RESUMEN
OBJECTIVES: The succession of microbial communities and intermediates during methane production was determined by pyrosequencing and GC-MS to investigate the mechanism of biomethanation enhancement from coal. RESULTS: The maximum methane production at 1.2 V was significantly higher than that at 0 V. Bacterial flora have been changed as a result of the addition of an electric field, e.g., the abundance of Pseudomonas significantly increased to enhance the coal degradation which improved the methane yield by facilitating the electron transfer. The fungal structure was also found stabilized by the electric field when compared to the control after 7 days of cultivation. The predominance of Methanosarcina could also stimulate interspecies electron transfer. The GC-MS analysis revealed that the electric field can selectively promote the metabolism of refractory intermediates such as esters and aromatics during coal biodegradation. CONCLUSION: The application of an electric field could enhance methane production from coal by changing the structure and succession of microbial communities, improving electron transfer, and enhancing the fermentation of intermediates during coal biodegradation.
Asunto(s)
Carbón Mineral , Microbiota , Carbón Mineral/microbiología , Bacterias/genética , Bacterias/metabolismo , Fermentación , Metano/metabolismoRESUMEN
Agaricus bisporus is one of the most commonly grown edible fungi in the world. In December 2021, brown blotch disease (2% incidence) was observed on the cap of A. bisporus, growing in a mushroom cultivation base in Guangxi, China. Initially, brown blotches (1-1.3 cm) appeared on the cap of A. bisporus, which expanded gradually as the cap grew. After two days, the infection penetrated inner tissues of fruiting bodies, and blotches were dark brown. For the isolation of causative agent(s), internal tissue samples of the infected stipes (5×5×5 mm) were sterilized in 75% ethanol for 30 s, rinsed three times with sterile deionized water (SDW), then, mashed in the sterile 2 ml Eppendorf tubes, 1000 µl SDW was added and the suspension was diluted into seven concentrations (10-1~10-7). Each suspension (120 µl) was spread on Luria Bertani (LB) medium and incubated for 24 hours at 28 °C. Morphological examination of the isolates was referred to Liu et al (2022). The dominant single colonies were whitish-grayish, smooth, convex. The cells were Gram-positive, non-flagellated, nonmotile, no pods or endospores formed, and no fluorescent pigments production on King's B medium (Solarbio). Amplified 16S rRNA (1351 bp; OP740790) of five colonies using universal primers 27f/1492r (Liu et al., 2022), exhibited 99.26% identity with Arthrobacter (Ar.) woluwensis. The partial sequences of the ATP synthase subunit beta gene (atpD) (677 bp; OQ262957), RNA polymerase subunit beta gene (rpoB) (848 bp; OQ262958), preprotein translocase subunit SecY gene (secY) (859 bp; OQ262959) and elongation factor Tu gene (tuf) (831 bp; OQ262960) genes of colonies were amplified using the method of Liu et al (2018), also exhibited more than 99% similarities to Ar. woluwensis. The biochemical tests for isolates (n=3) were performed via bacterial micro-biochemical reaction tubes (Hangzhou Microbial Reagent Co., LTD), and the results showed the same biochemical characteristics as Ar. woluwensis (Positive for esculin hydrolysis, urea, gelatinase, catalase, sorbitol, gluconate, salicin and arginine. Negative for citrate, nitrate reduction and rhamnose) (Funke et al., 1996). The isolates were identified as Ar. woluwensis based on morphological characteristics, biochemical tests and phylogenetic analysis. Pathogenicity tests were performed with bacterial suspensions (1 × 109 CFU/ml) after growing for 36 h in LB Broth at 28 °C, 160 rpm. 30 µl bacterial suspension was added to the cap and tissue of young A. bisporus. SDW was added as a negative control. All treatments were incubated at 20 °C and 80-85% humidity. The experiment was repeated three times with five caps and five tissues of young A. bisporus each time. Brown blotches were observed on all the parts of the inoculated caps and tissues after 24 h of inoculation. At 48 h, the inoculated caps turned dark brown while the infected tissues changed from brown to black and expanded to the entire tissue block giving a severely rotten appearance and foul odor. This disease symptoms were similar to those observed in the original samples. There were no lesions in the control group. After the pathogenicity test, the pathogen was re-isolated from the infected caps and tissues based on morphological characteristics, 16S rRNA sequences, and biochemical results, fulfilling Koch's postulates. Arthrobacter spp. are very widely distributed in the environment (Kim et al., 2008). To date, two studies have confirmed Arthrobacter spp. as a pathogen of edible fungi (Bessette, 1984; Wang et al., 2019). However, this is the first report of Ar. woluwensis causing brown blotch disease on A. bisporus. Our finding could contribute to developing phytosanitary and control treatments for this disease.
RESUMEN
Pleurotus pulmonarius is a popular and widely cultivated edible mushroom in China. In November 2021, white blotch disease (3% incidence) was observed on the cap of P. pulmonarius, growing in a mushroom farm in Nanning, China. Initially, white blotch (0.7-1.6 cm) appeared on the cap of the young P. pulmonarius, which expanded gradually as the cap grew. However, the fruiting bodies still grew well without rotting. The pathogen causing this phenomenon was isolated from infected cap tissues using a dilution plate technique, sections of tissue (approximately 5×5×5 mm) with white blotch were rinsed three times in sterile deionized water, then, mashed in the sterile 2 ml eppendorf tubes, 1000µl sterile water was added and the suspension was diluted into eight concentrations (10-1~10-8). From each concentration, 120µl suspension was spread on Luria Bertani (LB) medium and incubated for 24 hours at 28°C. Both 10-5 and 10-6 suspensions had single colonies, the dominant single colonies were picked and purified 2-3 times. The purified colonies were round, beige, and opaque, with a raised center and regular, smooth and moist margins. This bacterium is gram negative, short rod-shaped, single polar flagellum, motile, without pods or endospores, and produced fluorescent pigments on King's B medium. Amplified 16S rDNA (1396 bp; OM022022) of four randomly selected colonies using universal primers 27f/1492r, exhibited 100% identity with Pseudomonas (Ps.) mosselii. The partial sequences of the rpoB (1173bp; OM202622), rpoD (734bp; ON469579), gyrB (1383bp; OM202621) and recA (887bp; ON469580) genes of four selected colonies were amplified using primers LAPS5/LAFS27(Tayeb et al. 2005.), PsEG30F/PsEG790R (Mulet et al. 2009), gyrB-R/gyrB-F (Agaras et al. 2018) and recA-F (5'-3' ACGACAACAAGAAGCGCGCCTT)/recA-R (5'-3' CAATGGCCGGGTTCTCTTGCAGGTA) designed in this study, respectively, also exhibited 99%~100% similarities to Ps. mosselii. Phylogenetic analysis showed that isolates cluster with Ps. mosselii. The biochemical tests for isolates were performed via bacterial micro-biochemical reaction tubes (Hangzhou Microbial Reagent Co., LTD), and the results showed the same biochemical characteristics as Ps. mosselii (Positive for arginine dihydrolase, trisodium citrate, urea, lysine, arginine, ornithine and gelatin. Negative for glucosamine, lactose, galactose, rhamnose, maltose, sucrose, arabinose, mannose, xylose, esculoside, inositol, nitrate reduction and malonate) (Dabboussi et al.2002; Soto-Rodriguez et al. 2013). The isolates were identified as Ps. mosselii based on biochemical tests and phylogenetic analysis. This isolate was incubated in LB Broth at 28â, 160 rpm for 24h and the bacterial cells were collected by centrifugation at 4000 rpm for 10min. The collected bacterial cells were resuspended in sterile deionized water to make a bacterial suspension. For pathogenicity tests, 30µl of bacterial suspension (approximately 1x10^9 CFU/mL) was added to the surface of the cap (3-4cm) of young P. pulmonarius. Sterile deionized water was added as a negative control. All treatments were incubated at 22°C and 80-85% humidity. The experiment was repeated three times with three bags each time. 12 h later, white blotches were visible on all parts of the inoculated mushroom. This disease symptoms were similar to those observed in the original samples. However, no disease phenomena were observed in the negative control group. After the pathogenicity test, we obtained the same pathogen as the initially isolates from infected tissues based on morphological characteristics, 16S rDNA sequences, rpoB, rpoD, gyrB and recA sequences, and biochemical test results. Ps. mosselii was first isolated clinically and described by Dabboussi et al. (2002). It has shown to be pathogenic to Oreochromis niloticus and humans (Soto-Rodriguez et al. 2013; Peña et al. 2019; Leneveu-Jenvrin et al. 2013; Huang et al. 2018.). However, to the best of our knowledge, this is the first report of Ps. mosselii causing white blotch disease in P. pulmonarius worldwide, which negatively affects the commercial value of P. pulmonarius and requires attention of mushroom industry.
RESUMEN
Hydrocarbon contamination due to anthropogenic activities is a major environmental concern worldwide. The present study focuses on biochar prepared from fruit and vegetable waste and sewage sludge using a thermochemical approach and its application for the enhanced bioremediation (biostimulation and bioaugmentation) of diesel-polluted soil. The biochar was characterized using FTIR (Fourier-transform infrared spectroscopy), elemental analysis, surface area analysis, and pore analysis. Adsorption experiments showed that hydrocarbon degradation was attributed to biological processes rather than adsorption. The study found that various biochar amendments could significantly increase the rate of hydrocarbon biodegradation with removal efficiencies > 70%. Bioaugmentation using cow dung further improved the removal efficiency to 82%. Treatments showing the highest degree of removal efficiency indicated the presence of 27 different bacteria phyla with Proteobacteria and Actinobacteria as the most abundant phyla. The present study concludes that biochar amendments have great potential for enhancing the bioremediation of soils contaminated with diesel range hydrocarbons.
Asunto(s)
Petróleo , Contaminantes del Suelo/análisis , Animales , Biodegradación Ambiental , Bovinos , Carbón Orgánico , Monitoreo del Ambiente , Femenino , Hidrocarburos , Suelo , Microbiología del SueloRESUMEN
Coalbed methane (CBM) is an important unconventional energy source and accounts for a substantial portion of the overall natural gas production in the USA. The extraction of CBM generates significant amounts of produced water, where the withdrawal of groundwater may disturb the subsurface environment and aquifers. The release of toxic recalcitrant compounds from the coal seam is of great concern for those who use groundwater for irrigation and potable water sources. Experiments were conducted that determined a small fraction of coal carbon can be extracted and solubilized in water during the CBM formation and production. These soluble components included long-chain alkanes, aromatic hydrocarbons, and humic compounds. Biometer flask assays demonstrated that these compounds are bioamenable and can be potentially degraded by microorganisms to produce methane and carbon dioxide, where these biodegradation processes may further impact groundwater quality in the coal seam.
Asunto(s)
Carbón Mineral , Agua Subterránea/análisis , Metano/química , Gas Natural/análisis , Contaminantes Químicos del Agua/análisis , Carbono/análisis , Cromatografía de Gases y Espectrometría de Masas , Espectrometría de FluorescenciaRESUMEN
As a coarse-gained model, a super-thin elastic rod subjected to interfacial interactions is used to investigate the condensation of DNA in a multivalent salt solution. The interfacial traction between the rod and the solution environment is determined in terms of the Young-Laplace equation. Kirchhoff's theory of elastic rod is used to analyze the equilibrium configuration of a DNA chain under the action of the interfacial traction. Two models are established to characterize the change of the interfacial traction and elastic modulus of DNA with the ionic concentration of the salt solution, respectively. The influences of the ionic concentration on the equilibrium configuration of DNA are discussed. The results show that the condensation of DNA is mainly determined by competition between the interfacial energy and elastic strain energy of the DNA itself, and the interfacial traction is one of forces that drive DNA condensation. With the change of concentration, the DNA segments will undergo a series of alteration from the original configuration to the condensed configuration, and the spiral-shape appearing in the condensed configuration of DNA is independent of the original configuration.
Asunto(s)
ADN/química , Módulo de Elasticidad , Modelos Moleculares , Sales (Química)/química , Conformación de Ácido Nucleico , SolucionesRESUMEN
BACKGROUND: Agaricus bisporus is a globally important edible fungus. The occurrence of ginger blotch caused by Pseudomonas 'gingeri' during A. bisporus growth and post-harvest stages results in significant economic losses. The biotoxin monoacetylphloroglucinol (MAPG) produced by P. 'gingeri' is responsible for inducing ginger blotch on A. bisporus. However, the understanding of the toxic mechanisms of MAPG on A. bisporus remains limited, which hinders the precise control of ginger blotch disease in A. bisporus and the breeding of disease-resistant varieties. RESULTS: Integrating transcriptomic, metabolomic, and physiological data revealed that MAPG led to an increase in intracellular superoxide anion (O2 -) levels and lipid peroxidation in A. bisporus. MAPG changed the cellular membrane composition of A. bisporus, causing to damage membrane permeability. MAPG inhibited the expression of genes associated with the 19s subunit of the proteasome, thereby impeding cellular waste degradation in A. bisporus. Unlike melanin, MAPG stimulated the synthesis of flavonoids in A. bisporus, which might explain the manifestation of ginger-colored symptoms rather than browning. Meanwhile, the glutathione metabolism pathway in A. bisporus played a pivotal role in counteracting the cytotoxic effects of MAPG. Additionally, enhanced catalase activity and up-regulation of defense-related genes, including cytochrome P450s, Major Facilitator Superfamily (MFS), and ABC transporters, were observed. CONCLUSION: This study provides comprehensive insights into MAPG toxicity in A. bisporus and uncovers the detoxification strategies of A. bisporus against MAPG. The findings offer valuable evidence for precise control and breeding of resistant varieties against ginger blotch in A. bisporus. © 2024 Society of Chemical Industry.
Asunto(s)
Agaricus , Floroglucinol , Enfermedades de las Plantas , Pseudomonas , Enfermedades de las Plantas/microbiología , Floroglucinol/análogos & derivados , Floroglucinol/farmacología , Floroglucinol/metabolismoRESUMEN
Biogenic coalbed methane (CBM) is a developing clean energy source. However, it is unclear how the mechanisms of bio-methane production with different sizes of coal. In this work, pulverized coal (PC) and lump coal (LC) were used for methane production by mixed fungi-methanogen microflora. The lower methane production from LC was observed. The aromatic carbon of coal was degraded slightly by 2.17% in LC, while 11.28% in PC. It is attributed to the proportion of lignin-degrading fungi, especially Penicillium, which was reached 67.57% in PC on the 7th day, higher than that of 11.38% in LC. The results suggested that the limited interaction area in LC led to microorganisms hardly utilize aromatics. It also led the accumulation of aromatic organics in the fermentation broth in PC. Increasing the reaction area of coal and facilitating the conversion of aromatic carbon are suggested means to increase methane production in situ.
Asunto(s)
Biodegradación Ambiental , Carbón Mineral , Hongos , Lignina , Metano , Metano/metabolismo , Carbón Mineral/microbiología , Hongos/metabolismo , Hongos/clasificación , Lignina/metabolismo , Fermentación , Penicillium/metabolismoRESUMEN
A lab-scale gravity-driven bioreactor (GDB) was designed and constructed to evaluate the simultaneous treatment of black liquor and domestic wastewater. The GDB was operated with a mixture of black liquor and domestic wastewater at a ratio of 1:1 and maintained at an average organic loading rate of 1235 mg-COD/L-Day. The wastewater was fed to the primary sedimentation tank at a flow rate of approximately 12 mL/min and subsequently passed through serially connected anaerobic and aerobic chambers with the same flow rate. Each wastewater sample was allowed to undergo a hydraulic retention time of approximately 72 h, ensuring effective treatment. The GDB was actively operated for nine samples (W1-W9) at a weekly frequency. The entire process was conducted within the workstation's ambient temperature range of 30-35 °C to sustain microbial activity and treatment efficiency in an open environment. The performance of the GDB was evaluated in terms of various pollution indicators, including COD, BOD5, lignin removal, TDS, TSS, EC, PO43-, SO42-, microbial load (CFU/mL and MPN index), total nitrogen, and color reduction. The results showed that the GDB achieved promising treatment efficiencies: 84.5% for COD, 71.80% for BOD5, 82.8% for TDS, 100% for TSS, 74.71% for E.C., 67.25% for PO43-, 81% for SO42-, and 69.36% for TN. Additionally, about 80% reduction in lignin content and 57% color reduction were observed after the treatment. The GDB substantially reduced microbial load in CFU/mL (77.98%) and MPN (90%). This study marks the first to report on wastewater treatment from two different sources (black liquor and domestic wastewater) using a simple GDB design. Furthermore, it highlights the GDB's potential as a cost-effective, environmentally friendly, and efficient solution for wastewater treatment, with no need for supplementary chemical or physical agents and zero operational costs.
Asunto(s)
Aguas Residuales , Purificación del Agua , Eliminación de Residuos Líquidos/métodos , Lignina , Reactores BiológicosRESUMEN
The structural characteristics of the organic matter and biomarker distributions in Shengli lignite (SL) were comprehensively studied by combining a variety of modern analytical techniques and solvent extraction/thermal dissolution. Characterization of SL with Fourier transform infrared spectroscopy, X-ray photoelectron spectroscopy, solid 13C nuclear magnetic resonance spectroscopy and thermogravimetry showed that organic matter in SL is rich in oxygen functional groups, such as C-O, >C=O, and -COOH, and hydrogen bonds. The hydrogen bonds mainly include -OH···π, self-associated -OH, -OH···ether O, tightly bound cyclic -OH, -OH···N, -COOH dimers, and -SH···N. The highest content of organic nitrogen and sulfur on SL surface are pyrrole nitrogen and aromatic sulfur, respectively. The proportions of aromatic and aliphatic carbons in SL are about 58% and 39%, respectively. The aromatic carbon is mainly composed of protonated aromatic and aromatic bridged carbons; methylene carbon has the highest content among the aliphatic carbons, with chains of average length of 1.43 carbon atoms. The average number of aromatic structural units in the carbon skeleton of SL is about 3, and each aromatic structural unit contains an average of 1-2 substituent groups. Thermogravimetric analysis clarified the distribution of the main types of covalent bonds in SL and their possible cracking temperatures during pyrolysis. The extracts and soluble portion of thermal dissolution from SL were analyzed by a gas chromatograph/mass spectrometer, and a series of biomarkers were identified, mainly concentrated in petroleum ether extract and cyclohexane thermal soluble portion. These included long-chain n-alkanes, isoprenoid alkanes, long-chain n-alkenes, terpenoids, n-alkan-2-ones, long-chain n-alkylbenzene, and long-chain n-alkyltoluene. The comprehensive characterization of the organic matter and the distribution of related biomarkers provided an important scientific basis for understanding the molecular structural characteristics and geochemical information on SL.
RESUMEN
How to prescribe traction on boundary surface is still an open question in peridynamics. This problem is investigated in this paper. Through introducing the induced body force defined by boundary traction, the Silling's peridynamic motion equation is extended to a new formulation called the traction-associated peridynamic motion equation, which is verified to be compatible with the conservation laws of linear momentum and angular momentum. The energy conservation equation derived from the traction-associated peridynamic motion equation has the same form as that in the original peridynamics advanced by Silling. Therefore, the constitutive models of the original peridynamics can be directly applied to the traction-associated peridynamic motion equation. Some benchmark examples in the plane stress problems are calculated. The numerical solutions agree well with the classical elasticity solutions, and the volume correction and the surface correction are no longer needed in the numerical algorithm. These results show that the traction-associated peridynamic motion equation not only retains all advantages of the original peridynamics, but also can conveniently deal with the complex traction boundary conditions.
RESUMEN
The present study demonstrates the potential of an integrated vertical flow-constructed wetland (IVFCW) for simultaneously treating black liquor and domestic wastewater. IVFCW was operated and monitored for 12 samples with the frequency of one sample per week with the following specifications viz,4 L of wastewater, a blend of 1:1 of pulp and paper industry effluent (black liquor BL), and domestic wastewater, was fed daily in a continuous mode with organic loading rate (OLR) of 1230 mg COD/L-Day, at a temperature range of 40-45â (natural temperature of the workstation). Valves controlled each chamber's hydraulic retention time (HRT) of 3 days and flow rate of 10 mL/minute. The IVFCW showed remarkable efficiency in removing various pollutants, including total suspended solids (TSS) and total dissolved solids (TDS), by 100 % and 83 %, respectively, and organic contaminants such as chemical oxygen demand (COD) and biological oxygen demand (BOD) by 80 % and 81 %, respectively. Moreover, the IVFCW efficiently reduced nutrients such as sulfates (SO4-2), phosphates (PO4-3), and total nitrogen by about 81 %, 63 %, and 61 %, respectively. The treatment also led to the reduction of lignin content by 83 %. Microbiological analysis revealed a significant reduction in fecal coliforms, and microbial profiling of Typha latifolia roots confirmed the presence of bacteria involved in lignin degradation. Seed germination and seedling survival were found to be negativelyaffected by untreated wastewater in a phytotoxicity study, suggesting that the wastewater's toxic chemicals could be harmful to plant life.This study highlights the effectiveness of IVFCW as a sustainable, economically viable, and resilient wastewater treatment system for mitigating environmental concerns related to the release of untreated wastewater.
RESUMEN
BACKGROUND: Agaricus bisporus is the most widely cultivated and consumed mushroom worldwide. Pseudomonas 'gingeri' is the only pathogenic causative agent of ginger blotch in A. bisporus. Current research on mushroom pathogenic biotoxins is limited to P. tolaasii, which causes brown blotch, while understanding of P. 'gingeri' is lacking, therefore identifying the toxins produced by P. 'gingeri' and evaluating their toxicity on A. bisporus is essential for understanding its pathogenic mechanisms. RESULTS: A pathogenic bacterium isolated from fruiting bodies of A. bisporus with ginger blotch was identified as P. 'gingeri', and its main toxin identified as 2', 4', 6'-trihydroxyacetophenone monohydrate, also known as monoacetylphloroglucinol (MAPG). Its first known extraction from a mushroom pathogen is reported here. MAPG at 250 µg/mL significantly inhibited the host's mycelial growth, increased branching, caused the structure to become dense and resulted in folds appearing on the surface. An MAPG concentration of 750 µg/mL MAPG led to mycelial death. P. 'gingeri' had high MAPG production in medium containing 0.1 mol/L of either glucose or mannitol (4.30 and 1.85 µg/mL, respectively), and mycelia were inhibited by 69.6% and 41.1%, respectively. The MAPG content was significantly lower in other carbon source media. CONCLUSION: This work provides a detailed description of the structure and virulence of the P. 'gingeri' biotoxin, which has implications for understanding its pathogenic mechanism and for exploring precise control strategies for A. bisporus ginger blotch disease, such as the development of MAPG inhibitory factors. © 2023 Society of Chemical Industry.
Asunto(s)
Agaricus , Floroglucinol/análogos & derivados , Zingiber officinale , PseudomonasRESUMEN
This study focuses on the utilization of Aspergillus flavus(M-3) for the bioleaching mercury from coal, offering an alternative and environmentally to its clean utilization. The fungus was isolated from the soil near a high mercury coal mine in Lao Ying Shan (LYS), Guizhou. Utilizing direct mercury analysis, X-ray diffraction (XRD), and Fourier Transform-Infrared (FT-IR) analysis techniques, the transformation of mercury speciation, mineral components, and organic groups in the coal were analyzed before and after the bioleaching process. The findings of the study illustrated that the fungus M-3 exhibited a remarkable capacity for coal bioliquefaction and mercury leaching from LYS coal. Following a 15-day bioleaching process, a remarkable mercury leaching rate of 83.79% was achieved. Various forms of mercury speciation, including residue, organic matter, sulfide-bound, oxide-bound, exchangeable, and carbonate-bound forms, were released from the coal, with leaching rates ranging from 80.41% to 92.60%. XRD analysis indicated that the M-3 strain facilitated the dissolution of coal pyrite and the degradation of macromolecules, effectively loosening the coal structure. FT-IR analysis of raw and residual coal demonstrated the breakdown of the aromatic ring structure and introduced oxygen-containing functional groups by M-3. Overall, this study highlights the efficacy of bioliquefying coal using Aspergillus flavus (M-3) as a method for clean coal utilization while simultaneously bioleaching mercury.
RESUMEN
The potential geochemical information in the produced water of coalbed methane (CBM) wells is conducive to the exploration and development of CBM in the case that the produced water is primitive formation water. A total of 58 produced water samples collected from 13 CBM wells in the Daxing Mine, Tiefa Basin, were investigated. Ionic composition tests and stable isotope analysis were conducted to explore the geochemical characteristics and sources of produced water as well as the method for determining whether the produced water is primitive formation water. The results suggest that the fracking fluid for CBM stimulations is the main factor affecting the ion change of the produced water in the initial stage of drainage. The concentrations of Cl- and Ca2+ + Mg2+ could be taken as the indices to identify whether the produced water is primitive formation water. When the Cl- concentration is lower than 20 mEq/L and the Ca2+ + Mg2+ concentration is lower than 1 mEq/L, the produced water is close to the pristine formation water. Biogenic methanogenic activity may result in a high δ13CDIC and high concentrations of HCO3- in the pristine formation water in the Tiefa Basin. The data of δD and δ18O in the study area suggest that the formation water might come from atmospheric precipitation, which is later affected by evaporation and the water-rock reaction. The hydrogen isotope values in the produced water derived from the lower coal group display a substantial elevation compared to those from the upper coal group. This disparity in the hydrogen isotope composition presents an opportunity to utilize δD in produced water as a tool for distinguishing the formation water between these two groups.
RESUMEN
Biomethane generation by coal degradation not only can increase coalbed methane (CBM) reserves, namely, microbially enhanced coalbed methane (MECBM), but also has a significant effect on the pore structure of coal which is the key factor in CBM extraction. The transformation and migration of organics in coal are essential to pore development under the action of microorganisms. Here, the biodegradation of bituminous coal and lignite to produce methane and the cultivation with inhibition of methanogenic activity by 2-bromoethanesulfonate (BES) were performed to analyze the effect of biodegradation on coal pore development by determining the changes of the pore structure and the organics in culture solution and coal. The results showed that the maximum methane productions from bituminous coal and lignite were 117.69 µmol/g and 166.55 µmol/g, respectively. Biodegradation mainly affected the development of micropore whose specific surface area (SSA) and pore volume (PV) decreased while the fractal dimension increased. After biodegradation, various organics were generated which were partly released into culture solution while a large number of them remained in residual coal. The content of newly generated heterocyclic organics and oxygen-containing aromatics in bituminous coal was 11.21% and 20.21%. And the content of heterocyclic organics in bituminous coal was negatively correlated with SSA and PV but positively correlated with the fractal dimension which suggested that the retention of organics contributed greatly to the decrease of pore development. But the retention effect on pore structure was relatively poor in lignite. Besides, microorganisms were observed around fissures in both coal samples after biodegradation which would not be conducive to the porosity of coal on the micron scale. These results revealed that the effect of biodegradation on pore development of coal was governed by the combined action of organics degradation to produce methane and organics retention in coal whose contributions were antagonistic and determined by coal rank and pore aperture. The better development of MECBM needs to enhance organics biodegradation and reduce organics retention in coal.
Asunto(s)
Carbón Mineral , Metano , Biodegradación Ambiental , Metano/metabolismoRESUMEN
Introduction: Croatian superhigh-organic-sulfur Rasa coal had been mined for nearly 400 years. The release of hazardous trace elements (HTEs) and toxic organic pollutants (TOPs) into the local environment by coal mining, preparation, and combustion activities has resulted in pollution. Methods: In this study, the diversity and composition of microbial communities in estuarine sediment and soil samples as well as community function responses to the pollutants were investigated. Results: The results showed that PAH degradation does occur following 60 years of natural attenuation, the location is still heavily polluted by polycyclic aromatic hydrocarbons (PAHs) and HTEs. Microbial analyses have shown that high concentrations of PAHs have reduced the diversity and abundance of microbial communities. The pollution exerted an adverse, long-term impact on the microbial community structure and function in the brackish aquatic ecosystem. Microorganisms associated with the degradation of PAHs and sulfur-containing compounds have been enriched although the diversity and abundance of the microbial community have reduced. Fungi which are believed to be the main PAH degrader may play an important role initially, but the activity remains lower thereafter. It is the high concentrations of coal-derived PAHs, rather than HTEs, that have reduced the diversity and abundance of microbial communities and shaped the structure of the local microbiota. Discussion: This study could provide a basis for the monitoring and restoration of ecosystems impacted by coal mining activities considering the expected decommission of a large number of coal plants on a global scale in the coming years due to growing global climate change concerns.
RESUMEN
[This corrects the article DOI: 10.3389/fmicb.2023.1126612.].
RESUMEN
The coal-degrading ability of microorganisms is essential for the formation of biogenic coalbed methane. The ability to degrade the aromatic compound of coal is more important because it is perceived as the main refractory component for bioconversion. In this paper, a polycyclic aromatic hydrocarbon (PAH) degrading fungal community (PF) was enriched from produced water using phenanthrene as sole carbon source. The goal was to improve both the microbial structure of the methanogenic microflora and its coal-degrading ability. Two strategies were pursued. The first used coal pretreatment with PF (PP), followed by methane production by methanogenic microflora; the second used methane production directly from coal by mixed culture of PF and methanogenic microflora (PM). The results showed that methane productions of PP and PM increased by 29.40 and 39.52%, respectively. After 7 days of cultivation, the fungal community has been altered in PP and PM, especially for Penicillium the proportions of which were 67.37 and 89.81% higher than that in methanogenic microflora, respectively. Furthermore, volatile fatty acid accumulations increased by 64.21 and 58.15%, respectively. The 13C-NMR results showed that PF addition promoted the transformation of aromatic carbons in coal to carboxyl and carbonyl carbons, which contributed greatly to the production of methane together with oxygen-containing functional groups. These results suggest that methane production can be increased by indigenous PAH-degrading fungi by improving the fermentation of aromatics in coal and the generation of volatile fatty acids. This provided a feasible method for enhancing biomethane generation in the coal seam.
RESUMEN
In present research, a potent fungal strain was isolated from paper mill effluent (black liquor) in order to investigate its potential for the biodegradation of lignin. Two step strategy was used to screen most efficient fungal strain having ability to growin MSM-black liquor medium and to degrade alkali lignin.The results of initial screening indicated that the strain M-2 produced comparatively higher ligninolytic zone on MSN agar plates supplemented with black liquor (BL) and alkali ligninase compared to the other isolates.The results of 18S rRNA gene sequencing revealed that strain M-2 showed ≥ 99% sequence homology with Dipodasceus australiansis.The process for the biodegradation of lignin was optimized using Taguchi Orthogonal Array design. Under optimized conditions of pH 9, 40 °C and 4% inoculum, a maximum of 89% lignin was degraded with 41% color reduction after 8 days of incubation period by Dipodasceus australiansis M-2. The pH and temperature were found to be significant terms with the p-values of 0.002 and 0.001 respectively. The laccase activity of the Dipodascus australiensis was found to be maximum of 1.511 U/mL. The HPLC analysis of lignin biodegradation indicated sharp transformation of peaks as compared to the control. Our results suggested that the strain Dipodascus australiensis M-2 possess excellent lignin degradation and color reduction capability and can be applied in waste treatment systems for pulp and paper mill effluent. In present work we are reporting first hand information regarding biodegradation of lignin by a potent strain of Dipodascus australiensis and statistical optimization of the bioprocess.