrounding the temporal role of biological sex in the development of severe BPD and its progression during the neonatal ICU stay. As we explore the phenotypes and endotypes of BPD, it is imperative to consider how sex modulates the disease from birth through hospital discharge.

Early-stage squamous cell carcinoma of the oropharynx: radiotherapy vs. trans-oral robotic surgery (ORATOR)--study protocol for a randomized phase II trial.

BACKGROUND: The incidence of oropharyngeal squamous cell carcinoma (OPSCC) has markedly increased over the last three decades due to newly found associations with human papillomavirus (HPV) infection. Primary radiotherapy (RT) is the treatment of choice for OPSCC at most centers, and over the last decade, the addition of concurrent chemotherapy has led to a significant improvement in survival, but at the cost of increased acute and late toxicity. Transoral robotic surgery (TORS) has emerged as a promising alternative treatment, with preliminary case series demonstrating encouraging oncologic, functional, and quality of life (QOL) outcomes. However, comparisons of TORS and RT in a non-randomized fashion are susceptible to bias. The goal of this randomized phase II study is to compare QOL, functional outcomes, toxicity profiles, and survival following primary RT (± chemotherapy) vs. TORS (± adjuvant [chemo] RT) in patients with OPSCC. METHODS/DESIGN: The target patient population comprises OPSCC patients who would be unlikely to require chemotherapy post-resection: Tumor stage T1-T2 with likely negative margins at surgery; Nodal stage N0-2, ≤3 cm in size, with no evidence of extranodal extension on imaging. Participants will be randomized in a 1:1 ratio between Arm 1 (RT ± chemotherapy) and Arm 2 (TORS ± adjuvant [chemo] RT). In Arm 1, patients with N0 disease will receive RT alone, whereas N1-2 patients will receive concurrent chemoradiation. In Arm 2, patients will undergo TORS along with selective neck dissections, which may be staged. Pathologic high-risk features will be used to determine the requirement for adjuvant radiotherapy +/- chemotherapy. The primary endpoint is QOL score using the M.D. Anderson Dysphagia Inventory (MDADI), with secondary endpoints including survival, toxicity, other QOL outcomes, and swallowing function. A sample of 68 patients is required. DISCUSSION: This study, if successful, will provide a much-needed randomized comparison of the conventional strategy of primary RT vs. the novel strategy of primary TORS. The trial is designed to provide a definitive QOL comparison between the two arms, and to inform the design of an eventual phase III trial for survival outcomes. TRIAL REGISTRATION: NCT01590355.