Molecular characterization of birch toti-like virus, a plant-associated member of the new family Orthototiviridae.

A novel totivirus, named "birch toti-like virus" (BTLV), was discovered in European white birch (Betula pendula) plants. The genome of BTLV is 4,967 nucleotides long and contains two overlapping open reading frames (ORFs) coding for the capsid protein (CP) and an RNA-dependent RNA-polymerase (RdRP). The encoded CP and RdRP proteins shared 46.9% and 60.2% amino acid sequence identity, respectively, with those of Panax notoginseng virus B. The presence of a putative slippery heptamer signal 82 nt upstream of the stop codon of ORF1 suggests that a -1 translational frameshifting strategy is involved in the expression of ORF2, like in other totiviruses. Phylogenetic analysis based on the CP and RdRP amino acid sequences placed this virus within a clade of plant-associated totiviruses, with taro-associated virus as its closest relative. Hence, based on its distinct host and the amino acid sequence similarity between BTLV and its relatives, we conclude that birch toti-like virus is a new member of the genus Totivirus.

Occurrence of grapevine yellow speckle viroid 2 and Australian grapevine viroid in Idaho grapevines.

Grapevine yellow speckle viroid 2 (GYSVd-2; Pospiviroidae, Apscaviroid) causes yellow speckle disease in grapevine (Koltunow et al. 1989) and was found in Australia, Iran, Italy, China, and Nigeria (Koltunow et al. 1989; Habili 2017; Zongoma et al. 2018). In the U.S., GYSVd-2 was found in the State of Washington (Vitis vinifera L. cv. Merlot; Alabi et al., 2012). Australian grapevine viroid (AGVd; Pospiviroidae, Apscaviroid) was reported in Australia, Italy, China, Tunisia, Iran, and in the U.S. wine grapes (V. vinifera) (Habili 2017). In the U.S., AGVd was reported from California (Al Rwahnih et al. 2009), from Washington State (V. vinifera cv. Syrah; GU327604), and from the State of New York (an unknown cv. of V. vinifera; KY081960). In Idaho, two other viroids, hop stunt viroid (HSVd; Pospiviroidae, Hostuviroid) and grapevine yellow speckle viroid 1 (GYSVd-1; Pospiviroidae, Apscaviroid), common in grapevines were previously found in wine grapes (Thompson et al. 2019) but neither GYSVd-2 nor AGVd were identified in the same high-throughput sequencing (HTS) outputs. In September 2020, 16 leaf and petiole samples were collected from six vineyards in Canyon and Nez Perce counties of Idaho, representing six different wine grape cultivars and an unknown table grape cultivar, and subjected to HTS analysis. One of the samples was from a table grape plant at the edge of a declining 'Chardonnay' wine grape block that was grown next to a wine tasting room deck for aesthetic, ornamental purposes; the table grape and 'Chardonnay' plants were own-rooted and planted in 1981. Ribodepleted total RNAs prepared from these samples, as described previously, were subjected to a HTS analysis on a NovaSeq platform (Dahan et al. 2023), producing 15,095,042 to 31,500,611 250-bp paired-end reads per sample. Raw reads were adapter and quality cleaned and mapped against the V. vinifera, reference genome. Unmapped paired-end reads were assembled, and contigs were analyzed using BLASTn and DIAMOND (Buchfink et al. 2021) programs. Fifteen samples were found infected with HSVd and with GYSVd-1, while one was infected with GYSVd-2 and AGVd; in particular, the table grape plant (arbitrarily designated RBTG) was found infected with all four viroid species. The HTS-derived, 490-nt GYSVd-2-specific contig from the table grape sample represented ∼1.35 genome of the Idaho isolate of GYSVd-2 (GYSVd-2-RBTG) and was 100% identical to the GYSVd-2 sequence JQ686716 from Iran. The HTS-derived, 488-nt AGVd-specific contig represented ∼1.32 genome of the Idaho isolate of AGVd (AGVd-RBTG) and was 100% identical to the AGVd sequence KF876037 from Iran. To validate the HTS data and confirm the presence of the four viroids in the original 16 samples, all of them were subjected to RT-PCR using the viroid-specific primers described by Gambino et al. (2014); all 16 samples were found positive for HSVd and GYSVd-1, and one found positive for AGVd. The RBTG sample was confirmed to be infected with HSVd, GYSVd-1, and AGVd by RT-PCR. GYSVd-2 sequence was not amplified, although primers designed by Gambino et al. (2014) matched the HTS-derived GYSVd-2-RBTG sequence; this may be related to a lower concentration of this viroid in the sample and to properties of the primers. The sampled table grape plant was asymptomatic; all four viroids were apparently not associated with any visible abnormalities in this table grape plant, consistent with the findings that viroids found in grapevines typically do not seem to be associated with visible diseases (Habili 2017).

Characterization of a New, Country Bean (Lablab purpureus) Lineage of Bean Common Mosaic Necrosis Virus.

Country bean (Lablab purpureus, family Fabaceae) is grown in subsistence agriculture in Bangladesh as a multipurpose crop for food, animal feed, and green manure. This study was undertaken to investigate the genetic diversity of bean common mosaic necrosis virus (BCMNV, genus Potyvirus, family Potyviridae) in country beans. Leaf samples from country beans showing yellowing, vein banding, and mosaic symptoms were collected during field surveys between 2015 and 2019 cropping seasons from farmers' fields in different geographic regions. These samples were tested by serological and molecular diagnostic assays for the presence of BCMNV. Virus-positive samples were subjected to high-throughput Illumina sequencing to generate near-complete genomes of BCMNV isolates. In pairwise comparisons, the polyprotein sequences of BCMNV isolates from Bangladesh showed greater than 98% identities among themselves and shared less than 84% sequence identity at the nucleotide level with virus isolates reported from other countries. In the phylogenetic analysis, BCMNV isolates from Bangladeshi country beans formed a separate clade from virus isolates reported from common beans in other countries in the Americas, Africa, Europe, and from East Timor. Grow-out studies showed seed-to-seedling transmission of BCMNV, implying a possible seedborne nature of the virus in country beans.

First report of tomato chlorotic dwarf viroid infecting litchi tomato (Solanum sisymbriifolium).

Litchi tomato (LT) (Solanum sisymbriifolium) is a solanaceous weed that is considered a biological control tool to manage potato cyst nematode (PCN) in Europe and is being explored for use in Idaho. Two Several LT lines were clonally maintained as stocks in the university greenhouse since 2013 and were also established in tissue culture at the same time. In 2018, tomato (Solanum lycopersicum cv. Alisa Craig) scions were grafted onto two LT rootstocks originating either from healthy-looking greenhouse stocks or from tissue culture-maintained plants. Unexpectedly, tomatoes grafted onto the greenhouse-maintained rootstocks of LT displayed severe symptoms of stunting, foliar deformation, and chlorosis, while grafts onto the same LT lines from tissue culture produced healthy-looking tomato plants. Tests for the presence of several viruses known to infect solanaceous plants were conducted on symptomatic tomato scion tissues using ImmunoStrips (Agdia, Elkhard, IN) and RT-PCR (Elwan et al. 2017) but yielded negative results. High throughput sequencing (HTS) was then used to identify possible pathogens that could have been responsible for the symptoms observed in tomato scions. Samples from two symptomatic tomato scions, two asymptomatic scions grafted onto the tissue culture-derived plants, and two greenhouse-maintained rootstocks were subjected to HTS. Total RNA from the four tomato and two LT samples was depleted of ribosomal RNA and subjected to HTS on an Illumina MiSeq platform producing 300-bp paired-end reads and raw reads were adapter and quality cleaned. For the tomato samples, the clean reads were mapped against the S. lycopersicum L. reference genome, and unmapped paired reads were assembled producing between 4,368 and 8,645 contigs. For the LT samples, all clean reads were directly assembled, producing 13,982 and 18,595 contigs. In the symptomatic tomato scions and the two LT rootstock samples, a 487-nt contig was found, comprising an ~1.35 tomato chlorotic dwarf viroid (TCDVd) genome and exhibiting 99.7% identity with it (GenBank accession AF162131; Singh et al. 1999). No other virus-related or viroid contigs were identified. RT-PCR analysis using a pospiviroid primer set Pospi1-FW/RE (Verhoeven et al. 2004), and a TCDVd-specific primer set TCDVd-Fw/TCDVd-Rev (Olmedo-Velarde et al. 2019) produced 198-nt and 218-nt bands, respectively, thus confirming the presence of TCDVd in tomato and LT samples. These PCR products were Sanger sequenced and confirmed to be TCDVd-specific; the complete sequence of the Idaho isolate of TCDVd was deposited in GenBank under the accession number OQ679776. Presence of TCDVd in LT plant tissue was confirmed by the APHIS PPQ Laboratory in Laurel, MD. Asymptomatic tomatoes and LT plants from tissue culture were found negative for TCDVd. Previously, TCDVd was reported to affect greenhouse tomatoes in Arizona and Hawaii (Ling et al. et al. 2009; Olmedo-Velarde et al. 2019), however, this is the first report of TCDVd infecting litchi tomato (S. sisymbriifolium). Five additional greenhouse-maintained LT lines were found TCDVd-positive using RT-PCR and Sanger sequencing. Given the very mild or asymptomatic infection of TCDVd in this host, molecular diagnostic methods should be used to screen LT lines for the presence of this viroid to avoid inadvertent spread of TCDVd. Another viroid, potato spindle tuber viroid, was reported to be transmitted through LT seed (Fowkes et al. 2021), and transmission of TCDVd through LT seed may also be responsible for this TCDVd outbreak in the university greenhouse, although no direct evidence was collected. To the best of our knowledge, this is the first report of TCDVd infection in S. sisymbriifolium and also the first report of the TCDVd occurrence in Idaho.

Papaya Sticky Disease Caused by Virus "Couples": A Challenge for Disease Detection and Management.

Papaya sticky disease (PSD) is a major virus disorder of papaya (Carica papaya). The disease is characterized by fruit damage caused by the oxidation of spontaneously exuded latex. In Brazil, PSD is caused by the coinfection of two viruses, papaya meleira virus (PMeV), a toti-like virus, and papaya meleira virus-2 (PMeV-2), an umbra-like virus. The disorder has also been reported in Mexico and, more recently, in Australia, but the presence of both PMeV and PMeV-2 in symptomatic plants has been documented only in Brazil. In 2021, 2-year-old papaya plants (cultivar Passion Red) exhibiting PSD-like symptoms were observed in Santa Elena Province, Ecuador. Molecular tests of leaf tissue and fruit latex from symptomatic plants failed to detect PMeV. However, papaya virus Q (PpVQ), an umbra-like virus related to but distinct from PMeV-2, and a novel virus, tentatively named papaya sticky fruit-associated virus (PSFaV), were found in the symptomatic samples. PSFaV shares 56% nucleotide identity with the genome of PMeV, suggesting that PSD symptoms can be caused by "couples" of viruses related to but distinct from PMeV (a toti-like virus) and PMeV-2 (an umbra-like virus). This review discusses the history and epidemiology of PSD and the genomic features of newly discovered virus couples involved in this syndrome. Given the unusual etiology of PSD, which involves distinct virus species, the importance of implementing proper diagnostic approaches for PSD is highlighted.

A new picorna-like virus identified in populations of the potato psyllid Bactericera cockerelli.

The potato/tomato psyllid Bactericera cockerelli (Hemiptera: Triozidae) is a pest of Solanaceae plants and a vector of the pathogenic bacterium 'Candidatus Liberibacter solanacearum', which is associated with zebra chip disease in potato. This disease is controlled through insecticide treatments, and more environmentally friendly management options are desirable. The objective of this study was to identify viruses present in potato psyllid populations that might be used as biocontrol agents for this insect pest. A new picorna-like virus, tentatively named "Bactericera cockerelli picorna-like virus" (BcPLV), was discovered in B. cockerelli populations maintained in greenhouses, through the use of high-throughput sequencing data and subsequent confirmation by RT-PCR and Sanger sequencing. BcPLV has a positive-sense 9,939-nt RNA genome encoding a single 2,947-aa polyprotein and is related to the Diaphorina citri picorna-like virus (DcPLV) found in Asian citrus psyllid Diaphorina citri populations. Based on their genome organization and the phylogeny of their RNA-dependent RNA polymerase domains, BcPLV and DcPLV together are proposed to comprise a new genus, provisionally named "Psylloidivirus", within the family Iflaviridae.

Occurrence of grapevine-associated tymo-like virus in wine grapes in the United States.

Grapevine-associated tymo-like virus (GaTLV) was reported to infect several grapevine cultivars in France (Hily et al. 2018). Recently, GaTLV-specific reads were identified among high-throughput sequencing (HTS) outputs from a pooled sample of grapevines in Tennessee, but the virus presence in individual plants was not confirmed by the RT-PCR testing with specific primers (Hu et al. 2021). In Idaho, several viruses infect wine grapes, such as grapevine leafroll-associated virus 3 (GLRaV-3; Mekuria et al. 2009; Thompson et al. 2019a), grapevine fleck virus (Kanuya et al. 2012), grapevine red blotch virus (Thompson et al. 2019b), and grapevine rupestris vein feathering virus (Dahan et al. 2021), while GaTLV status was not tested for previously. In September 2020 leaf and petiole samples of six different cultivars were collected from six vineyards in Canyon and Nez Perce counties of Idaho, for a total of 16 samples. Most of the samples were selected based on symptoms of vine decline, grapevine leafroll disease (GLD), or other abnormalities. Ribodepleted total RNAs prepared from these samples as described previously (Thompson et al. 2019a) were subjected to a HTS analysis on a NovaSeq platform, producing between 15,095,042 and 31,500,611 250-bp paired-end reads per sample. Raw reads were adapter and quality cleaned and mapped against the Vitis vinifera L., reference genome. Unmapped paired-end reads were assembled, and contigs were analyzed using BLASTn and DIAMOND (Buchfink et al. 2021) programs. Three of the samples, two collected from own-rooted Chardonnay vines planted in 1981, and one from an own-rooted, 20-yr old Cabernet franc vine, yielded large, 6,005 to 6,024-nt contigs exhibiting 99.0% identity to the sequence of the GaTLV (MH383239) described in France (Hily et al. 2018). Conceivably, these 6,005 to 6,024-nt sequences represented nearly complete genomes of the Idaho isolates of GaTLV; they were designated GaTLV-ID1 to -ID3 and deposited in the GenBank database under the accession numbers ON853767-ON853769. Two specific primer pairs, GaT1_2009F (5'-GGCTGAGTTAAAGGACGAGAA-3') and GaT1_2648R (5'-CGCCACGCCAAGCCAATAATGCT - 3'), and GaT2_5499F (5' - GCCAGAGTTTTCGGAGGCAAA - 3') and GaT2_5905R (5'-CGCGGAAAAACAATTCAGCAA-3') amplifying 662-bp and 427-bp products, respectively, were used to test for GaTLV presence in these 2020 samples, and also in additional 18 samples collected in September 2021 from nine grapevine cultivars in three vineyards of Canyon County, Idaho. Twelve GaTLV-positive samples, out of the 34 total, were identified in five out of the seven tested vineyards located in Canyon and Nez Perce counties of Idaho (Supplementary Fig. S1), in Chardonnay (nine positives), Gewürztraminer (one positive), Cabernet franc (one positive), and an unknown cultivar (one positive). The two RT-PCR products were Sanger sequenced for ten GaTLV-positives and displayed 100% identity to the HTS-derived GaTLV-ID genomic sequences at the targeted regions. The exact role of GaTLV in the development of the symptoms of decline in Chardonnay or in GLD symptoms in Cabernet franc vines is not clear at the moment. These same Chardonnay and Gewürztraminer samples contained other GLD-associated viruses, such as GLRaV-3 (Dahan et al. 2021), while the GaTLV-positive Cabernet franc had only common viroids, hop stunt viroid and grapevine yellow speckle viroid 1, not normally associated with GLD symptoms in wine grapes (Di Serio et al. 2017). To the best of our knowledge, this is the first report of GaTLV in Idaho, and, given the lack of RT-PCR amplifications of GaTLV sequences reported by Hu et al. (2021), also the first confirmed report of GaTLV presence in wine grapes in the United States.

Prevalence of Recombinant Strains of Potato Virus Y in Seed Potato Planted in Idaho and Washington States Between 2011 and 2021.

Potato virus Y (PVY) has emerged as the main reason for potato seed lot rejections, seriously affecting seed potato production in the United States throughout the past 20 years. The dynamics of PVY strain abundance and composition in various potato growing areas of the United States has not been well documented or understood up to now. The objective of this study was to find out the prevalence of PVY strains in potato fields in the Pacific Northwest (PNW), including seed potato production systems in the State of Idaho and commercial potato fields in the Columbia Basin of Washington State between 2011 and 2021. Based on the testing of >10,000 foliar samples during Idaho seed certification winter grow-out evaluations of seed potato lots and seed lot trials in Washington State, a dramatic shift in the PVY strain composition was revealed in the PNW between 2011 and 2016. During this time period, the prevalence of the ordinary, PVYO strain in seed potato dropped 8- to 10-fold, concomitantly with the rise of recombinant strains PVYN-Wi and PVYNTNa, which together accounted for 98% of all PVY positives by 2021. In Idaho seed potato, PVYNTNa strain associated with the potato tuber necrotic ringspot disease (PTNRD) was found to increase threefold between 2011 and 2019, accounting for 24% of all PVY positives in 2019. Mild foliar symptoms induced by recombinant PVY strains may be partially responsible for the proliferation of PVYN-Wi and PVYNTNa in potato crops. A spike of another PTNRD-associated recombinant, PVY-NE11, was recorded in the PNW between 2012 and 2016, but after reaching a 7 to 10% level in 2012 to 2013 this recombinant disappeared from the PNW potato by 2019. Whole genome sequence analysis of the PVY-NE11 suggested this recombinant was introduced in the United States at least three times. The data on PVY strain abundance in the PNW potato crops suggest that virus management strategies must consider the current dominance of the two recombinant PVY strains, PVYN-Wi and PVYNTNa.

Prevalence and Strain Composition of Potato virus Y Circulating in Potato Fields in China's North-Central Province of Shanxi.

Potato is an important crop in Shanxi province, located in north-central China. In 2019 to 2020, 319 potato leaf samples were collected from eight locations distributed in three major potato production areas in Shanxi. BioChip testing revealed the presence of several potato viruses, of which Potato virus Y (PVY) was the most common, reaching an incidence of 87.8% of all symptomatic samples. Immunocaptured multiplex reverse transcription (RT) PCR was used to identify strains for all 280 PVY-positive samples, unveiling 242 samples infected with a single strain of PVY (86.4%) and 38 (13.6%) with a mixed infection. Of samples with a single-strain infection, PVY-SYR-II accounted for 102 (42.1%), followed by PVYN-Wi (33, 13.6%), PVY-SYR-I (28, 11.6%), 261-4 (22, 9.1%), PVYNTNa (20, 8.3%), PVYNTNb (19, 7.9%), and PVY-SYR-III (18, 7.4%). Seven isolates representing different recombinants were selected for whole genome sequencing. Phylogenetic and recombination analyses confirmed the RT-PCR-based strain typing for all seven strains of PVY found in Shanxi. SXKL-12 is the first SYR-III strain from potato reported from China. However, unlike that in other known SYR-III isolates, the region positioned from 1,764 to 1,902 nt in SXKL-12 shared the highest sequence identity of 82.2% with an uncharacterized PVY isolate, JL-23, from China. Interestingly, PVYN-Wi isolate SXZY-40 also possessed a more divergent sequence for the region positioned from 6,156 to 6,276 nt than other N-Wi isolates known to date, sharing the highest identity of 86.6% with an uncharacterized Chinese PVY isolate, JL-11. Pathogenicity analysis of dominant strains PVY-SYR-II and PVYN-Wi in six local popular potato cultivars revealed that 'Kexin 13', 'Helan 15', and 'Jizhangshu 12' were susceptible to these two strains, with mild mottling or mosaic symptom expression, and three cultivars, 'Jinshu 16', 'Qingshu 9', and 'Xisen 6', were fully resistant.

First report of Coleus blumei viroid 1 in commercial Coleus blumei in the United States.

Coleus scutellarioides (syn. Coleus blumei) is a widely grown evergreen ornamental plant valued for its highly decorative variegated leaves. Six viroids, named Coleus blumei viroid 1 to 6 (CbVd-1 to -6) have been identified in coleus plants in many countries of the world (Nie and Singh 2017), including Canada (Smith et al. 2018). However there have been no reports of Coleus blumei viroids occurring in the U.S.A. (Nie and Singh 2017). In April 2021, leaf tissue samples from 27 cultivars of C. blumei, one plant of each, were submitted to the University of Idaho laboratory from a commercial nursery located in Oregon to screen for the presence of viroids. The sampled plants were selected randomly and no symptoms were apparent in any of the samples. Total nucleic acids were extracted from each sample (Dellaporta et al. 1983) and used in reverse-transcription (RT)-PCR tests (Jiang et al. 2011) for the CbVd-1 and CbVd-5 with the universal primer pair CbVds-P1/P2, which amplifies the complete genome of all members in the genus Coleviroid (Jiang et al. 2011), and two additional primer pairs, CbVd1-F1/R1 and CbVd5-F1/R1, specific for CbVd-1 and CbVd-5, respectively (Smith et al. 2018). Five C. blumei plants (cvs Fire Mountain, Lovebird, Smokey Rose, Marrakesh, and Nutmeg) were positive for a coleviroid based on the observation of the single 250-nt band in the RT-PCR test with CbVds-P1/P2 primers. Two of these CbVd-1 positive plants (cvs Lovebird and Nutmeg) were also positive for CbVd-1 based on the presence of a single 150-nt band in the RT-PCR assay with CbVd1-F1/R1 primers. One plant (cv Jigsaw) was positive for CbVd-1, i.e. showing the 150-nt band in RT-PCR with CbVd1-F1/R1 primers, but did not show the ca. 250-bp band in RT-PCR with primers CbVds-P1/P2. None of the tested plants were positive for CbVd-5, either with the specific, or universal primers. All coleviroid- and CbVd-1-specific PCR products were sequenced directly using the Sanger methodology, and revealed whole genomes for five isolates of CbVd-1 from Oregon, U.S.A. The genomes of the five CbVd-1 isolates displayed 96.9-100% identity among each other and 96.0-100% identity to the CbVd-1 sequences available in GenBank. Because the sequences from cvs Lovebird, Marrakesh, and Nutmeg, were found 100% identical, one sequence was deposited in GenBank (MZ326145). Two other sequences, from cvs Fire Mountain and Smokey Rose, were deposited in the GenBank under accession numbers MZ326144 and MZ326146, respectively. To the best of our knowledge, this is the first report of CbVd-1 in the United States.

First report of grapevine rupestris vein feathering virus in wine grapes in Idaho.

Grapevine rupestris vein feathering virus (GRVFV) was found associated with chlorotic discolorations of leaf veins in a Greek grapevine cultivar (El Beaino et al. 2001; Abou Ghanem-Sabanadzovic et al. 2003) or with Syrah decline (Al Rwahnih et al. 2009). In the United States, GRVFV was reported to occur in California (Al Rwahnih et al. 2009) and in Washington State (Chingandu et al. 2021). Wine grape production in Idaho is known to be affected by several viruses, such as grapevine leafroll-associated virus 3 (GLRaV-3; Mekuria et al. 2009; Thompson et al. 2019a), grapevine fleck virus (GFkV; Kanuya et al. 2012), and grapevine red blotch virus (GRBV; Thompson et al. 2019b), but the GRVFV status was not addressed previously. In 2018, leaf and petiole samples from five declining Chardonnay vines were collected from a single vineyard in Canyon County of Idaho. Ribodepleted total RNA prepared from these samples was subjected to a high-throughput sequencing (HTS) analysis on a MiSeq platform as described previously (Thompson et al. 2019a), yielding between 3,623,716 and 4,467,149 300-bp paired-end reads. Briefly, raw reads were adapter and quality cleaned, mapped against the Vitis vinifera L., reference genome. Unmapped paired reads were assembled, producing between 829 and 1,996 contigs over 1,000-nt in length. All five samples were found to contain GLRaV-3 and the two common viroids, hop stunt viroid and grapevine yellow speckle viroid, while four contigs ranging in size from 1,361 to 6,736 and exhibiting homology with the GRVFV were found in three out of the five Chardonnay samples analyzed. Those GRVFV-specific contigs had 98.5-98.7% pairwise identity. A nearly complete genome of GRVFV-ID was assembled from the HTS data of one sample, and the 3'-terminus of the genome was acquired using the RACE methodology; the 6,736-nt sequence has been deposited in the GenBank database under the accession number MZ027155. BLASTn analysis of this sequence revealed 90.7% identity to the closest match in the GenBank database (MH544699, isolate SK931from Slovakia). In the fall of 2020, six commercially operating vineyards in Canyon and Nez Perce Counties of Idaho, including the original one, were sampled for the total of 26 sampled plants of white and red wine grape cultivars, based on visual symptoms of leaf reddening, leaf rolling, and chlorosis, and tested by reverse transcription (RT)-PCR using newly designed GRVFV-specific primers, GRVFV-F1 (5'- GAAGCAACAGTGCCCGTCTC -3') and GRVFV-R1 (5'- AGGTCGCTTTACGGACCTTTTCTT -3'). Four plants were found positive for GRVFV by RT-PCR; these positive samples came from three vineyards in Canyon County, from the same wine grape cultivar, Chardonnay. Amplified RT-PCR products were directly sequenced using conventional Sanger methodology, and confirmed to represent 662-nt segments of the GRVFV genome exhibiting 98.6-99.1% pairwise identity to the HTS-derived full-length genome of GRVFV-ID (MZ027155). The four corresponding partial sequences were deposited under the accession numbers MZ020577 to MZ020580. This close identity between the GRVFV sequences from three different Idaho vineyards, coming from the same cultivar Chardonnay, may suggest a common origin of the original GRVFV infection, possibly the same supplier of the original Chardonnay planting material. The California GRVFV sequence AY706994 was 80% identical to the GRVFV-ID, while the recently reported partial sequences of GRVFV from Washington State (MT782067-MT782070; Chingandu et al. 2021) were found to be only 82-85% identical to the GRVFV-ID. Presence of GRVFV might have contributed to the decline of the original Chardonnay vines, although the exact role of GRVFV in a mixed infection with GLRaV-3 is not clear at the moment. To the best of our knowledge, this is the first report of GRVFV in wine grapes in Idaho.

'Candidatus Liberibacter solanacearum' Infection of Physalis ixocarpa Brot. (Solanales: Solanaceae) in Saltillo, Mexico.

The potato psyllid Bactericera cockerelli (Sulc) (Hemiptera: Triozidae) is a pest of solanaceous crops (order Solanales), including potato (Solanum tuberosum L.) and tomato (S. lycopersicum L.). Feeding by high populations of nymphs causes psyllid yellows while adults and nymphs are vectors of the plant pathogen 'Candidatus Liberibacter solanacearum'. Foliar symptoms that were consistent with either 'Ca. L. solanacearum' infection or psyllid yellows were observed in 2019 on tomatillo (Physalis ixocarpa Brot.; family Solanaceae) grown within an experimental plot located near Saltillo, Mexico. This study had three primary objectives: 9i) determine whether the foliar symptoms observed on tomatillo were associated with 'Ca. L. solanacearum' infection, (ii) identify the haplotypes of 'Ca. L. solanacearum' and potato psyllids present in the symptomatic plot, and (iii) use gut content analysis to infer the plant sources of 'Ca. L. solanacearum'-infected psyllids. Results confirmed that 71% of symptomatic plants and 71% of psyllids collected from the plants were infected with 'Ca. L. solanacearum'. The detection of 'Ca. L. solanacearum' in plants and psyllids and the lack of nymphal populations associated with psyllid yellows strongly suggests that the observed foliar symptoms were caused by 'Ca. L. solanacearum' infection. All infected plants and insects harbored the more virulent 'Ca. L. solanacearum' haplotype B but one psyllid was also coinfected with haplotype A. The potato psyllids were predominantly of the central haplotype but one psyllid was identified as the western haplotype. Molecular gut content analysis of psyllids confirmed the movement of psyllids between noncrop habitats and tomatillo and indicated that 'Ca. L. solanacearum' infection of psyllids was associated with increased plant diversity in their diet.

Molecular and Biological Characterization of Recombinant Isolates of Potato virus Y Circulating in Potato Fields in Mexico.

Potato virus Y (PVY) is a significant threat to potato (Solanum tuberosum) production in Mexico. The presence of recombinant strains of PVY circulating in potato has been reported in the country, but no systematic study on the genetic diversity of PVY in potato and prevalence of PVY strains has been conducted yet. We report on a series of surveys in seed potato production areas in two states in Mexico, namely, Chihuahua and Jalisco, between 2011 and 2019. PVY was detected through the period of nine years in multiple potato cultivars in both states, often remaining asymptomatic in the most popular cultivars, such as 'Fianna' and 'Agata'. When typed to strain, all PVY samples studied were found to have N-serotype, and were all identified molecularly as isolates of the same recombinant strain, PVYNTN. Five of these PVY isolates were tested on tobacco (Nicotiana tabacum), where they induced vein necrosis supporting the molecular typing. This identification was also confirmed biologically on differential potato cultivars, where one PVYNTN isolate from the 2013 survey triggered the hypersensitive resistance conferred by the Nztbr gene in the cv. Maris Bard. Seven of these Mexican PVYNTN isolates, collected between 2013 and 2019, including two PVY isolates from potato tubers exhibiting potato tuber necrotic ringspot disease, were subjected to whole genome sequencing and found to show a typical PVYNTNa recombinant structure. When subjected to phylogenetic analysis, Mexican PVYNTN sequences clustered in more than three separate clades, suggesting multiple introductions of PVYNTN in the country. The wide circulation of the PVYNTN strain in Mexican potato should be considered by potato producers, to develop mitigation strategies for this PVY strain associated with tuber necrotic symptoms.

Proposed revision of the family Secoviridae taxonomy to create three subgenera, "Satsumavirus", "Stramovirus" and "Cholivirus", in the genus Sadwavirus.

We present a taxonomic proposal for revision of the family Secoviridae, a taxon of plant viruses in the order Picornavirales. We propose the reorganization of the genus Sadwavirus to create three new subgenera and to update the classification of five existing species. The proposed subgenera are "Satsumavirus" (one species: Satsuma dwarf virus), "Stramovirus" (two species: Strawberry mottle virus and Black raspberry necrosis virus) and "Cholivirus" (two species: Chocolate lily virus A and Dioscorea mosaic associated virus).

Potato Virus Y (PVY) Isolates from Solanum betaceum Represent Three Novel Recombinants Within the PVYN Strain Group and Are Unable to Systemically Spread in Potato.

Tamarillo, or tree tomato (Solanum betaceum), is a perennial small tree or shrub species cultivated in subtropical areas for fresh fruit and juice production. In Ecuador, tamarillo orchards are affected by several viruses, with one previously identified as potato virus Y (PVY); however, the specific strain composition of PVY in tamarillo was not determined. In 2015 and 2016, eight tamarillo plants exhibiting symptoms of leaf drop, mosaic, and mottled fruit were sampled near Tumbaco and Quito, Ecuador. These tamarillo PVY isolates were able to systemically infect tobacco, Nicotiana benthamiana, naranjilla, and tamarillo. Seven of the eight PVY isolates from tamarillo exhibited N-serotype, while one of the PVY isolates studied, Tam15, had no identifiable serotype. One isolate, Tam17, had N-serotype but produced asymptomatic systemic infection in tobacco. In tamarillo, four tamarillo isolates induced mosaic and slight growth retardation and were unable to systemically infect pepper or potato. Tamarillo, on the other hand, was unable to support systemic infection of PVY isolates belonging to the PVYO and PVYEu-N strains. The whole genomes of eight PVY isolates were sequenced from a series of overlapping RT-PCR fragments. Phylogenetically, tamarillo PVY isolates were found to belong to the large PVYN lineage, in a new tamarillo clade. Recombination analysis revealed that these tamarillo PVY isolates represent at least three novel recombinant types not reported before. The combination of the biological and molecular properties found in these eight PVY isolates suggested the existence of a new tamarillo strain of PVY that may have coevolved with S. betaceum.

Effects of the Age-Related Resistance to Potato virus Y in Potato on the Systemic Spread of the Virus, Incidence of the Potato Tuber Necrotic Ringspot Disease, Tuber Yield, and Translocation Rates Into Progeny Tubers.

The recombinant strain of potato virus Y (PVY), PVYNTN, is the main cause of the potato tuber necrotic ringspot disease (PTNRD) in susceptible potato cultivars, which reduces the quality of potato tubers, in addition to the yield loss. Control of PVY has been the main challenge in most potato-producing areas. Here, the effects of the age-related resistance (ARR) were investigated in transplants of a potato cultivar Yukon Gold to the infection with PVYNTN strain in greenhouse experiments. Within the first 3 weeks after transplanting into soil (week 1 [W1] to W3), Yukon Gold plants developed ARR that impaired the systemic movement of PVYNTN into upper noninoculated leaves and concomitant translocation into progeny tubers starting from W4 after transplanting. The yield and quality of tubers from PVY-infected plants with the established ARR (W5 to W8) were comparable with the healthy controls, suggesting that late PVY infection would not significantly affect commercial potato production. Plants inoculated early (W1 to W2), before the establishment of the ARR, exhibited a 100% primary systemic infection with PVYNTN and produced fewer tubers of smaller sizes, exhibiting PTNRD; this resulted ≤70% yield reduction compared with plants inoculated later in the season (W5 to W8). This ARR greatly restricted the systemic movement of PVYNTN in the foliage and resulted in very limited translocation rates of the virus into tested progeny tubers: 7.8 and 4.1% in 2017 and 2018, respectively, of all plants inoculated later in the season (W5 to W8). This study suggests that PVYNTN management programs in Yukon Gold seed potato should focus more on the early stages of the potato development before the onset of the ARR.

Genetic Diversity of Nine Non-Recombinant Potato virus Y Isolates From Three Biological Strain Groups: Historical and Geographical Insights.

Potato virus Y (PVY) isolates from potato currently exist as a complex of six biologically defined strain groups all containing nonrecombinant isolates and at least 14 recombinant minor phylogroups. Recent studies on eight historical UK potato PVY isolates preserved since 1984 found only nonrecombinants. Here, four of five PVY isolates from cultivated potato or wild Solanum spp. collected recently in Australia, Mexico, and the U.S.A. were typed by inoculation to tobacco plants and/or serological testing using monoclonal antibodies. Next, these five modern isolates and four additional historical UK isolates belonging to biological strain groups PVYC, PVYZ, or PVYN obtained from cultivated potato in 1943 to 1984 were sequenced. None of the nine complete PVY genomes obtained were recombinants. Phylogenetic analysis revealed that the four historical UK isolates were in minor phylogroups PVYC1 (YC-R), PVYO-O (YZ-CM1), PVYNA-N (YN-M), or PVYEu-N (YN-RM), Australian isolate YO-BL2 was in minor phylogroup PVYO-O5, and both Mexican isolate YN-Mex43 and U.S.A. isolates YN-MT12_Oth288, YN-MT12_Oth295, and YN-WWAA150131G42 were in minor phylogroup PVYEu-N. When combined, these new findings and those from the eight historical UK isolates sequenced earlier provide important historical insights concerning the diversity of early PVY populations in Europe and the appearance of recombinants in that part of the world. They and four recent Australian isolates sequenced earlier also provide geographical insights about the geographical distribution and diversity of PVY populations in Australia and North America.

The Recombinant Potato virus Y (PVY) Strain, PVYNTN, Identified in Potato Fields in Victoria, Southeastern Australia.

Potato virus Y (PVY) is one of the main viruses affecting potato in Australia. However, molecular characterization of PVY isolates circulating in potato in different states of Australia has not yet been thoroughly conducted. Only nonrecombinant isolates of three biological PVY strains collected from potato were reported previously from Western Australia and one from Queensland. Here, PVY isolates collected from seed potato originating in Victoria, Australia, and printed on FTA cards, were subjected to strain typing by RT-PCR, with three isolates subjected to whole genome sequencing. All the 59 PVY isolates detected during two growing seasons were identified to be recombinants based on two RT-PCR assays. No nonrecombinant PVY isolates were identified. All the RT-PCR typed isolates belonged to the PVYNTN strain. Sequence analysis of the whole genomes of three isolates suggested a single introduction of the PVYNTN strain to Australia but provided no clues as to where this introduction originated. Given the association of the PVYNTN strain with potato tuber damage, growers in Australia should implement appropriate strategies to manage PVYNTN in potato.

Prevalence of 'Candidatus Liberibacter solanacearum' Haplotypes in Potato Tubers and Psyllid Vectors in Idaho From 2012 to 2018.

'Candidatus Liberibacter solanacearum' (Lso) is an uncultured, phloem-associated bacterium causing a severe tuber disease in potato called zebra chip (ZC). Seven haplotypes of Lso have been described in different hosts, with haplotypes A and B found associated with infections in potato and tomato. In the field, Lso is transmitted by the potato psyllid (Bactericera cockerelli), and between 2011 and 2015, a significant change in Lso haplotype prevalence was previously reported in Idaho: from exclusively A haplotype found in tested psyllids in 2012 to mainly B haplotype found in collected psyllids in 2015. However, prevalence of Lso haplotypes in Idaho was not analyzed in potato tubers exhibiting symptoms of ZC. To fill in this knowledge gap, prevalence of Lso haplotypes was investigated in potato tubers harvested in southern Idaho between 2012 and 2018, and it was found to change from exclusively A haplotype in the 2012 season to an almost equal A and B haplotype distribution during the 2016 season. During the same period, haplotype distribution of Lso in psyllid vectors collected using yellow sticky traps also changed, but in psyllids, the shift from A haplotype of Lso to B haplotype was complete, with no A haplotype detected in 2016 to 2018. The changes in the haplotype prevalence of the Lso circulating in potato fields in southern Idaho may be, among other factors, responsible for a decrease in the ZC incidence in Idaho potato fields between an outbreak of the disease in 2012 and a very low level of ZC afterward.

A Novel Genetic Variant of Grapevine leafroll-associated virus-3 (GLRaV-3) from Idaho Grapevines.

Grapevine leafroll-associated virus-3 (GLRaV-3) is a major constraint on profitable grapevine cultivation. The virus is transmitted efficiently by mealybugs and soft scale insects, or through vegetative propagation by cuttings, and is present worldwide, wherever grapevines are grown. GLRaV-3 exists as a complex of genetic variants currently classified in several phylogenetic groups that can differ from each other by as much as 30% in nucleotide sequence of the whole genome. In the course of the GLRaV-3 testing of wine grapes in southern Idaho, plants of two grapevine cultivars were found to harbor a novel genetic variant of GLRaV-3, named ID45, which exhibited ≤80% nucleotide sequence identity level to the known GLRaV-3 isolates in its most conserved HSP70h gene. The ID45 variant caused no foliar symptoms in 'Cabernet Sauvignon' in the fall, and was demonstrated to have poor reactivity to commercial virus-specific antibodies. The entire 18,478-nt genome sequence of the GLRaV-3-ID45 was determined using a combination of high-throughput and conventional Sanger sequencing, and demonstrated to have typical organization for the genus Ampelovirus (family Closteroviridae), with only 70 to 77% identity level to the GLRaV-3 genomes from other established phylogroups. We concluded that ID45 represented a new phylogenetic group IX of GLRaV-3. Database search using ID45 nucleotide sequence as a query suggested that this novel ID45 variant is present in at least one other grape-growing state in the U.S., California, and in Brazil. An RT-PCR based test was developed to distinguish ID45 from the predominant GLRaV-3 phylogroup I found in Idaho in single and mixed infections.