Evaluation of the Antiviral Activity of Tabamide A and Its Structural Derivatives against Influenza Virus.

Influenza viruses cause severe endemic respiratory infections in both humans and animals worldwide. The emergence of drug-resistant viral strains requires the development of new influenza therapeutics. Tabamide A (TA0), a phenolic compound isolated from tobacco leaves, is known to have antiviral activity. We investigated whether synthetic TA0 and its derivatives exhibit anti-influenza virus activity. Analysis of structure-activity relationship revealed that two hydroxyl groups and a double bond between C7 and C8 in TA0 are crucial for maintaining its antiviral action. Among its derivatives, TA25 showed seven-fold higher activity than TA0. Administration of TA0 or TA25 effectively increased survival rate and reduced weight loss of virus-infected mice. TA25 appears to act early in the viral infection cycle by inhibiting viral mRNA synthesis on the template-negative strand. Thus, the anti-influenza virus activity of TA0 can be expanded by application of its synthetic derivatives, which may aid in the development of novel antiviral therapeutics.

Chromatin Regulator SRG3 Overexpression Protects against LPS/D-GalN-Induced Sepsis by Increasing IL10-Producing Macrophages and Decreasing IFNγ-Producing NK Cells in the Liver.

We previously showed that ubiquitous overexpression of the chromatin remodeling factor SWItch3-related gene (SRG3) promotes M2 macrophage differentiation, resulting in anti-inflammatory responses in the experimental autoimmune encephalomyelitis model of multiple sclerosis. Since hepatic macrophages are responsible for sepsis-induced liver injury, we investigated herein the capacity of transgenic SRG3 overexpression (SRG3ß-actin mice) to modulate sepsis in mice exposed to lipopolysaccharide (LPS) plus d-galactosamine (d-GalN). Our results demonstrated that ubiquitous SRG3 overexpression significantly protects mice from LPS/d-GalN-induced lethality mediated by hepatic M1 macrophages. These protective effects of SRG3 overexpression correlated with the phenotypic conversion of hepatic macrophages from an M1 toward an M2 phenotype. Furthermore, SRG3ß-actin mice had decreased numbers and activation of natural killer (NK) cells but not natural killer T (NKT) cells in the liver during sepsis, indicating that SRG3 overexpression might contribute to cross-talk between NK cells and macrophages in the liver. Finally, we demonstrated that NKT cell-deficient CD1d KO/SRG3ß-actin mice are protected from LPS/d-GalN-induced sepsis, indicating that NKT cells are dispensable for SRG3-mediated sepsis suppression. Taken together, our findings provide strong evidence that SRG3 overexpression may serve as a therapeutic approach to control overwhelming inflammatory diseases such as sepsis.

Ubiquitous Overexpression of Chromatin Remodeling Factor SRG3 Exacerbates Atopic Dermatitis in NC/Nga Mice by Enhancing Th2 Immune Responses.

The SWItch (SWI)3-related gene (SRG3) product, a SWI/Sucrose Non-Fermenting (SNF) chromatin remodeling subunit, plays a critical role in regulating immune responses. We have previously shown that ubiquitous SRG3 overexpression attenuates the progression of Th1/Th17-mediated experimental autoimmune encephalomyelitis. However, it is unclear whether SRG3 overexpression can affect the pathogenesis of inflammatory skin diseases such as atopic dermatitis (AD), a Th2-type immune disorder. Thus, to elucidate the effects of SRG3 overexpression in AD development, we bred NC/Nga (NC) mice with transgenic mice where SRG3 expression is driven by the ß-actin promoter (SRG3ß-actin mice). We found that SRG3ß-actin NC mice exhibit increased AD development (e.g., a higher clinical score, immunoglobulin E (IgE) hyperproduction, and an increased number of infiltrated mast cells and basophils in skin lesions) compared with wild-type NC mice. Moreover, the severity of AD pathogenesis in SRG3ß-actin NC mice correlated with expansion of interleukin 4 (IL4)-producing basophils and mast cells, and M2 macrophages. Furthermore, this accelerated AD development is strongly associated with Treg cell suppression. Collectively, our results have identified that modulation of SRG3 function can be applied as one of the options to control AD pathogenesis.

Nc886, a Novel Suppressor of the Type I Interferon Response Upon Pathogen Intrusion.

Interferons (IFNs) are a crucial component in the innate immune response. Especially the IFN-ß signaling operates in most cell types and plays a key role in the first line of defense upon pathogen intrusion. The induction of IFN-ß should be tightly controlled, because its hyperactivation can lead to tissue damage or autoimmune diseases. Activation of the IFN-ß promoter needs Interferon Regulatory Factor 3 (IRF3), together with Nuclear Factor kappa-light-chain-enhancer of activated B cells (NF-κB) and Activator Protein 1 (AP-1). Here we report that a human noncoding RNA, nc886, is a novel suppressor for the IFN-ß signaling and inflammation. Upon treatment with several pathogen-associated molecular patterns and viruses, nc886 suppresses the activation of IRF3 and also inhibits NF-κB and AP-1 via inhibiting Protein Kinase R (PKR). These events lead to decreased expression of IFN-ß and resultantly IFN-stimulated genes. nc886's role might be to restrict the IFN-ß signaling from hyperactivation. Since nc886 expression is regulated by epigenetic and environmental factors, nc886 might explain why innate immune responses to pathogens are variable depending on biological settings.

nc886, a non-coding RNA, inhibits UVB-induced MMP-9 and COX-2 expression via the PKR pathway in human keratinocytes.

nc886, a long non-coding RNA (ncRNA) of 101 nucleotides in length, is known as a vault RNA or microRNA precursor. Despite the recent discovery that ncRNAs in the nucleus play a crucial role in regulating chromosomal transformation and transcription, only a few studies have focused on the function of ncRNAs in the cytoplasm, such as nc886. Several studies have investigated the function of nc886 as a suppressor of carcinogenesis and inflammation in different cancer cell types; however, its role in the skin has yet to be clearly elucidated. The two RNA binding sites for protein kinase RNA-activated (PKR) are located in the central region of the stable structure of nc886, which competes with other double-stranded RNA species. Successful binding results in decreased PKR activity. Among changes in skin cells induced by ultraviolet B (UVB) radiation, nc886 expression decreases, whereas PKR phosphorylation via mitogen-activated protein kinases (MAPKs) increases. Reduced nc886 expression leads to uncontrolled PKR activity and increases in the expression of inflammatory cytokines, matrix metalloproteinase-9 (MMP-9), type IV collagenase, and cyclooxygenase (COX-2), which ultimately accelerate inflammatory responses and skin aging. The present study investigated the regulatory mechanism associated with PKR activity and nc886-PKR binding in skin cell aging and inflammation. These results suggest a role for nc886 in controlling photoaging and inflammation in skin cells.

TopBP1 deficiency impairs V(D)J recombination during lymphocyte development.

TopBP1 was initially identified as a topoisomerase II-ß-binding protein and it plays roles in DNA replication and repair. We found that TopBP1 is expressed at high levels in lymphoid tissues and is essential for early lymphocyte development. Specific abrogation of TopBP1 expression resulted in transitional blocks during early lymphocyte development. These defects were, in major part, due to aberrant V(D)J rearrangements in pro-B cells, double-negative and double-positive thymocytes. We also show that TopBP1 was located at sites of V(D)J rearrangement. In TopBP1-deficient cells, γ-H2AX foci were found to be increased. In addition, greater amount of γ-H2AX product was precipitated from the regions where TopBP1 was localized than from controls, indicating that TopBP1 deficiency results in inefficient DNA double-strand break repair. The developmental defects were rescued by introducing functional TCR αß transgenes. Our data demonstrate a novel role for TopBP1 as a crucial factor in V(D)J rearrangement during the development of B, T and iNKT cells.

Anti-cancer activity of Angelica gigas by increasing immune response and stimulating natural killer and natural killer T cells.

BACKGROUND: The polysaccharide component of Angelica gigas induces immuno-stimulatory effects on innate immune cells. However, it is unclear whether A. gigas' adjuvant activity on the immune system can elicit anti-cancer responses. METHODS: A water-soluble immuno-stimulatory component of A. gigas was prepared. How this ISAg modulated the activation of innate immune cells such as dendritic cells (DCs) was examined. ISAg-induced cytotoxic activity via natural killer (NK) and NKT cells was also tested using a tumor-bearing mouse model. RESULTS: ISAg treatment induced nitric oxide (NO) production and cytokine gene expression involved in innate immune responses. ISAg activated macrophages and DCs to secrete cytokine IL-12, through the TLR4 signaling pathway. IL-12 plays a crucial role in ISAg-mediated NK and NKT cell activation. Thus, the anti-cancer activity of NK and NKT cells induced ISAg-mediated cytotoxicity of B16 melanoma cells in mice. CONCLUSIONS: These results indicated that the natural ingredient, ISAg, has adjuvant activity to induce strong anti-cancer activity of NK and NKT cells in vivo.

IL32γ activates natural killer receptor-expressing innate immune cells to produce IFNγ via dendritic cell-derived IL12.

The inflammatory cytokine IL32γ acts on dendritic cells (DCs) to produce IL12 and IL6, which are involved in the differentiation of Th1 and Th17 cells. Natural killer (NK) and NKT cells play important roles in IL12-mediated adaptive immune responses, such as antitumor immunity. Herein we demonstrate the effect of IL32γ on the activation of NK and NKT cells. Upon IL32γ stimulation, splenic NK and NKT cells could be activated, and this activation was dependent on both IL12 and DCs, which was confirmed by using IL12p35 knockout and CD11c-diphtheria toxin receptor transgenic mouse models. Furthermore, IL32γ could induce the production of proinflammatory cytokines by NKDCs, a subset of DCs expressing NK cell markers, known to enhance NKT cell function. Unlike conventional DCs, NKDCs produced IFNγ and TNFα rather than IL12 upon stimulation with IL32γ. Taken together, IL32γ will be useful as an adjuvant to boost the cytotoxicities of NK and NKT cells that play critical roles in antitumor immunity.

Continuous exposure to 60 Hz magnetic fields induces duration- and dose-dependent apoptosis of testicular germ cells.

To evaluate duration- and dose-dependent effects of continuous exposure to a 60 Hz magnetic field (MF) on the testes in mice, BALB/c male mice were exposed to a 60 Hz MF at 100 µT for 24 h a day for 2, 4, 6, or 8 weeks, and at 2, 20, or 200 µT for 24 h a day for 8 weeks. Any exposures to MF did not significantly affect body or testicular masses. However, the apoptotic cells among testicular germ cells were increased duration-dependent at exposures of 100 µT for 6 and 8 weeks and dose-dependent at exposures of 20 and 200 µT for 8 weeks. The number of sperm in epididymis and the diameter of seminiferous tubule decreased in mice exposed to 100 and 200 µT for 8 weeks, respectively. To induce the apoptosis of testicular germ cell in mice, the minimum dose is 20 µT at continuous exposure to a 60 Hz MF for 8 weeks and the minimum duration is 6 weeks at continuous exposure of 100 µT. Taken together, these results suggest that continuous exposure to a 60 Hz MF might affect, duration- and dose-dependent biological processes including apoptotic cell death and spermatogenesis in the male reproductive system of mice.

Precursor miR-886, a novel noncoding RNA repressed in cancer, associates with PKR and modulates its activity.

Noncoding RNAs have drawn significant attention in biology recently. Whereas the current research is highly inclined to microRNAs, research on other noncoding RNAs has lagged behind. Here, we investigated a novel noncoding RNA that has been known as precursor microRNA miR-886 (pre-miR-886). Pre-miR-886 has been proposed also as a vault RNA, a component of the vault complex implicated in cancer drug resistance. We identified pre-miR-886 as a 102-nucleotide-long, abundant cytoplasmic RNA that is neither a genuine pre-microRNA nor a vault RNA. Pre-miR-886 is physically associated with PKR (Protein Kinase RNA-activated), an interferon-inducible and double-stranded RNA dependent kinase. The suppression of pre-miR-886 activates PKR and its downstream pathways, eIF2α phosphorylation and the NF-κB pathway, leading to impaired cell proliferation. We also found that pre-miR-886 is suppressed in a wide-range of cancer cell lines and in clinical specimens. This study is the first intense characterization of pre-miR-886 as well as the initial report on its function as a PKR regulator, which suggests a critical role in tumorigenesis.

Compartmentalized, functional role of angiogenin during spotted fever group rickettsia-induced endothelial barrier dysfunction: evidence of possible mediation by host tRNA-derived small noncoding RNAs.

BACKGROUND: Microvascular endothelial barrier dysfunction is the central enigma in spotted fever group (SFG) rickettsioses. Angiogenin (ANG) is one of the earliest identified angiogenic factors, of which some are relevant to the phosphorylation of VE-cadherins that serve as endothelial adherens proteins. Although exogenous ANG is known to translocate into the nucleus of growing endothelial cells (ECs) where it plays a functional role, nuclear ANG is not detected in quiescent ECs. Besides its nuclear role, ANG is thought to play a cytoplasmic role, owing to its RNase activity that cleaves tRNA to produce small RNAs. Recently, such tRNA-derived RNA fragments (tRFs) have been shown to be induced under stress conditions. All these observations raise an intriguing hypothesis about a novel cytoplasmic role of ANG, which is induced upon infection with Rickettsia and generates tRFs that may play roles in SFG rickettsioses. METHODS: C3H/HeN mice were infected intravenously with a sublethal dose of R. conorii. At days 1, 3, and 5 post infection (p.i.), liver, lung and brain were collected for immunofluorescence (IF) studies of R. conorii and angiogenin (ANG). Human umbilical vein endothelial cells (HUVECs) were infected with R. conorii for 24, 48, and 72 hrs before incubation with 1µg/ml recombinant human ANG (rANG) in normal medium for 2 hrs. HUVEC samples were subjected to IF, exogenous ANG translocation, endothelial permeability, and immunoprecipitation phosphorylation assays. To identify small non-coding RNAs (sncRNAs) upon rickettsial infection, RNAs from pulverized mouse lung tissues and HUVECs were subjected to library preparation and deep sequencing analysis using an Illumina 2000 instrument. Identified sncRNAs were confirmed by Northern hybridization, and their target mRNAs were predicted in silico using BLAST and RNA hybrid programs. RESULTS: In the present study, we have demonstrated endothelial up-regulation of ANG, co-localized with SFG rickettsial infection in vivo. We also have provided direct evidence that rickettsial infection sensitizes human ECs to the translocation of exogenous ANG in a compartmentalized pattern at different times post-infection. Typically, exogenous ANG translocates into the nucleus at 24 hrs and to the cytoplasm at 72 hrs post-infection. The ANG cytoplasmic translocation enhances phosphorylation and destabilization of VE-cadherin and attenuates endothelial barrier function. Of note, deep sequencing analysis detected tRFs, mostly derived from the 5'-halves of host tRNAs, that are induced by ANG. Northern hybridization validates the two most abundantly cloned tRFs derived from tRNA-ValGTG and tRNA-GlyGCC, in both mouse tissues and human cells. Bioinformatics analysis predicted that these tRFs may interact with transcripts associated with the endothelial barrier, the host cell inflammatory response, and autophagy. CONCLUSIONS: Our data provide new insight into the role of compartmentalized ANG during SFG rickettsioses, and highlight its possible mediation through tRFs.

Improvement of the diagnostic sensitivity of scrub typhus using a mixture of recombinant antigens derived from Orientia tsutsugamushi serotypes.

Diagnosis of scrub typhus is difficult because its symptoms are very similar to other acute febrile illnesses, such as leptospirosis, murine typhus, and other viral hemorrhagic fevers. To differentiate scrub typhus from other acute febrile diseases, a rapid and reliable serological diagnosis is important. We have developed a chimeric recombinant antigen cr56 and two other recombinant antigens, r21 and kr56, from various serotypes of Orientia tsutsugamushi. They were tested for the detection of antibodies against O. tsutsugamushi in the patient's serum samples using enzyme-linked immunosorbent assay (ELISA) and dot-blot analyses. As of conventional immunofluorescence assay (IFA), when the mixture of these three recombinant antigens was used, both sensitivity and specificity of the recombinant antigens were increased up to 98% in IgM and IgG at ELISA and dot blotting. Additionally, both sensitivity and specificity by detection of IgM and IgG antibodies at rapid diagnostic test (RDT), using the mixture of three antigens and gold conjugated antibodies, were 99%. Our results suggest the use of mixture of these recombinant antigen proteins in ELISA or RDT is suitable as a diagnostic test for scrub typhus.

A tumor surveillance model: a non-coding RNA senses neoplastic cells and its protein partner signals cell death.

nc886 (= pre-miR-886 or vtRNA2-1) is a non-coding RNA that has been recently identified as a natural repressor for the activity of PKR (Protein Kinase R). The suppression of nc886 activates PKR and thereby provokes a cell death pathway. When combined with the fact that nc886 is suppressed in a wide range of cancer cells, the nc886-PKR relationship suggests a tumor surveillance model. When neoplastic cells develop and nc886 decreases therein, PKR is released from nc886 and becomes the active phosphorylated form, which initiates an apoptotic cascade to eliminate those cells. The nc886-PKR pathway is distinct from conventional mechanisms, such as the immune surveillance hypothesis or intrinsic mechanisms that check/proofread the genomic integrity, and thus represents a novel example of tumor surveillance.

Gold nanoparticle-based colorimetric detection of kanamycin using a DNA aptamer.

A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants (K(d) [kanamycin]=78.8 nM, K(d) [kanamycin B]=84.5 nM, and K(d) [tobramycin]=103 nM) of the new aptamer were determined by fluorescence intensity analysis using 5'-fluorescein amidite (FAM) modification. Using this aptamer, kanamycin was detected down to 25 nM by the gold nanoparticle-based colorimetric method. Because the designed colorimetric method is simple, easy, and visible to the naked eye, it has advantages that make it useful for the detection of kanamycin. Furthermore, the selected new aptamer has many potential applications as a bioprobe for the detection of kanamycin, kanamycin B, and tobramycin in pharmaceutical preparations and food products.

Growth and Drug Interaction Monitoring of NIH 3T3 Cells by Image Analysis and Capacitive Biosensor.

Capacitive biosensors are manufactured on glass slides using the semiconductor process to monitor cell growth and cell-drug interactions in real time. Capacitance signals are continuously monitored for each 10 min interval during a 48 h period, with the variations of frequency from 1 kHz to 1 MHz. The capacitance values showed a gradual increase with the increase in NIH 3T3 cell numbers. After 48 h of growth, 6.67 µg/mL puromycin is injected for the monitoring of the cell-drug interaction. The capacitance values rapidly increased during a period of about 10 h, reflecting the rapid increase in the cell numbers. In this study, we monitored the state of cells and the cell-drug interactions using the developed capacitive biosensor. Additionally, we monitored the state of cell behavior using a JuLiTM Br&FL microscope. The monitoring of cell state by means of a capacitive biosensor is more sensitive than confluence measuring using a JuLiTM Br&FL microscope image. The developed capacitive biosensor could be applied in a wide range of bio-medical areas; for example, non-destructive real-time cell growth and cell-drug interaction monitoring.

Development of an enzymatic encapsulation process for a cycloamylose inclusion complex with resveratrol.

Cyclodextrin glucanotransferase (CGTase; EC 2.4.1.19) produces cycloamyloses (CAs), which are large cyclic glucans, and subsequently transforms them to α-, ß-, and γ-cyclodextrins. We developed a novel encapsulation process based on the cyclization activity of CGTase and applied it to the formation of CA inclusion complexes with resveratrol (RVT), which has limited bioavailability due to its low water solubility. The encapsulated RVT (CA-RVT) was purified using preparative high-performance liquid chromatography. The water solubility of CA-RVT was 6,000-fold higher than that of RVT. CA-RVT in water demonstrated 98% stability for 1 week at 4 °C. According to radical scavenging activity and anti-inflammatory assays, CA-RVT in aqueous solution exhibited similar activities as an equal amount of RVT in dimethyl sulfoxide, suggesting the limited solubility of RVT can be overcome through CA encapsulation by CGTase, thus enhancing its nutraceutical value as a functional ingredient in the food industry.

Twist2 promotes CD8+ T-cell differentiation by repressing ThPOK expression.

CD4/CD8 T-cell lineage differentiation is a key process in immune system development; however, a defined regulator(s) that converts the signal from T-cell receptor and co-receptor complexes into lineage differentiation remains unclear. Here, we show that Twist2 is a critical factor in CD4/CD8 thymocyte differentiation. Twist2 expression is differentially regulated by T-cell receptor signaling, leading to differentiation into the CD4 or CD8 lineage. Forced Twist2 expression perturbed CD4+ thymocyte differentiation while enhancing CD8+ thymocyte differentiation. Furthermore, Twist2 expression produced mature CD8+ thymocytes in B2m-/- mice, while its deficiency significantly impaired CD8+ cells in MHC class-II-/- and TCR transgenic mice, favoring CD8 T-cell differentiation. During CD8 lineage differentiation, Twist2 interacted with Runx3 to bind to the silencer region of the ThPOK locus, thereby blocking ThPOK expression. These findings indicate that Twist2 is a part of the transcription factor network controlling CD8 lineage differentiation.

A Regulatory Noncoding RNA, nc886, Suppresses Esophageal Cancer by Inhibiting the AKT Pathway and Cell Cycle Progression.

nc886 is a regulatory non-coding RNA (ncRNA) whose expression is frequently silenced in malignancies. In the case of esophageal squamous cell carcinoma (ESCC), nc886 silencing is associated with shorter survival of patients, suggesting nc886's tumor suppressor role in ESCC. However, this observation has not been complemented by an in-detail study about nc886's impact on gene expression and cellular phenotypes. Here we have shown that nc886 inhibits AKT, a key protein in a renowned pro-survival pathway in cancer. nc886-silenced cells (nc886- cells) have activated AKT and altered expression of cell cycle genes. nc886- cells tend to have lower expression of CDKN2A and CDKN2C, both of which are inhibitors for cyclin-dependent kinase (CDK), and higher expression of CDK4 than nc886-expressing cells. As a result, nc886- cells are hyperactive in the progression of the G1 to S cell cycle phase, proliferate faster, and are more sensitive to palbociclib, which is a cancer therapeutic drug that targets CDK4/6. Experimentally by nc886 expression and knockdown, we have determined the AKT target genes and cell cycle genes that are controlled by nc886 (nc886-associated gene sets). These gene sets, in combination with pathologic staging and nc886 expression levels, are a vastly superior predictor for the survival of 108 ESCC patients. In summary, our study has elucidated in ESCC how nc886 inhibits cell proliferation to explain its tumor suppressor role and identified gene sets that are of future clinical utility, by predicting patient survival and responsiveness to a therapeutic drug.

TLR4-dependent effects of ISAg treatment on conventional T cell polarization in vivo.

We recently demonstrated that the polysaccharide component of the Korean medicinal herb Angelica gigas (immuno-stimulatory fraction of A. gigas; ISAg) induces anticancer effects in mice by activating natural killer (NK) and natural killer T (NKT) cells. However, it is unclear whether the use of ISAg in vivo can affect the differentiation of conventional T cells. Here, we investigated the effects of ISAg on the activation of conventional CD4+ and CD8+ T cells. We found that the administration of ISAg induced the polarization of CD4+ T cells toward the acquisition of the Th1 phenotype in vivo. Additionally, in mice treated with ISAg, CD8+ T cells produced more IFNγ than in control mice treated with PBS. Moreover, treatment with ISAg activated CD4+ and CD8+ T cells as well as NK and NKT cells, resulting in the secretion of Th1-type cytokines in a toll-like receptor 4 (TLR4)-dependent manner, implying that TLR4 is critical for an optimal Th1 response. Interestingly, ISAg treatment increased the number of Foxp3+ Treg cells, but not of Th2 cells, compared to control mice treated with PBS, indicating that ISAg possesses an immunomodulatory capacity that can control adaptive immune responses. Taken together, our results indicate that ISAg possesses a Th1-enhancing activity that could be used to treat Th2-mediated allergic immune diseases such as atopic dermatitis.

Modulation of androgen receptor transactivation by the SWI3-related gene product (SRG3) in multiple ways.

The SWI3-related gene product (SRG3), a component of the mouse SWI/SNF complex, has been suggested to have an alternative function. Here, we demonstrate that in the prostate transactivation of the androgen receptor (AR) is modulated by SRG3 in multiple ways. The expression of SRG3, which is developmentally regulated in the prostate, is induced by androgen through AR. SRG3 in turn enhances the transactivation of AR, providing a positive feedback regulatory loop. The SRG3 coactivation of AR transactivation is achieved through the recruitment of coactivator SRC-1, the protein level of which is upregulated by SRG3, providing another pathway of positive regulation. Interestingly, SRG3 coactivation of AR transactivation is fully functional in BRG1/BRM-deficient C33A cells and the AR/SRG3/SRC-1 complex formed in vivo contains neither BRG1 nor BRM protein, suggesting the possibility of an SRG3 function independent of the SWI/SNF complex. Importantly, the AR/SRG3/SRC-1 complex occupies androgen response elements on the endogenous SRG3 and PSA promoter in an androgen-dependent manner in mouse prostate and LNCaP cells, respectively, inducing gene expression. These results suggest that the multiple positive regulatory mechanisms of AR transactivation by SRG3 may be important for the rapid proliferation of prostate cells during prostate development and regeneration.