A recurrent rare intronic variant in CAPN3 alters mRNA splicing and causes autosomal recessive limb-girdle muscular dystrophy-1 in three Pakistani pedigrees.

Autosomal recessive limb-girdle muscular dystrophy-1 (LGMDR1) is an autosomal recessive disorder characterized by progressive weakness of the proximal limb and girdle muscles. Biallelic mutations in CAPN3 are reported frequently to cause LGMDR1. Here, we describe 11 individuals from three unrelated consanguineous families that present with typical features of LGMDR1 that include proximal muscle wasting, weakness of the upper and lower limbs, and elevated serum creatine kinase. Whole-exome sequencing identified a rare homozygous CAPN3 variant near the exon 2 splice donor site that segregates with disease in all three families. mRNA splicing studies showed partial retention of intronic sequence and subsequent introduction of a premature stop codon (NM_000070.3: c.379 + 3A>G; p.Asp128Glyfs*15). Furthermore, we observe reduced CAPN3 expression in primary dermal fibroblasts derived from an affected individual, suggesting instability and/or nonsense-mediated decay of mutation-bearing mRNA. Genome-wide homozygosity mapping and single-nucleotide polymorphism analysis identified a shared haplotype and supports a possible founder effect for the CAPN3 variant. Together, our data extend the mutational spectrum of LGMDR1 and have implications for improved diagnostics for individuals of Pakistani origin.

CtIP Mutations Cause Seckel and Jawad Syndromes.

Seckel syndrome is a recessively inherited dwarfism disorder characterized by microcephaly and a unique head profile. Genetically, it constitutes a heterogeneous condition, with several loci mapped (SCKL1-5) but only three disease genes identified: the ATR, CENPJ, and CEP152 genes that control cellular responses to DNA damage. We previously mapped a Seckel syndrome locus to chromosome 18p11.31-q11.2 (SCKL2). Here, we report two mutations in the CtIP (RBBP8) gene within this locus that result in expression of C-terminally truncated forms of CtIP. We propose that these mutations are the molecular cause of the disease observed in the previously described SCKL2 family and in an additional unrelated family diagnosed with a similar form of congenital microcephaly termed Jawad syndrome. While an exonic frameshift mutation was found in the Jawad family, the SCKL2 family carries a splicing mutation that yields a dominant-negative form of CtIP. Further characterization of cell lines derived from the SCKL2 family revealed defective DNA damage induced formation of single-stranded DNA, a critical co-factor for ATR activation. Accordingly, SCKL2 cells present a lowered apoptopic threshold and hypersensitivity to DNA damage. Notably, over-expression of a comparable truncated CtIP variant in non-Seckel cells recapitulates SCKL2 cellular phenotypes in a dose-dependent manner. This work thus identifies CtIP as a disease gene for Seckel and Jawad syndromes and defines a new type of genetic disease mechanism in which a dominant negative mutation yields a recessively inherited disorder.

A Mini Literature Review of Probiotics: Transforming Gastrointestinal Health Through Evidence-Based Insights.

As our understanding of the intricate interaction between gut bacteria and human health continues to expand, so too has interest in the ability of probiotics to manage gut microbiota and confer multiple health benefits to the host. The mini literature review focuses on the expanding potential of the use of probiotics in GI health, with a focus on probiotics' potential therapeutic advantages in a variety of gastrointestinal (GI) illnesses. Probiotics play a significant role in managing diarrhea and symptoms of irritable bowel syndrome with diarrhea (IBS-D) by modulating gut microbial communities. Specific probiotic strains have been found to reduce the abundance of harmful bacteria, regulate inflammatory markers like interleukin 6, and improve GI symptoms such as abdominal discomfort and stool consistency. Additionally, probiotic blends have shown potential for preventing GI infections and alleviating GI pain in IBS-D patients. Studies have demonstrated that certain multi-strain probiotics, including Bifidobacterium and Lactobacillus species, can significantly increase the frequency of bowel movements and reduce the proportion of individuals experiencing constipation. It has also been found that probiotic supplementation may reduce the incidence of postoperative complications and mortality, particularly in patients undergoing colorectal adenocarcinoma surgery. Additionally, probiotics have been associated with decreased levels of pro-inflammatory cytokines and improved clinical outcomes in patients with colorectal cancer. Furthermore, probiotics have been associated with enhanced digestive tolerance, reduced GI inflammation, and prolonged clinical remission in certain UC patients. Studies have also shown that probiotics, administered either directly to infants or pregnant women during the perinatal stage, can alleviate symptoms such as inconsolable crying and irritation associated with infant colic, improve bowel movement frequency in cases of functional constipation, and enhance overall conditions in premature infants, including reducing regurgitation and improving feeding tolerance. The review addresses both encouraging results and challenges with probiotic therapy, while also arguing for more studies to elucidate underlying mechanisms and enhance therapeutic techniques. As we traverse the complex field of probiotic therapy in the treatment of GI illnesses, researchers, physicians, and other healthcare professionals can benefit from the informative information provided by this study.

Noncoding mutations of HGF are associated with nonsyndromic hearing loss, DFNB39.

A gene causing autosomal-recessive, nonsyndromic hearing loss, DFNB39, was previously mapped to an 18 Mb interval on chromosome 7q11.22-q21.12. We mapped an additional 40 consanguineous families segregating nonsyndromic hearing loss to the DFNB39 locus and refined the obligate interval to 1.2 Mb. The coding regions of all genes in this interval were sequenced, and no missense, nonsense, or frameshift mutations were found. We sequenced the noncoding sequences of genes, as well as noncoding genes, and found three mutations clustered in intron 4 and exon 5 in the hepatocyte growth factor gene (HGF). Two intron 4 deletions occur in a highly conserved sequence that is part of the 3' untranslated region of a previously undescribed short isoform of HGF. The third mutation is a silent substitution, and we demonstrate that it affects splicing in vitro. HGF is involved in a wide variety of signaling pathways in many different tissues, yet these putative regulatory mutations cause a surprisingly specific phenotype, which is nonsydromic hearing loss. Two mouse models of Hgf dysregulation, one in which an Hgf transgene is ubiquitously overexpressed and the other a conditional knockout that deletes Hgf from a limited number of tissues, including the cochlea, result in deafness. Overexpression of HGF is associated with progressive degeneration of outer hair cells in the cochlea, whereas cochlear deletion of Hgf is associated with more general dysplasia.

Intragenic deletions in the dystrophin gene in 211 Pakistani Duchenne muscular dystrophy patients.

BACKGROUND: Deletions of single or multiple exonic regions within the dystrophin gene can be detected using current molecular methods in approximately 65% of the patients with X-linked recessive neuromuscular disorder, Duchenne/Becker muscular dystrophy (DMD/BMD). Population-based variations in frequency and distribution of dystrophin gene deletions have been reported in DMD/BMD patients. In the present study, the first in the Pakistani population, frequency and distribution of deletions of 18 exons clustered in two hot spots within the dystrophin gene in 211 unrelated DMD patients were analyzed. METHODS: A total of 211 patients suffering from DMD were ascertained, and intragenic deletions within the dystrophin gene were detected on polymerase chain reaction amplification of the genomic DNA using 18 primer sets clustered within two major deletion hot spots. lovd v.1.1.0 software from the Leiden Muscular Dystrophy website has been used to predict in-frame and out-of-frame deletions. RESULTS: Intragenic deletions were detected in 86 patients (40.75%): 35 patients (40.69%) had deletions within the proximal hot spot, and 51 patients (59.30%) had deletions confined to the distal deletion hot spot of the dystrophin gene. The most frequently deleted exons were 50, 6, 47, 13 and 52 with deletion frequencies of 15.11%, 12.79%, 10.46%, 8.13%, and 4.65%, respectively. lovd v.1.1.0 predicted out-of-frame deletions in 67 DMD patients and in-frame deletions in 19 DMD patients. CONCLUSIONS: The observed proportion of intragenic deletions in the Pakistani population is relatively low, which is comparable with most of the Asian data. Also, deletions in 67 patients (77.9%) are in agreement with the frame-shift rule.

Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy.

OBJECTIVES: To identify the underlying gene mutation in a large consanguineous Pakistani family.  Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool.  Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM) like elevated serum creatine kinase (CK) levels, distal muscle weakness, myopathic changes in electromyography (EMG) and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT) in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X), which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein.  Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X) in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

Autosomal Recessive Primary Microcephaly (MCPH): clinical manifestations, genetic heterogeneity and mutation continuum.

Autosomal Recessive Primary Microcephaly (MCPH) is a rare disorder of neurogenic mitosis characterized by reduced head circumference at birth with variable degree of mental retardation. In MCPH patients, brain size reduced to almost one-third of its original volume due to reduced number of generated cerebral cortical neurons during embryonic neurogensis. So far, seven genetic loci (MCPH1-7) for this condition have been mapped with seven corresponding genes (MCPH1, WDR62, CDK5RAP2, CEP152, ASPM, CENPJ, and STIL) identified from different world populations. Contribution of ASPM and WDR62 gene mutations in MCPH World wide is more than 50%. By and large, primary microcephaly patients are phenotypically indistinguishable, however, recent studies in patients with mutations in MCPH1, WDR62 and ASPM genes showed a broader clinical and/or cellular phenotype. It has been proposed that mutations in MCPH genes can cause the disease phenotype by disturbing: 1) orientation of mitotic spindles, 2) chromosome condensation mechanism during embryonic neurogenesis, 3) DNA damage-response signaling, 4) transcriptional regulations and microtubule dynamics, 5) certain unknown centrosomal mechanisms that control the number of neurons generated by neural precursor cells. Recent discoveries of mammalian models for MCPH have open up horizons for researchers to add more knowledge regarding the etiology and pathophysiology of MCPH. High incidence of MCPH in Pakistani population reflects the most probable involvement of consanguinity. Genetic counseling and clinical management through carrier detection/prenatal diagnosis in MCPH families can help reducing the incidence of this autosomal recessive disorder.