An Approach to Apply BDNF Targeting Fe3O4-Based Nanoparticles as Multifunctional Anti-Alzheimer Agents.

To search for novel anti-Alzheimer agents, multifunctional Fe3O4-based nanoparticles (FSSIO) is designed and prepared which contain ferulic acid (FA) and Simvastatin linked to the surface of Fe3O4 particles. In vitro tests confirmed that FSSIO possessed favorable biocompatibility and a pronounced ability to penetrate blood brain barrier. The FA moiety endowed the particles with remarkable antioxidant and anti-inflammatory properties, and effectively protected neuron cells from the toxicity induced by Aß. Moreover, the Simvastatin pharmacophore assists the particles up-regulate the expression level of BDNF and significantly promotes the expression levels of p-TrkB, p-ERK, p-PI3K and Akt, which consequently leads to the neurite outgrowth via regulating PI3K/ATK and TrkB-mediated signaling pathway. More importantly, in the Morris water maze test, FSSIO shows excellent activity to enhance the learning and memory retention of AD model rats.

Protein aggregation in plant mitochondria lacking Lon1 inhibits translation and induces unfolded protein responses.

Loss of Lon1 led to stunted plant growth and accumulation of nuclear-encoded mitochondrial proteins including Lon1 substrates. However, an in-depth label-free proteomics quantification of mitochondrial proteins in lon1 revealed that the majority of mitochondrial-encoded proteins decreased in abundance. Additionally, we found that lon1 mutants contained protein aggregates in the mitochondrial that were enriched in metabolic enzymes, ribosomal subunits and PPR-containing proteins of the translation apparatus. These mutants exhibited reduced general mitochondrial translation as well as deficiencies in RNA splicing and editing. These findings support the role of Lon1 in maintaining a functional translational apparatus for mitochondrial-encoded gene translation. Transcriptome analysis of lon1 revealed a mitochondrial unfolded protein response reminiscent of the mitochondrial retrograde signalling dependent on the transcription factor ANAC017. Notably, lon1 mutants exhibited transiently elevated ethylene production, and the shortened hypocotyl observed in lon1 mutants during skotomorphogenesis was partially alleviated by ethylene inhibitors. Furthermore, the short root phenotype was partially ameliorated by introducing a mutation in the ethylene receptor ETR1. Interestingly, the upregulation of only a select few target genes was linked to ETR1-mediated ethylene signalling. Together this provides multiple steps in the link between loss of Lon1 and signalling responses to restore mitochondrial protein homoeostasis in plants.

Lon1 Inactivation Downregulates Autophagic Flux and Brassinosteroid Biogenesis, Modulating Mitochondrial Proportion and Seed Development in Arabidopsis.

Mitochondrial protein homeostasis is crucially regulated by protein degradation processes involving both mitochondrial proteases and cytosolic autophagy. However, it remains unclear how plant cells regulate autophagy in the scenario of lacking a major mitochondrial Lon1 protease. In this study, we observed a notable downregulation of core autophagy proteins in Arabidopsis Lon1 knockout mutant lon1-1 and lon1-2, supporting the alterations in the relative proportions of mitochondrial and vacuolar proteins over total proteins in the plant cells. To delve deeper into understanding the roles of the mitochondrial protease Lon1 and autophagy in maintaining mitochondrial protein homeostasis and plant development, we generated the lon1-2atg5-1 double mutant by incorporating the loss-of-function mutation of the autophagy core protein ATG5, known as atg5-1. The double mutant exhibited a blend of phenotypes, characterized by short plants and early senescence, mirroring those observed in the individual single mutants. Accordingly, distinct transcriptome alterations were evident in each of the single mutants, while the double mutant displayed a unique amalgamation of transcriptional responses. Heightened severity, particularly evident in reduced seed numbers and abnormal embryo development, was observed in the double mutant. Notably, aberrations in protein storage vacuoles (PSVs) and oil bodies were evident in the single and double mutants. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses of genes concurrently downregulated in lon1-2, atg5-1, and lon1-2atg5-1 unveiled a significant suppression of genes associated with brassinosteroid (BR) biosynthesis and homeostasis. This downregulation likely contributes to the observed abnormalities in seed and embryo development in the mutants.

Evaluation of Antioxidant Activity and Treatment of Eczema by Berberine Hydrochloride-Loaded Liposomes-in-Gel.

In this paper, berberine hydrochloride-loaded liposomes-in-gel were designed and developed to investigate their antioxidant properties and therapeutic effects on the eczema model of the mouse. Berberine hydrochloride-liposomes (BBH-L) as the nanoparticles were prepared by the thin-film hydration method and then dispersed BBH-L evenly in the gel matrix to prepare the berberine hydrochloride liposomes-gel (BBH-L-Gel) by the natural swelling method. Their antioxidant capacity was investigated by the free radical scavenging ability on 2,2-diphenyl-1-picrylhydrazyl (DPPH) and H2O2 and the inhibition of lipid peroxides malondialdehyde (MDA). An eczema model was established, and the efficacy of the eczema treatment was preliminarily evaluated using ear swelling, the spleen index, and pathological sections as indicators. The results indicate that the entrapment efficiency of BBH-L prepared by the thin-film hydration method was 78.56% ± 0.7%, with a particle size of 155.4 ± 9.3 nm. For BBH-L-Gel, the viscosity and pH were 18.16 ± 6.34 m Pas and 7.32 ± 0.08, respectively. The cumulative release in the unit area of the in vitro transdermal study was 85.01 ± 4.53 µg/cm2. BBH-L-Gel had a good scavenging capacity on DPPH and H2O2, and it could effectively inhibit the production of hepatic lipid peroxides MDA in the concentration range of 0.4-2.0 mg/mL. The topical application of BBH-L-Gel could effectively alleviate eczema symptoms and reduce oxidative stress injury in mice. This study demonstrates that BBH-L-Gel has good skin permeability, excellent sustained release, and antioxidant capabilities. They can effectively alleviate the itching, inflammation, and allergic symptoms caused by eczema, providing a new strategy for clinical applications in eczema treatment.

Evaluating the Clinical Utility of a Long-Read Sequencing-Based Approach in Prenatal Diagnosis of Thalassemia.

BACKGROUND: The aim is to evaluate the clinical utility of a long-read sequencing-based approach termed comprehensive analysis of thalassemia alleles (CATSA) in prenatal diagnosis of thalassemia. METHODS: A total of 278 fetuses from at-risk pregnancies identified in thalassemia carrier screening by PCR-based methods were recruited from 9 hospitals, and PCR-based methods were employed for prenatal diagnosis. CATSA was performed retrospectively and blindly for all 278 fetuses. RESULTS: Among the 278 fetuses, 263 (94.6%) had concordant results and 15 (5.4%) had discordant results between the 2 methods. Of the 15 fetuses, 4 had discordant thalassemia variants within the PCR detection range and 11 had additional variants identified by CATSA. Independent PCR and Sanger sequencing confirmed the CATSA results. In total, CATSA and PCR-based methods correctly detected 206 and 191 fetuses with variants, respectively. Thus, CATSA yielded a 7.9% (15 of 191) increment as compared with PCR-based methods. CATSA also corrected the predicted phenotype in 8 fetuses. Specifically, a PCR-based method showed one fetus had homozygous HBB c.52A > T variants, while CATSA determined the variant was heterozygous, which corrected the predicted phenotype from ß-thalassemia major to trait, potentially impacting the pregnancy outcome. CATSA additionally identified α-globin triplicates in 2 fetuses with the heterozygous HBB c.316-197C > T variant, which corrected the predicted phenotype from ß-thalassemia trait to intermedia and changed the disease prognosis. CONCLUSIONS: CATSA represents a more comprehensive and accurate approach that potentially enables more informed genetic counseling and improved clinical outcomes compared to PCR-based methods.

Wheat rhizosphere colonization by Bacillus amyloliquefaciens W10 and Pseudomonas protegens FD6 suppress soil and in planta abundance of the sharp eyespot pathogen Rhizoctonia cerealis.

AIMS: Develop quantitative assays (qPCR) to determine the wheat rhizosphere competence of inoculant strains Bacillus amyloliquefaciens W10 and Pseudomonas protegens FD6, and their suppressive efficacies against the sharp eyespot pathogen Rhizoctonia cerealis. METHODS AND RESULTS: Antimicrobial metabolites of strains W10 and FD6 decreased in vitro growth of R. cerealis. A qPCR assay for strain W10 was designed from a diagnostic AFLP fragment and the rhizosphere dynamics of both strains in wheat seedlings were compared by culture-dependent (CFU) and qPCR assays. The qPCR minimum detection limits for strains W10 and FD6 were log 3.04 and log 4.03 genome (cell) equivalents g-1 soil, respectively. Inoculant soil and rhizosphere abundance determined by CFU and qPCR were highly correlated (r > 0.91). In wheat bioassays, rhizosphere abundance of strain FD6 was up to 80-fold greater (P < 0.001) than strain W10 at 14 and 28 days postinoculation. Both inoculants reduced (P < 0.05) rhizosphere soil and root abundance of R. cerealis by up to 3-fold. CONCLUSIONS: Strain FD6 exhibited greater abundance in wheat roots and rhizosphere soil than strain W10 and both inoculants decreased the rhizosphere abundance of R. cerealis.

First report of Arthrobacter woluwensis causing brown blotch disease on white button mushroom (Agaricus bisporus).

Agaricus bisporus is one of the most commonly grown edible fungi in the world. In December 2021, brown blotch disease (2% incidence) was observed on the cap of A. bisporus, growing in a mushroom cultivation base in Guangxi, China. Initially, brown blotches (1-1.3 cm) appeared on the cap of A. bisporus, which expanded gradually as the cap grew. After two days, the infection penetrated inner tissues of fruiting bodies, and blotches were dark brown. For the isolation of causative agent(s), internal tissue samples of the infected stipes (5×5×5 mm) were sterilized in 75% ethanol for 30 s, rinsed three times with sterile deionized water (SDW), then, mashed in the sterile 2 ml Eppendorf tubes, 1000 µl SDW was added and the suspension was diluted into seven concentrations (10-1~10-7). Each suspension (120 µl) was spread on Luria Bertani (LB) medium and incubated for 24 hours at 28 °C. Morphological examination of the isolates was referred to Liu et al (2022). The dominant single colonies were whitish-grayish, smooth, convex. The cells were Gram-positive, non-flagellated, nonmotile, no pods or endospores formed, and no fluorescent pigments production on King's B medium (Solarbio). Amplified 16S rRNA (1351 bp; OP740790) of five colonies using universal primers 27f/1492r (Liu et al., 2022), exhibited 99.26% identity with Arthrobacter (Ar.) woluwensis. The partial sequences of the ATP synthase subunit beta gene (atpD) (677 bp; OQ262957), RNA polymerase subunit beta gene (rpoB) (848 bp; OQ262958), preprotein translocase subunit SecY gene (secY) (859 bp; OQ262959) and elongation factor Tu gene (tuf) (831 bp; OQ262960) genes of colonies were amplified using the method of Liu et al (2018), also exhibited more than 99% similarities to Ar. woluwensis. The biochemical tests for isolates (n=3) were performed via bacterial micro-biochemical reaction tubes (Hangzhou Microbial Reagent Co., LTD), and the results showed the same biochemical characteristics as Ar. woluwensis (Positive for esculin hydrolysis, urea, gelatinase, catalase, sorbitol, gluconate, salicin and arginine. Negative for citrate, nitrate reduction and rhamnose) (Funke et al., 1996). The isolates were identified as Ar. woluwensis based on morphological characteristics, biochemical tests and phylogenetic analysis. Pathogenicity tests were performed with bacterial suspensions (1 × 109 CFU/ml) after growing for 36 h in LB Broth at 28 °C, 160 rpm. 30 µl bacterial suspension was added to the cap and tissue of young A. bisporus. SDW was added as a negative control. All treatments were incubated at 20 °C and 80-85% humidity. The experiment was repeated three times with five caps and five tissues of young A. bisporus each time. Brown blotches were observed on all the parts of the inoculated caps and tissues after 24 h of inoculation. At 48 h, the inoculated caps turned dark brown while the infected tissues changed from brown to black and expanded to the entire tissue block giving a severely rotten appearance and foul odor. This disease symptoms were similar to those observed in the original samples. There were no lesions in the control group. After the pathogenicity test, the pathogen was re-isolated from the infected caps and tissues based on morphological characteristics, 16S rRNA sequences, and biochemical results, fulfilling Koch's postulates. Arthrobacter spp. are very widely distributed in the environment (Kim et al., 2008). To date, two studies have confirmed Arthrobacter spp. as a pathogen of edible fungi (Bessette, 1984; Wang et al., 2019). However, this is the first report of Ar. woluwensis causing brown blotch disease on A. bisporus. Our finding could contribute to developing phytosanitary and control treatments for this disease.

Overexpression of VPS11 antagonizes the promoting effect of miR-542-3p on Mycobacterium tuberculosis survival in macrophages by regulating autophagy.

Impaired autophagy is an important cause of Mycobacterium tuberculosis survival in macrophages. VPS11 is an important regulator of autophagy; decreased VPS11 expression has been observed in macrophages after tuberculosis (TB) infection. Gene ontology data revealed that various miRNAs (for example, miR-542-3p) were upregulated in macrophages upon TB infection; thus, these miRNAs were likely to reduce VPS11 expression. In this study, both TB patients and healthy subjects were enrolled, and the levels of VPS11 and some miRNAs in their blood macrophages were measured. Moreover, various macrophages were cultured and infected with M. tuberculosis. Luciferase reporter, RNA pulldown, and RNA immunoprecipitation assays were performed to determine the regulatory effect of miR-542-3p on VPS11 expression. Results showed that VPS11 expression was downregulated, whereas miR-542-3p expression was upregulated in blood macrophages after TB infection. TB infection reduced VPS11 levels in two human macrophages in vitro, but not in mouse macrophages. This might be because the seed sequence exists in the VPS11 3' untranslated region in humans, but is absent in mice and rats. miR-542-3p promoted M. tuberculosis survival in human macrophages, but VPS11 overexpression antagonized the promoting effect of miR-542-3p. Further, VPS11 was confirmed as a target of miR-542-3p. Overexpression of VPS11 or depletion of miR-542-3p promoted autophagy, which was suppressed upon TB infection. In summary, VPS11 overexpression antagonized the promoting effect of miR-542-3p on M. tuberculosis survival in macrophages by regulating autophagy.

Chromatographic methods for rapid aflatoxin B1 analysis in food: a review.

Aflatoxin B1 (AFB1) is a mycotoxin and is the most carcinogenic of all known chemicals. In view of the AFB1 characteristics of widespread distribution, serious pollution, great harm to humans, and animals and difficult to remove, it is urgent to develop a convenient and sensitive detection method. Moreover, chromatographic test strips (CTSs) are a rapid detection technology that combines labeling technology with chromatography technology. CTSs have been widely used in the fields of environmental monitoring, medical diagnosis, and food safety analysis in recent years. Different from other immune assays, they have the advantages of short measuring time, low cost, high efficiency and no need for professionals to operate. In addition, the introduction of nanomaterials has laid a good foundation for the detection of high sensitivity, high specificity and high efficiency via CTSs. Herein, we tend to comprehensively introduce the applications of chromatographic methods in AFB1 detection and pay attention to the signal detection modes based on nanomaterials in antibody-based immunochromatographic strips (ICSs), such as colorimetric, fluorescent, chemiluminescent, and Raman scattering sensing. Some typical examples are also listed in this review. In the end, we make a summary and put forward prospects for the development of CTSs.

This review is the first systematic review about the applications of antibody-/aptamer-based chromatographic methods for rapid AFB1 detection.Pay attention to the signal detection modes based on nanomaterials in antibody-ICSs, such as colorimetric, fluorescent, chemiluminescent and Raman scattering sensing.Make a summary about some typical examples and put forward prospects for the development of CTSs.

First report of Pseudomonas mosselii causing white blotch disease in Pleurotus pulmonarius in China.

Pleurotus pulmonarius is a popular and widely cultivated edible mushroom in China. In November 2021, white blotch disease (3% incidence) was observed on the cap of P. pulmonarius, growing in a mushroom farm in Nanning, China. Initially, white blotch (0.7-1.6 cm) appeared on the cap of the young P. pulmonarius, which expanded gradually as the cap grew. However, the fruiting bodies still grew well without rotting. The pathogen causing this phenomenon was isolated from infected cap tissues using a dilution plate technique, sections of tissue (approximately 5×5×5 mm) with white blotch were rinsed three times in sterile deionized water, then, mashed in the sterile 2 ml eppendorf tubes, 1000µl sterile water was added and the suspension was diluted into eight concentrations (10-1~10-8). From each concentration, 120µl suspension was spread on Luria Bertani (LB) medium and incubated for 24 hours at 28°C. Both 10-5 and 10-6 suspensions had single colonies, the dominant single colonies were picked and purified 2-3 times. The purified colonies were round, beige, and opaque, with a raised center and regular, smooth and moist margins. This bacterium is gram negative, short rod-shaped, single polar flagellum, motile, without pods or endospores, and produced fluorescent pigments on King's B medium. Amplified 16S rDNA (1396 bp; OM022022) of four randomly selected colonies using universal primers 27f/1492r, exhibited 100% identity with Pseudomonas (Ps.) mosselii. The partial sequences of the rpoB (1173bp; OM202622), rpoD (734bp; ON469579), gyrB (1383bp; OM202621) and recA (887bp; ON469580) genes of four selected colonies were amplified using primers LAPS5/LAFS27(Tayeb et al. 2005.), PsEG30F/PsEG790R (Mulet et al. 2009), gyrB-R/gyrB-F (Agaras et al. 2018) and recA-F (5'-3' ACGACAACAAGAAGCGCGCCTT)/recA-R (5'-3' CAATGGCCGGGTTCTCTTGCAGGTA) designed in this study, respectively, also exhibited 99%~100% similarities to Ps. mosselii. Phylogenetic analysis showed that isolates cluster with Ps. mosselii. The biochemical tests for isolates were performed via bacterial micro-biochemical reaction tubes (Hangzhou Microbial Reagent Co., LTD), and the results showed the same biochemical characteristics as Ps. mosselii (Positive for arginine dihydrolase, trisodium citrate, urea, lysine, arginine, ornithine and gelatin. Negative for glucosamine, lactose, galactose, rhamnose, maltose, sucrose, arabinose, mannose, xylose, esculoside, inositol, nitrate reduction and malonate) (Dabboussi et al.2002; Soto-Rodriguez et al. 2013). The isolates were identified as Ps. mosselii based on biochemical tests and phylogenetic analysis. This isolate was incubated in LB Broth at 28℃, 160 rpm for 24h and the bacterial cells were collected by centrifugation at 4000 rpm for 10min. The collected bacterial cells were resuspended in sterile deionized water to make a bacterial suspension. For pathogenicity tests, 30µl of bacterial suspension (approximately 1x10^9 CFU/mL) was added to the surface of the cap (3-4cm) of young P. pulmonarius. Sterile deionized water was added as a negative control. All treatments were incubated at 22°C and 80-85% humidity. The experiment was repeated three times with three bags each time. 12 h later, white blotches were visible on all parts of the inoculated mushroom. This disease symptoms were similar to those observed in the original samples. However, no disease phenomena were observed in the negative control group. After the pathogenicity test, we obtained the same pathogen as the initially isolates from infected tissues based on morphological characteristics, 16S rDNA sequences, rpoB, rpoD, gyrB and recA sequences, and biochemical test results. Ps. mosselii was first isolated clinically and described by Dabboussi et al. (2002). It has shown to be pathogenic to Oreochromis niloticus and humans (Soto-Rodriguez et al. 2013; Peña et al. 2019; Leneveu-Jenvrin et al. 2013; Huang et al. 2018.). However, to the best of our knowledge, this is the first report of Ps. mosselii causing white blotch disease in P. pulmonarius worldwide, which negatively affects the commercial value of P. pulmonarius and requires attention of mushroom industry.

Design and synthesis of alkyl substituted pyridino[2,3-D]pyrimidine compounds as PI3Kα/mTOR dual inhibitors with improved pharmacokinetic properties and potent in vivo antitumor activity.

Using pyridino[2,3-D]pyrimidine as the core, total 13 pyridino[2,3-D]pyrimidine derivatives with different alkyl substituents at C2 site have been designed and synthesized to search for novel PI3Kα/mTOR dual inhibitors. Most of the target compounds showed potent mTOR inhibition activity with IC50 values ranging from single to double digit nanomole. Five target compounds exhibited pronounced PI3Kα inhibition activity. In vitro cellular assay indicated that most of the target compounds showed excellent antiproliferative activity, especially 3j whose potency against SKOV3 was 8-fold higher than the positive control AZD8055. In vitro metabolic stability study found that 3j had a comparable stability to that of AZD8055. More importantly, 3j showed better antitumor activity and pharmacokinetic properties in vivo as compared with AZD8055.

Low apolipoprotein M serum levels correlate with Systemic lupus erythematosus disease activity and apolipoprotein M gene polymorphisms with Lupus.

BACKGROUND: Sequence variation in gene promoters is often associated with disease risk. In this study, we tested the hypothesis that common promoter variation in the APOM gene is associated with systemic lupus erythematosus (SLE) risk and SLE-related clinical phenotypes in a Chinese cohort. Meanwhile, we investigated the expression of apolipoprotein M (APOM) in the serum of patients with systemic lupus erythematosus (SLE) and its relationship with disease activity. METHODS: We used a case-control design and genotyped 52 SLE patients and 52 healthy controls for 19 APOM promoter single nucleotide polymorphism (SNP) (rs113947529, rs1143030, rs114826514, rs116715239, rs12525463, rs1266078, rs2273612, rs28432254, rs34490746, rs4947251, rs55880811, rs707921, rs74890500, rs75629491, rs76611345, rs76794541, rs805264, rs805297, rs9267528). Genotyping was done by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). The blood serum concentration of APOM was measured by an enzyme-linked immunosorbent assay in SLE patients and controls. RESULTS: The average concentration of APOM in serum was significantly lower in SLE patients compared to controls and APOM levels in SLE patients with positive anti-dsDNA antibodies were dramatically lower than that of patients with negative anti-dsDNA antibodies (P = 0.011). It was interesting that APOM levels correlated with systemic lupus erythematosus disease activity index (SLEDAI) scores (r = -0.396, P = 0.004). No association between APOM and SLE susceptibility was detected in our Han Chinese cohort. CONCLUSIONS: Our results demonstrated that lower APOM levels in SLE patients and correlated with disease activity.

High apolipoprotein M serum levels correlate with chronic obstructive pulmonary disease.

BACKGROUND: Recently, variations in a component of high-density lipoprotein (HDL), namely apolipoprotein M (apoM), were found to be associated with chronic obstructive pulmonary disease (COPD). The aim of this study was to evaluate the association between apoM and COPD severity. Factors associated with apoM, COPD, or coronary artery disease (CAD) were also assessed. METHODS: A total of 110 COPD patients and 110 age- and sex-matched non-COPD controls were included. Among them, thirty COPD patients and seven non-COPD controls had CAD. ApoM and pentraxin-3 levels were measured by ELISA. Additionally, the levels of high-sensitivity C-reactive protein (hs-CRP), cholesterol, and triglyceride were assessed using an automatic biochemical analyzer. RESULTS: Serum apoM levels increased gradually with COPD severity, with the most prominent apoM elevation observed in very severe COPD cases. In addition, ApoM was correlated with percent-predicted forced expiratory volume in one second (% predicted FEV1) (r = -0.38, P < 0.001), low-density lipoprotein cholesterol (LDL-C) (r = 0.23, P < 0.017), and hs-CRP (r = 0.24, P = 0.01) in COPD patients. Furthermore, apoM was shown to be a risk factor for COPD onset (OR = 1.095, 95% CI = 1.034-1.160, P = 0.002), but not associated with CAD in COPD patients. CONCLUSIONS: Serum apoM was elevated in COPD patients and increased gradually with COPD severity. However, there was no association between apoM and CAD development in COPD patients.

The death-inducer obliterator 1 (Dido1) gene regulates embryonic stem cell self-renewal.

The regulatory network of factors that center on master transcription factors such as Oct4, Nanog, and Sox2 help maintain embryonic stem (ES) cells and ensure their pluripotency. The target genes of these master transcription factors define the ES cell transcriptional landscape. In this study, we report our findings that Dido1, a target of canonical transcription factors such as Oct4, Sox2, and Nanog, plays an important role in regulating ES cell maintenance. We found that depletion of Dido1 in mouse ES cells led to differentiation, and ectopic expression of Dido1 inhibited differentiation induced by leukemia inhibitory factor withdrawal. We further demonstrated that whereas Nanog and Oct4 could occupy the Dido1 locus and promote its transcription, Dido1 could also target to the loci of pluripotency factors such as Nanog and Oct4 and positively regulate their expression. Through this feedback and feedforward loop, Dido1 is able to regulate self-renewal of mouse ES cells.

[Association of serum level of apolipoprotein M with disease activity in systemic lupus erythematosus].

OBJECTIVE: To explore the association of serum level of apolipoprotein M with disease activity in systemic lupus erythematosus (SLE). METHODS: A total of 65 patients with SLE, who came to Second Xiangya Hospital for treatment from April to November in 2013 (SLE group) and 120 age-and sex-matched controls (control group) were studied. The SLE group was further divided into three groups according to systemic lupus erythematosus disease activity index (SLEDAI): a mild activity group, a moderate activity group and a severe activity group (n=16, 16, 33, respectively). The control group was also divided into a disease control group (n=60) and a healthy control group (n=60). The serum levels of apo M were measured by enzyme-linked immunosorbent assay (ELISA). Other indicators including TC, TG, HDL, LDL, apo A1, apo B, and anti-dsDNA antibody were detected. The correlation between SLEDAI or anti-dsDNA antibody and apo M was assessed. RESULTS: Compared with the healthy control group, the expression levels of apo M and HDL were decreased significantly (both P<0.05), and the expression levels of anti-dsDNA antibody, TG, apo B were increased significantly in the SLE group (all P<0.05). Comparison among the three subgroups, no significant differences in apo M were found (all P>0.05). The serum concentration of apo M was significant negatively correlated with SLEDAI and anti-dsDNA antibody (r=-0.551, -0.562, both P<0.01). CONCLUSION: Compared with the healthy control group, the serum levels of apo M in patients with SLE are significantly decreased. The apo M is closely correlated with disease activity of SLE and it might be used as an indicator to monitor the disease activity of SLE.

In vitro potential of Lycosin-I as an alternative antimicrobial drug for treatment of multidrug-resistant Acinetobacter baumannii infections.

The resistance of multidrug-resistant Acinetobacter baumannii (MDRAB) isolates to most traditional antibiotics results in huge challenges for infection therapy. We investigated the in vitro activities of both l- and d-lycosin-I against MDRAB. These two compounds displayed high antibacterial activities and rapid bactericidal effects against MDRAB. Moreover, the compounds retained their activity even at high salt (Mg(2+) or Ca(2+)) concentrations. These results demonstrate the potential of lycosin-I to be developed as a new antibiotic.

Emodin alleviates intestinal ischemia-reperfusion injury through antioxidant stress, anti-inflammatory responses and anti-apoptosis effects via Akt-mediated HO-1 upregulation.

BACKGROUND: Intestinal ischemia-reperfusion (I/R) injury is a severe vascular emergency. Previous research indicated the protective effects of Emodin on I/R injury. Our study aims to explore the effect of Emodin on intestinal I/R (II/R) injury and elucidate the underlying mechanisms. METHODS: C57BL/6 mice and Caco-2 cells were used for in vivo and in vitro studies. We established an animal model of II/R injury by temporarily occluding superior mesenteric artery. We constructed an oxygen-glucose deprivation/reoxygenation (OGD/R) cell model using a hypoxia-reoxygenation incubator. Different doses of Emodin were explored to determine the optimal therapeutic dose. Additionally, inhibitors targeting the protein kinase B (Akt) or Heme oxygenase-1 (HO-1) were administered to investigate their potential protective mechanisms. RESULTS: Our results demonstrated that in animal experiments, Emodin mitigated barrier disruption, minimized inflammation, reduced oxidative stress, and inhibited apoptosis. When Akt or HO-1 was inhibited, the protective effect of Emodin was eliminated. Inhibiting Akt also reduced the level of HO-1. In cell experiments, Emodin reduced inflammation and apoptosis in the OGD/R cell model. Additionally, when Akt or HO-1 was inhibited, the protective effect of Emodin was weakened. CONCLUSIONS: Our findings suggest that Emodin may protect the intestine against II/R injury through the Akt/HO-1 signaling pathway.

Engineered plant extracellular vesicles for natural delivery across physiological barriers.

Extracellular vesicles (EVs) are nanoscale luminal vesicles that participate in the information transfer of proteins, nucleic acids, and lipids between cells, thereby playing a role in the treatment of diseases and the delivery of nutrients. In recent years, plant-derived EVs (PDEVs) containing bioactive compounds have attracted increasing interest due to their better biocompatibility and lower cytotoxicity in healthy tissues. In the biomedical field, PDEVs have been used as cargo carriers to achieve various functions through engineering modification techniques. This review focuses on the biogenesis, isolation, and identification of PDEVs. We discuss the surface functionalization of PDEVs to enhance therapeutic efficacy, thereby improving their efficiency as a next-generation drug delivery vehicle and their feasibility to treat diseases across the physiological barriers, while critically analyzing the current challenges and opportunities.

Emodin alleviates intestinal ischemia/reperfusion-induced lung injury by upregulating HO-1 expression via PI3K/AkT pathway.

BACKGROUND: Emodin, a natural anthraquinone derivative found in various Chinese medicinal herbs, has been proved to be an effective therapeutic agent in the treatment of many diseases. However, its effect on lung injury after intestinal ischemia/reperfusion injury remains unknown. This research was designed to investigate whether emodin protects against intestinal ischemia/reperfusion-induced lung injury and to elucidate the underlying molecular mechanisms in vivo and in vitro. METHODS: Intestinal ischemia/reperfusion injury was induced by occluding the superior mesenteric artery in mice, and mouse lung epithelial-12 cells were subjected to oxygen-glucose deprivation and reoxygenation to establish an in vitro model. RESULTS: Our data indicated that emodin treatment reduced intestinal ischemia/reperfusion-induced oxidative stress, inflammation and apoptosis in lung tissues and alleviated lung injury. However, the protective effects of emodin on intestinal ischemia/reperfusion-induced lung injury were reversed by the protein kinase B inhibitor triciribine or the heme oxygenase-1 inhibitor tin protoporphyrin IX. The protein kinase inhibitor triciribine also downregulated the expression of heme oxygenase-1. CONCLUSION: In conclusion, our data suggest that emodin treatment protects against intestinal ischemia/reperfusion-induced lung injury by enhancing heme oxygenase-1 expression via activation of the PI3K/protein kinase pathway. Emodin may act as a potential therapeutic agent for the prevention and treatment of lung injury induced by intestinal ischemia/reperfusion.

Bushen Zhuyun Decoction Improves Endometrial Receptivity by Inhibiting NF-κB/NLRP3 Signaling Pathway.

OBJECTIVE: Bushen Zhuyun Decoction (BSZY), a traditional Chinese herbal prescription has shown promising effects on gynecological infertility, but the mechanism for endometrial receptivity is still unclear. This study aimed to investigate the regulatory effects of BSZY on endometrial receptivity, which plays a key role in colonization of embryo, and its regulatory mechanisms associated with NF- κB/NLRP3 pathway. METHODS: SD rats at reproductive age with affected endometrial receptivity was established using mifepristone (RU486), and the regulatory effects of BSZY on endometrial receptivity were evaluated by H&E staining, and changes in sex hormones by ELISA and Western blot. Moreover, human endometrial RL95-2 cells were treated with H2O2, and inflammatory cytokines in rats and RL95-2 cells were analyzed by ELISA. The activation of NF-κB/NLRP3 signaling pathway in RL95-2 cells were characterized using immunofluorescence and Western blot. Mitochondrial morphology and function in RL95-2 cells were observed by transmission electron microscope and cell mitochondrial stress test. RESULTS: BSZY increased uterine endometrial thickness and attenuate histopathological changes induced by RU486. BSZY can regulate endometrial estrogen receptor and progesterone receptor, and the levels of sex hormones and inflammatory cytokines in pregnant rats. BSZY-containing serum also showed strong anti-inflammatory and cytoprotective effects in vitro. In addition, BSZY-containing serum inhibited the activation of NF-κB/NLRP3 signaling pathway, and improve mitochondrial morphology and function in RL95-2 cells. CONCLUSION: BSZY can improve endometrial receptivity, potentially by improving mitochondrial morphology and function to inhibit the activation of NF-κB/NLRP3 signaling pathway in endometrial cells, thus regulate inflammation to improve endometrial receptivity.