The PapG-adhesin at the tip of P-fimbriae provides Escherichia coli with a competitive edge in experimental bladder infections of cynomolgus monkeys.

Human urinary tract infection is an infectious disease that depends on a series of host-microbial interactions. The bacteria first colonize the colon and then the periurethral/vaginal areas; they ascend to and infect first the bladder and then the kidneys. Expression of Escherichia coli P-fimbriae constitutes the strongest correlation to renal pathogenicity, but is also related to first-time cystitis in children. The role of P-fimbriae in the preceding steps in the infectious process is unknown. To examine this, we constructed, from a P-fimbriated E. coli strain with a class II G-adhesin preferentially binding to globoside, one isogenic mutant lacking the G-adhesin and another isogenic mutant in which we replaced the papG class II allele with a class III adhesin preferentially binding to the Forssman antigen. We report here the comparison of the adhesin knockout mutant (DS17-8) and the class-switch mutant (DS17-1) with the wild-type (DS17) for in vivo colonization of the gut, vagina, and bladder of cynomolgus monkeys. It was recently shown that the class II tip G-adhesin is a prerequisite for acute pyelonephritis to occur in the monkey model in the absence of other kidney-specific adhesins or obstruction of the urinary flow. Here we show that it is not required for bladder infection but gives a competitive advantage in mixed infections. In the vagina and colon, the G-adhesin gives no competitive advantage.

Antibody responses in patients with invasive Staphylococcus aureus infections.

Correlation between antibody response and clinical outcome in Staphylococcus aureus bacteremia has yielded conflicting results. Immunization schedules have failed in clinical trials. Is the humoral response toward S. aureus of protective nature? A prospective study was performed in patients with invasive S. aureus (ISA) infections during the period 2003-2005. The antibody levels were determined at the beginning and at the end of treatment and one month later (n = 96, n = 71, and n = 51, respectively). As controls, 115 healthy individuals were used. A quantitative enzyme-linked immunosorbent assay (ELISA) against eight purified antigens was performed. Bacterial isolates were grouped as to the production of alpha-toxin, agr type, and pulsed-field gel electrophoresis (PFGE) type. Large variations were seen in the antibody levels. The levels in the second sample were the highest. A correlation between agr group, PFGE group, alpha-toxin production, and initial antibody levels was observed. Patients with fatal outcome displayed lower initial antibody levels to all antigens and significantly so in regard to teichoic acid, lipase, enterotoxin A, and scalded skin syndrome toxin. In episodes with complicated bacteremia, initial significantly low levels to teichoic acid and lipase were registered. Low initial antibody levels against several antigens were associated with increased mortality and complicated bacteremia in invasive S. aureus infections. Bacterial properties, strain, and toxin production affected the antibody response.

Host species-specific translocation of Escherichia coli.

The purpose of this paper is to investigate the rate of translocation of Escherichia coli strains in different experimental/animal models. Four proficient translocating E. coli strains isolated from mesenteric lymph nodes (MLNs) and/or the blood of rats (strains KIC-1 and KIC-2), from a fatal case of pancreatitis (HMLN-1) and from pigs (PC-1 isolated in this study) were tested for their ability to translocate across two host species and the Caco-2 cell line as a model of the human gut epithelium. HMLN-1 was found in the MLNs of all 15 pigs tested. This strain, however, did not translocate in any rats and only colonised the caecum of four rats in small numbers. HMLN-1 and PC-1 were the dominant translocating strains in Caco-2 cells compared to KIC-1 and KIC-2, which were found to translocate at a lower rate in pigs and in Caco-2 cells. The rate of translocation of PC-1 in rats was also very low compared to KIC-1 and KIC-2. We suggest that, in studies aiming to investigate the mechanism of translocation of E. coli strains isolated from humans, rats may not be an appropriate animal model and that the Caco-2 cells or pigs are more suitable in vitro and in vivo models, respectively.

Molecular structure and transferability of Tn1546-like elements in Enterococcus faecium isolates from clinical, sewage, and surface water samples in Iran.

The molecular structure and transferability of Tn1546 in 143 vancomycin-resistant Enterococcus faecium (VREF) isolates obtained from patients (n = 49), surface water (n = 28), and urban and hospital sewage (n = 66) in Tehran, Iran, were investigated. Molecular characterization of Tn1546 elements in vanA VREF was performed using a combination of restriction fragment length polymorphism analysis and DNA sequencing of the internal PCR fragments of vanA transposons. Long-PCR amplification showed that the molecular size of Tn1546 elements varied from 10.8 to 12.8 kb. The molecular analysis of Tn1546 showed that 45 isolates (31.5%) harbored a deletion/mutation upstream from nucleotide 170. No horizontal transfer of Tn1546 was observed following filter-mating conjugation with these isolates. Nevertheless, the rates of transferability for other isolates were 10(-5) to 10(-6) per donor. Insertion sequences IS1216V and IS1542 were present in 103 (72%) and 138 (96.5%) of the isolates, respectively. The molecular analysis of Tn1546 elements resulted in three genomic organizations. The genomic organization lineage 1 was dominated by the isolates from clinical samples (3.4%), lineage 2 was dominated mostly by sewage isolates (24.5%), and lineage 3 contained isolates obtained from all sources (72.1%). The genetic diversity determined using pulsed-field gel electrophoresis (PFGE) revealed a single E. faecium clone, designated 44, which was common to the samples obtained from clinical specimens and hospital and municipal sewage. Furthermore, the results suggest that lineage 3 Tn1546 was highly disseminated among our enterococcal isolates in different PFGE patterns.

Aeromonas-Acanthamoeba interaction and early shift to a viable but nonculturable state of Aeromonas by Acanthamoeba.

AIMS: To investigate the hypothesis that amoeba may comprise a significant environmental reservoir for Aeromonas, Acanthamoeba-Aeromonas interaction experiments were performed. METHODS AND RESULTS: Acanthamoeba were grown in monoculture and co-cultures with three different species of Aeromonas. Survival, invasion and viable but nonculturable state experiments were performed. We showed that at a low initial bacterial cell density, growth of Aeromonas spp. was inhibited by Acanthamoeba castellanii, while A. castellanii growth was unaffected. In contrast, a high initial bacterial cell density, Aeromonas hydrophila AEW44 and Aeromonas veronii biovar sobria AEW104 suppressed the growth of A. castellanii. Fluorescent and phase-contrast microscopic observations of GFP tagged Aer. hydrophila AEW44 demonstrated that the bacterial cells aggregated on A. castellanii cells after 15 min of incubation and internalized. Aeromonas hydrophila AEW44 cells were found to be actively moving. Interestingly, Aer. hydrophila AEW44 cells shifted more rapidly to a viable but nonculturable form when co-cultured with A. castellanii than in monoculture. CONCLUSIONS: We demonstrated that Aeromonas spp. are able to interact with and to infect the protozoan A. castellanii under laboratory conditions. SIGNIFICANCE AND IMPACT OF THE STUDY: Free-living amoeba might play a role as reservoir for Aeromonas, and thus may increase the transmission of Aeromonas by acting as a vehicle.

Induction of protective immunity after escherichia coli bladder infection in primates. Dependence of the globoside-specific P-fimbrial tip adhesin and its cognate receptor.

Clinical observations suggest that immune mechanisms affect etiology and course of recurrent cystitis. A primate infection model was used to show that primary bladder infection with a uropathogenic P-fimbriated strain (binding to globoside present in the bladder wall) protects against rechallenge with homologous as well as heterologous Escherichia coli strains for up to 5-6 mo. In contrast, mutant derivatives producing P-fimbriae either lacking the tip adhesin protein or carrying an adhesin for which no bladder receptor was present, were unable to induce protection, even though they generated bladder infections of similar duration as the wild type. Therefore, the protective effect mediated by the adhesin seemed to depend upon the presence of its cognate receptor. Since the wild strain also mediated protection against mutants that lacked the adhesin, our data suggest that the globoside-binding PapG adhesin acts as an adjuvant during infection to enhance a specific response against other bacterial antigens. In fact, the globoside-binding strain DS17, but not the mutant DS17-1, unable to bind to membrane-bound globoside, elicited a secretory IgA response to LPS in urine. These in vivo findings suggest that bacterial adhesin-ligand interactions may have signaling functions of importance for the immune response.

Classification of microbial, plant and animal cytolysins based on their membrane-damaging effects of human fibroblasts.

38 cytolytic agents of mainly microbial origin were investigated with respect to membrane-damaging activity on human diploid fibroblasts. Increased plasma membrane permeability was measured as leakage of three defined cytoplasmic markers of various sizes: alpha-aminoisobutyric acid, uridine nucleotides and ribosomal RNA. The relative leakages of these markers, caused by different concentrations of the various cytolysins, yielded a leakage pattern for each substance. Five distinct types of leakage patterns were obtained. These were transformed into numerical expressions by calculating the ratios between the amounts of cytolysin needed to release 50% of the nucleotide and ribosomal RNA markers and the amounts required to release 50% of the alpha-aminoisobutyric acid marker (ED50 ratios). A classification of the cytolysins into five groups was arrived at on the basis of the different types of leakage patterns with the aid of reference cytolysins with well-known mechanisms of membrane interaction. These groups comprised: (1) detergent-like agents, (2) agents interacting with only certain constituents of the cell membrane, (3) agents interacting with specific receptor molecules in the membrane, (4) agents inducing small functional holes of a definable size, and (5) agents inducing only a very limited increase in plasma membrane permeability. The system may be useful for characterization and differentiation of new cytolytic agents of various sources as it divides membrane-damaging agents into separate groups on the basis of their principal function on intact human cells.

Changes of viability and composition of the Escherichia coli flora in faecal samples during long time storage.

Long-time storage of faecal samples is necessary for investigations of intestinal microfloras. The aim of the present study was to evaluate how the viability and the composition of the Escherichia coli flora are affected in faecal samples during different storage conditions. Four fresh faecal samples (two from calves and two from infants) were divided into sub-samples and stored in four different ways: with and without addition of glycerol broth at -20 degrees C and at -70 degrees C. The viability and the phenotypic diversity of the E. coli flora in the sub-samples were evaluated after repeated thawings and after storage during 1 year. The samples stored for 1 year without thawing were also kept at room temperature for 5 days and subsequently analysed. According to phenotyping (PhP analysis) of 32 isolates per sample on day 0, all four samples contained two dominating strains of E. coli each, and between one and eight less common strains. Samples that were stored at -70 degrees C in glycerol broth showed equal or even higher bacterial numbers as the original samples, even after repeated thawings, whereas samples stored at -20 degrees C showed a considerably lower survival rate, also with addition of glycerol. Sub-samples containing glycerol broth that were kept at room temperature after storage for 1 year showed a clear increase in the number of viable cells as well as in diversity. The diversities in each sub-sample showed a tendency to decrease after several thawings as well as after storage. Generally, the E. coli populations in samples stored at -20 degrees C were less similar to the population of the original sample than that in samples stored at -70 degrees C. Samples that had been mixed with glycerol broth had an E. coli flora more similar to that in the original sample than those without glycerol broth. Furthermore, the sub-samples that were kept at room temperature after storage for 1 year generally were more similar to the original samples than if they were processed directly. We conclude that for long time storage of faecal samples, storage at -70 degrees C is preferable. If samples have to be thawed repeatedly, addition of glycerol is preferable both for samples stored at -70 degrees C and for samples stored at -20 degrees C. Our data also have indicated that when E. coli isolates from faecal samples are selected for, e.g. analysis of virulence factors, it is necessary to pick several isolates per sample in order to obtain at least one isolate representing the dominating strain(s).

Virulence characteristics of Escherichia coli strains causing acute cystitis in young adults in Iran.

BACKGROUND: Escherichia coli strains that cause cystitis posses virulence properties that facilitate their colonisation and persistence in the bladder. In Iran, despite the high number of the urinary tract infections, very few studies has been done to determine the role of these virulence properties in the pathogenesis of E. coli cyctitis. PATIENTS AND METHODS: Eighty-seven strains of E. coli, isolated from young adults with cystitis in Shiraz, Iran, were examined for the expression of type 1 and P-fimbriae, mannose resistant haemagglutination, haemolysin production, aerobactin-mediated iron uptake, O:K serotypes, biochemical phenotypes (BPTs) and their antibiotic susceptibility patterns. RESULTS: Seventy-six percent of the strains expressed multiple virulence properties. There was a significant correlation between the presence of aerobactin and the expression of type 1 fimbriae. All P-fimbriated strains produced aerobactin with 50% of them also coexpressing haemolysin. Of the 29 different O:K serotypes identified, 42% belonged to serotypes not commonly found among European serotypes associated with UTI. Strains of O groups 4 and 6 expressed more virulence factors than the others. A high resistance against ampicillin, trimethoprim and cotrimoxasol was observed among the isolates with 53% of the isolates showing multiresistance to these three antibiotics. Certain BPTs were also found among O:K serotypes with some containing strains of the same virulence profile. CONCLUSION: We conclude that certain colonal groups of E. coli are commonly associated with cystitis in young adults in Iran with strains possessing a combination of aerobactin and type 1 fimbriae being the dominant ones and belonging to serotypes not commonly found in Europe. We also conclude that the multiple antibiotic resistant E. coli strains causing cyctitis are highly prevalent in this part of the country.

Enzyme-linked immunosorbent assay (ELISA) for antibodies to Clostridium difficile toxins in patients with pseudomembranous colitis and antibiotic-associated diarrhoea.

Enzyme-linked immunosorbent assay (ELISA) was established with purified toxins from Clostridium difficile as antigen to measure antibody response in patients with pseudomembranous colitis (PMC) and prolonged antibiotic-associated diarrhoea (AAD). Positive ELISA titres were defined in a control population. Antibodies of IgG class against toxin B were demonstrated in 6/88 (7%) control sera and in 31/61 (51%) sera from 11/19 (58%) patients. Antibodies of IgA class were found in one patient while antibodies of IgM class were not demonstrated. ELISA antibodies against toxin A were not demonstrated. For comparison a neutralization test was performed and neutralizing antibodies to toxin B but not to toxin A were demonstrated in 10/61 (16%) sera from 4/19 (21%) patients and in none of the controls. ELISA was found to be a more sensitive assay than neutralization. ELISA antibodies were detected from the third week of the disease while neutralizing antibodies appeared after 5 weeks. Lack of an antibody response in ELISA seemed to correlate to a more severe colitis.

Comparison of five calculation modes for antibody ELISA procedures using pertussis serology as a model.

During a phase III pertussis vaccine trial, serum antibody responses were measured by two enzyme-linked immunosorbent assays (ELISA) for pertussis toxin and filamentous haemagglutinin. These were used both for studies of antibody levels after vaccination and for diagnostic purposes. Since the absorbance values obtained were not directly proportional to the amount of antibody in the samples, ELISA optical densities were transformed to units by calibration to a reference serum. Five different calculation modes were compared. In four of these modes unit calculations were based on the relationship between dose response curves of the serum sample and a reference serum. In addition, traditional endpoint titres were included in the comparison. The calculation mode using reference line units showed the highest reproducibility, with intrassay coefficients of variation (CV) within the same test plate of 4-7% and interassay CVs of 12-14%. The CVs among the other methods ranged from 6 to 31% for intra-assay comparisons and from 12 to 47% for interassay comparisons. Furthermore, the CV values for intra-assay variations were used to calculate standardized differences between 79 pairs of acute and convalescent sera from cases confirmed by culture. These differences were then used to estimate the 'diagnostic sensitivity' for the different calculation modes. The results indicated that use of the reference line units was the most sensitive, whereas use of the end point titers was the least sensitive of these calculation modes.

Hyperosmotic glucose infusion during hemorrhage does not reduce bacterial translocation in 24 hour-starved rats.

Food deprivation 24 h before stress increases bacterial translocation in hemorrhage. Presently it tested whether hyperosmolality, induced by exogenous glucose infusion to improve plasma refill, prevents or reduces bacterial translocation after experimental hemorrhage in 24 h food-deprived rats. Rats were given an i.v. infusion of either 2 mL of 30% glucose (G) or the same volume of .9% NaCl (C) while simultaneously being submitted to a standardized 60 min hemorrhage period, of moderate or more severe hemorrhage. Blood was not reinfused. Despite development of marked hyperglycemia (p < .001, G vs. C) resulting in significantly greater reductions in packed cell volume (p < .001, G vs. C), bacterial translocation was detected similarly in both groups regardless of whether moderate (10/12-G, 9/12-C) or severe (15/19-G, 15/18-C) hemorrhage was inflicted. It was concluded that hyperglycemic hyperosmolality did not prevent bacterial translocation in these models of hemorrhagic stress in 24 h-starved rats.

In vitro activity of norfloxacin and other antibacterial agents against gastro-intestinal pathogens isolated in Sweden.

The in vitro activity of norfloxacin was compared to that of ampicillin, doxycycline, chloramphenicol, trimethoprim in combination with sulfamethoxazole (1/20), and erythromycin, against 272 clinical isolates of gastro-intestinal pathogens. Norfloxacin was the most active compound of those tested with MICs in the range 0.004-2 mg/l. Concentrations inhibiting 90% of the strains (MIC 90) were 0.008 mg/l for Vibrio cholerae, 0.016 mg/l for Aeromonas hydrophila, 0.032 mg/l for Vibrio cholerae non 01, 0.064 mg/l for Vibrio parahaemolyticus, Yersinia enterocolitica 03, enterotoxigenic (ETEC) and enteropathogenic (EPEC) Escherichia coli and Shigella species, 0.125 mg/l for Salmonella species, and 0.5 mg/l for Campylobacter species. Resistance to one or several of the other drugs was seen with higher or lower frequency in all the bacterial species tested. No cross-resistance between any of the other agents and norfloxacin was recorded.

Typing of coagulase-negative staphylococci from peritonitis in CAPD-patients by the PhP-CS system and REA.

Coagulase-negative staphylococci (CNS) were the most common bacteria causing peritonitis in patients treated with continuous ambulatory peritoneal dialysis (CAPD). In order to investigate if the same clone was responsible for the peritonitis in the different patients and if the exit site was the source of infection we followed 68 patients on CAPD for 2 years. During this period 9 patients had 12 episodes of peritonitis caused by CNS. Cultures were taken from exit site and peritoneal fluid in all patients at peritonitis and during the first study year at monthly intervals. In each culture up to 10 isolates of CNS were randomly collected and frozen. All 437 CNS isolates from the patients with CNS peritonitis were typed using a biochemical typing method and 41 isolates identical by this method were further discriminated by a DNA fingerprinting method. Identical strains were in no case isolated from different patients, indicating that no virulent strain was spread between the patients. The isolates causing the peritonitis were never found at the exist sites before the first day of the peritonitis in any patient. In only two patients was the same strain found at the exit site and in the peritoneal fluid on the first day of peritonitis. It thus seems that no virulent clone of CNS was infecting the patients and we found no evidence of CNS at the exit site causing the peritonitis.

Diagnostic evaluation of polymerase chain reaction discriminative for Bordetella pertussis, B. parapertussis, and B. bronchiseptica.

A polymerase chain reaction (PCR) procedure for simultaneous detection and identification of Bordetella pertussis, B. parapertussis, and B. bronchiseptica was developed and evaluated against culture in a study comprising nasopharyngeal aspirates and swabs from 166 patients with suspected pertussis, 54 of which were culture positive. A 239-base-pair sequence in the pertussis toxin promoter region was amplified using primers Bouni 1: 5'GCACCATCCCGCATACGTGTTG3', and Bouni 2: 5'GTGCAACGCATCCCGTCTTCC3'. The sequence contains mutations in B. parapertussis and B. bronchiseptica, and species were differentiated by restriction enzyme cleavage of the amplified product. The lowest detectable amount of B. pertussis DNA was 0.1 pg (equals approximately 30 bacteria). No false positives were found in clinical samples or among 18 other species. Treatment of 66 aspirates with a weak cation exchange resin increased the diagnostic sensitivity of PCR. Two culture-positive aspirates were negative by PCR, but grew with a single colony among contaminating flora and could be identified only after PCR analysis of the colony material. The amount of positive cases was increased from 13 by culture to 19 by the addition of PCR. Six samples positive by PCR were culture negative. All six patients showed clinical and epidemiologic evidence of pertussis, and three patients had been treated with antibiotics. PCR increased the sensitivity of pertussis case finding with retained specificity and can be used for laboratory diagnosis of whooping cough.

Variation in the agr-dependent expression of alpha-toxin and protein A among clinical isolates of Staphylococcus aureus from patients with septicaemia.

In Staphylococcus aureus synthesis of many virulence factors is regulated by the agr locus. The regulatory molecule RNAIII, induced by agr, activates transcription of the alpha-toxin gene, hla, while it acts as a repressor of the protein A gene, spa. Forty clinical strains of S. aureus from human blood cultures were analysed for alpha-toxin and protein A production. An inverse correlation between alpha-toxin and protein A production was found in most strains. The levels of alpha-toxin and protein A production varied significantly among strains, which indicates various levels of the regulator, RNAIII. This was confirmed by selecting strains producing different amounts of alpha-toxin, showing that the variations in toxin production are due to the variations of RNAIII transcript. However, in one of the selected strains which produced high levels of alpha-toxin, OR153, although RNAIII is also strongly expressed, the specific hla mRNA was unexpectedly low. One partial explanation for the high alpha-toxin production by this clinical isolate might be its lack of extracellular proteases.

Biochemical phenotypes of enteropathogenic Escherichia coli common to Iran and Sweden.

A collection of 143 strains of enteropathogenic Escherichia coli (EPEC) of 11 different serogroups isolated from children with diarrhoea, 71 in Sweden and 72 in Iran, was tested for similarity with a computerised biochemical fingerprinting method. From Sweden, there were 54 different phenotypes, 42 consisting of a single strain and 12 (common phenotypes) containing more than one isolate. From Iran, there were 48 different phenotypes, 38 with only one strain and 10 with more than one. Many of the strains which were biochemically similar, in both countries, also had similar virulence factors. Nine Swedish and 20 Iranian isolates showed biochemical identity to at least one of the strains of the other country, most of them belonging to serogroups O55, O119, O126, O127 and O128. The value of the biochemical fingerprinting method as an epidemiological tool and its ability to evaluate clonal relations among E. coli strains in different geographical areas is discussed.

Evaluation of the PhP system for biochemical-fingerprint typing of strains of Salmonella of serotype Typhimurium.

The Phene Plate (PhP) system of biochemical fingerprinting of bacteria is a computerised typing system, based on quantitative measurements of the kinetics of several biochemical reactions of bacteria grown in liquid medium in microtitration plates. For each isolate tested, it yields a biochemical fingerprint comprising several kinds of quantitative data which are useful for establishing similarities among strains with a personal-computer program. In this study, a set of 16 specific substrates was chosen to differentiate strains of Salmonella of serotype Typhimurium. The system was evaluated for its typability, reproducibility and discriminatory power in tests with a collection of 100 epidemiologically unrelated Typhimurium strains and results were compared with those obtained by phage typing. At an identity level of 0.980, strains were assigned by this method to 51 biochemical phenotypes (BPTs), giving a diversity index of 0.963 and a resolution index of 0.210. In contrast, 24 phage types (PTs) were identified among these isolates (a diversity index of 0.901). The combined use of biochemical fingerprinting by the PhP system and phage typing discriminated 82 phenotypes (a diversity index of 0.994). Stability of markers in each of the methods was also evaluated after subculture of 20 strains for 21 consecutive days. Only nine biochemical reactions were found that were subject to small, but measurable, changes for at least one isolate. These changes slightly decreased the mean similarity coefficients among strains but the overall BPTs of the strains showed changes in four strains (20%). In contrast, eight strains (40%) showed changes in their PTs after this treatment. It is concluded that the PhP system is a highly discriminatory and reproducible method for typing Typhimurium strains. It is easy to perform, and may be used alone or in combination with phage typing in epidemiological studies of Typhimurium strains.

Serum antibody response to Staphylococcus aureus enterotoxins and TSST-1 in patients with septicaemia.

The prevalence of enterotoxins and toxic shock syndrome toxin (TSST-1) production in strains isolated from patients with Staphylococcus aureus septicaemia, and the serum antibody response in relation to toxin production in vitro of each isolate, were investigated. Among 63 strains of S. aureus isolated from the blood of patients with septicaemia, 51 from patients with superficial wounds and 49 from nasal carriers, 50-60% produced at least one of the enterotoxins A-D or TSST-1. The most frequent toxins produced were enterotoxins A and C and TSST-1. Among the 63 patients with staphylococcal septicaemia, 51 (81%) had a significant rise or a high antibody titre, or both, to at least one of the toxins. A positive serological response to toxin A was found in 78%, to enterotoxin B in 83%, to enterotoxin C in 80%, to enterotoxin D in 86% and to TSST-1 in 92% of the patients from whom the isolated strain produced the respective toxin. Antibodies against enterotoxins A, B, C and D and TSST-1 were also seen in 35%, 16%, 32%, 59% and 10%, respectively, in patients infected by strains that did not produce the specific toxin. Immunological cross-reactions between the toxins were demonstrated both in hyperimmune sera obtained from rabbits and in patients' sera, particularly between enterotoxins B and C. It is concluded that these potent toxins with superantigenic properties are produced in vivo during S. aureus septicaemia. No differences with regard to enterotoxin or TSST-1 production or antibody response were noted between patients with complicated versus uncomplicated septicaemia.

Immunochemical fingerprinting of Clostridium difficile strains isolated from an outbreak of antibiotic-associated colitis and diarrhoea.

Twenty eight strains of Clostridium difficile , isolated from an outbreak of antibiotic-associated colitis and diarrhoea in an orthopaedic ward and from sporadic cases throughout Sweden, were sent to Edinburgh for immunochemical fingerprinting without information about their origin. EDTA extracts of the organisms were examined by crossed immunoelectrophoresis (CIE), polyacrylamide gel electrophoresis (PAGE) and electroblot transfer. Two patterns were revealed by CIE: group A (18 strains) and group B (10 strains). PAGE and electroblot transfer revealed one major group of 10 strains (group 1), six small groups of two or three strains and six strains which were unlike any other strain. The CIE group B and PAGE- electroblot group 1 were identical. Nine of the 10 strains in this group were from patients in the outbreak. These findings indicate that a single strain spread in the orthopaedic ward as a nosocomial infection and that this strain differed from most other strains investigated. The PAGE- electroblot technique should, therefore, greatly aid investigations into the epidemiology of C. difficile infections.