Genome-wide characterization of the wall-associated kinase-like (WAKL) family in sesame (Sesamum indicum) identifies a SiWAKL6 gene involved in resistance to Macrophomina Phaseolina.

BACKGROUND: Sesame charcoal rot caused by Macrophomina phaseolina is one of the most serious fungal diseases in sesame production, and threatens the yield and quality of sesame. WAKL genes are important in the plant response to biotic stresses by sensing and transmitting external signals to the intracellular receptor. However, there is still a lack about the WAKL gene family and its function in sesame resistance to M. phaseolina. The aim of this study was to interpret the roles of WAKL genes in sesame resistance to M. phaseolina. RESULTS: In this study, a comprehensive study of the WAKL gene family was conducted and 31 WAKL genes were identified in the sesame genome. Tandem duplication events were the main factor in expansion of the SiWAKL gene family. Phylogenetic analysis showed that the sesame SiWAKL gene family was divided into 4 groups. SiWAKL genes exhibited different expression patterns in diverse tissues. Under M. phaseolina stress, most SiWAKL genes were significantly induced. Notably, SiWAKL6 was strongly induced in the resistant variety "Zhengzhi 13". Functional analysis showed that SiWAKL6 was induced by salicylic acid but not methyl jasmonate in sesame. Overexpression of SiWAKL6 in transgenic Arabidopsis thaliana plants enhanced their resistance to M. phaseolina by inducing the expression of genes involved in the salicylic acid signaling pathway and reconstructing reactive oxygen species homeostasis. CONCLUSIONS: Taken together, the results provide a better understanding of functions about SiWAKL gene family and suggest that manipulation of these SiWAKL genes can improve plant resistance to M. phaseolina. The findings contributed to further understanding of functions of SiWAKL genes in plant immunity.

A 4.43-Kb deletion of chromosomal segment containing an ovate family protein confers long capsule in sesame (Sesamum indicum L.).

KEY MESSAGE: A 4.43-Kb structural variation in the sesame genome results in the deletion of the Siofp1 gene and induces the long capsule length trait. Capsule length (CL) has a positive effect on seed weight and yield in various agronomically important species; however, the molecular mechanism underlying long capsule trait regulation in sesame remains unknown. The inheritance analysis showed that long capsule traits (CL > 4.0 cm) were dominant over normal length (average CL = 3.0 cm) and were controlled by a single gene pair. Association mapping with a RIL population and 259 natural sesame germplasm accessions indicated that the target interval was 52,830-730,961 bp of SiChr.10 in sesame. Meanwhile, the structural variation (SV) of the association mapping revealed that only SV_414325 on chromosome 10 was significantly associated with the CL trait, with a P value of 1.1135E-19. SV_414325 represents a 4430-bp deletion from 414,325 to 418,756 bp on SiChr.10, covering Sindi_2155000 (named SiOFP1). In the normal length type, Siofp1 encodes 411 amino acids of the ovate family proteins and is highly expressed in the leaf, stem, bud, and capsule tissues of sesame. In accordance with the transcriptional repressor character, Siofp1 overexpression in transgenic Arabidopsis (T0 and T1 generations) induced a 25-39% greater shortening of silique length than the wild type (P < 0.05), as well as round cauline leaves and short carpels. These results confirm that SiOFP1 plays a key role in regulating CL trait in sesame and other flowering plants. These findings provide a theoretical and material basis for sesame capsule development and high-yield breeding research.

Identification of a Sidwf1 gene controlling short internode length trait in the sesame dwarf mutant dw607.

KEY MESSAGE: SiDWF1 encodes a gibberellin receptor GID1B-like protein controlling the internode length and plant height in sesame. Sesame is a high-height crop. Here we systematically analyzed the morphological and genetic characters of the sesame dwarf mutant dw607 (dwf1 type). The plant height and the internode length of dw607 significantly declined, while the thousand seed weight (TSW) significantly increased (P < 0.01). The cell size of stem parenchyma and pith tissue reduced, and vascular bundle cells and parenchyma tissue arranged much tighter in the dwarf mutant. Based on the cross-population association mapping of a RIL population of the cross 'dw607 (dwf1) × 15N41 (wt type),' the target interval linked to the short internode length was located on C9.scaffold2 of SiChr.4 in sesame. We further screened the 58 variants using the genomic variant data of 824 germplasm and BSA DNA pools and determined the target gene Sidwf1. The SNP mutation of C1057 to T1057 resulted in the amino acid change of P150 (proline) to S150 (serine) in SiDWF1. SiDWF1 gene allele is 1,638 bp and encodes a gibberellin receptor GID1B-like protein. Transcription profile assay reflected that Sidwf1 is highly expressed in leaf, stem, bud, and capsule tissues. The dynamic variation in endogenous GA3 content in dw607 and the wild type was also monitored in this study. The results revealed the molecular genetic mechanism of the internode length and plant height trait in sesame for the first time. The findings supply the theoretical and material basis for developing the marker-assisted selection (MAS) breeding in sesame.

Identification of Pathogenicity Groups and Pathogenic Molecular Characterization of Fusarium oxysporum f. sp. sesami in China.

Fusarium oxysporum f. sp. sesami is an extremely destructive pathogen, causing sesame Fusarium wilt disease worldwide. To clarify the pathogenicity and the genetic characters of F. oxysporum f. sp. sesami, we systematically investigated 69 F. oxysporum isolates collected from major sesame-growing areas in China. Among these isolates, 54 isolates were pathogenic and 15 were nonpathogenic according to pathogenicity testing on sesame seedlings. For the pathogenic isolates, three F. oxysporum f. sp. sesami pathogenicity groups were defined based on the three differential sesame hosts for the first time. A translation elongation factor 1α gene tree was constructed to determine the genetic diversity of the F. oxysporum isolates but could not separate F. oxysporum f. sp. sesami isolates from the nonpathogenic isolates and other F. oxysporum formae speciales. Ten secreted-in-xylem (SIX) genes (one family of effectors) were identified in F. oxysporum f. sp. sesami isolates by a search with the genome data, and were subsequently screened in the 69 F. oxysporum isolates. Compared with the SIX gene profiles in other F. oxysporum formae speciales, the presence and sequence variations of the SIX gene homologs directly correlated with the specific pathogenicity of F. oxysporum f. sp. sesami toward sesame. Furthermore, eight of these F. oxysporum f. sp. sesami SIX genes were significantly expressed in sesame plants as infection of the F. oxysporum f. sp. sesami isolate. These findings have important significance for understanding the pathogenic basis of F. oxysporum f. sp. sesami isolates, and will contribute to improve the diagnostics to effectively control Fusarium wilt disease in sesame.

A SNP Mutation of SiCRC Regulates Seed Number Per Capsule and Capsule Length of cs1 Mutant in Sesame.

Seed number per capsule (SNC) is a major factor influencing seed yield and is an important trait with complex gene interaction effects. We first performed genetic analysis, gene cloning, and molecular mechanism study for an EMS-induced sesame mutant cs1 with fewer SNC and shorter capsule length (CL). The mutant traits were due to the pleiotropism of a regressive gene (Sics1). Capsule hormone determination showed that five out of 12 hormones, including auxin indole-3-acetic acid (IAA), had significantly different levels between wild type (WT) and mutant type (MT). KEGG pathway analysis showed that plant hormone signal transduction, especially the auxin signal transduction pathway, was the most abundant differentially expressed signaling pathway. After the cross-population association and regional genome screening, we found that three homozygous loci were retained in cs1. Further analysis of these three loci resulted in the identification of SiCRC as the candidate gene for cs1. SiCRC consists of seven exons and six introns encoding 163 amino acids. The SiCRC in cs1 showed a point mutation at intron 5 and exon 6 junction, resulting in the splice site being frame-shifted eight nucleotides further downstream, causing incorrect splicing. Taken together, we assumed the SNP mutation in SiCRC disrupted the function of the transcription factor, which might act downstream of the CRC-auxin signal transduction pathway, resulting in a shorter CL and less SNC mutation of cs1 in sesame. Our results highlight the molecular framework underlying the transcription factor CRC-mediated role of auxin transduction in SNC and CL development.

Identification of a SiCL1 gene controlling leaf curling and capsule indehiscence in sesame via cross-population association mapping and genomic variants screening.

BACKGROUND: Leaf shape can affect plantlet development and seed yield in sesame. The morphological, histological and genetic analyses of a sesame mutant cl1 (cl) with curly leaf and indehiscent capsule traits were performed in this study. In order to clone the cl1 gene for breeding selection, genome re-sequencing of the 130 individuals of cl1 × USA (0)-26 F2 population and a bulked segregation analysis (BSA) pool was carried out. The genome re-sequencing data of the 822 germplasm with normal leaf shape were applied. RESULTS: For cl1 mutant, the adaxial/abaxial character of the parenchyma cells in the leaf blades is reduced. Results proved that the leaf curling trait is controlled by a recessive gene (Sicl1). Cross- population association of the F2 population of cl1 × USA (0)-26 indicated that the target cl locus was located on the interval C29 between C29_6522236 and C29_6918901 of SiChr. 1. Further regional genome variants screening determined the 6 candidate variants using genomic variants data of 822 natural germplasm and a BSA pool data. Of which, 5 markers C29_6717525, C29_6721553, C29_6721558, C29_6721563, and C29_6721565 existed in the same gene (C29.460). With the aid of the validation in the test F2 population of cl1 × Yuzhi 11 and natural germplasm, the integrated marker SiCLInDel1 (C29: 6721553-6721572) was determined as the target marker, and C29.460 was the target gene SiCL1 in sesame. SiCL1 is a KAN1 homolog with the full length of 6835 bp. In cl1, the 20 nucleic acids (CAGGTAGCTATGTATATGCA) of SiCLInDel1 marker were mutagenized into 6 nucleic acids (TCTTTG). The deletion led to a frameshift mutation and resulted in the earlier translation termination of the CL gene. The Sicl1 allele was shortened to 1829 bp. SiCL1 gene was expressed mainly in the tissues of stem, leaf, bud, capsule and seed. CONCLUSIONS: SiCL1 encodes a transcription repressor KAN1 protein and controls leaf curling and capsule indehiscence in sesame. The findings provided an example of high-efficient gene cloning in sesame. The SiCL1 gene and the cl1 mutant supply the opportunity to explore the development regulation of leaf and capsule, and would improve the new variety breeding with high harvest mechanization adaption in sesame.

High-density genetic map construction and QTL mapping to identify genes for blight defense- and yield-related traits in sesame (Sesamum indicum L.).

Sesame (Sesamum indicum L.) is an important oilseed crop widely cultivated in subtropical and tropical areas. Low genetic yield potential and susceptibility to disease contribute to low productivity in sesame. However, the genetic basis of sesame yield- and disease-related traits remains unclear. Here, we represent the construction of a high-density bin map of sesame using whole genome sequencing of an F2 population derived from 'Yizhi' and 'Mingdeng Zhima'. A total of 2766 Bins were categorized into 13 linkage groups. Thirteen significant QTLs were identified, including ten QTLs related to yield, two QTLs related to Sesame Fusarium wilt (SFW) disease, and one QTL related to seed color. Among these QTLs, we found that SFW-QTL1.1 and SFW-QTL1.2 were major QTLs related to Fusarium wilt disease, explaining more than 20% of the phenotypic variation with LOD > 6. SCC-QTL1.1 was related to seed coat color, explaining 52% of the phenotypic variation with LOD equal to 25.3. This suggests that seed color traits were controlled by a major QTL. Candidate genes related to Fusarium wilt disease and seed color in the QTLs were annotated. We discovered a significant enrichment of genes associated with resistance to late blight. These genes could be spectral disease resistance genes and may have a role in the regulation of Fusarium wilt disease resistance. Our study will benefit the implementation of marker-assisted selection (MAS) for the genetic improvement of disease resistance and yield-related traits in sesame.

Sesame lignans modulate aroma formation in sesame oil through the Maillard reaction and lipid oxidation in model systems.

The unknown effect of sesame lignans on aroma formation in sesame oil via the Maillard reaction (MR) and lipid oxidation was investigated. Sesamin, sesamolin, or sesamol was added to 3 models: lysine+glucose (MR), cold-pressed sesame oil (SO), and MR + SO, and were heated at 120 °C for 60 min. All three lignans suppressed SO oxidation while increasing DPPH scavenging ability (p < 0.05). Lignans increased depletions of lysine and glucose and MR browning (p < 0.05). Lignans reduced most aroma-active pyrazines, aldehydes, ketones, alcohols, and esters (p < 0.05). Sesamol and sesamolin increased perceptions of the preferable aromas of nutty, roasted sesame, and popcorn while reducing the undesirable green and rancid aromas (p < 0.05). Sesamol demonstrated a stronger effect on lipid oxidation, MR browning, aroma formation, and sensory perception than sesamin and sesamolin. This study suggests that sesame lignans can modulate aroma formation and sensory perception of sesame oil by interacting with the MR and lipid oxidation pathways.

Comprehensive analysis of sesame LRR-RLKs: structure, evolution and dynamic expression profiles under Macrophomina phaseolina stress.

Leucine-rich repeat receptor-like kinases (LRR-RLKs) can participate in the regulation of plant growth and development, immunity and signal transduction. Sesamum indicum, one of the most important oil crops, has a significant role in promoting human health. In this study, 175 SiLRR-RLK genes were identified in S. indicum, and they were subdivided into 12 subfamilies by phylogenetic analysis. Gene duplication analysis showed that the expansion of the SiLRR-RLK family members in the sesame was mainly due to segmental duplication. Moreover, the gene expansion of subfamilies IV and III contributed to the perception of stimuli under M. phaseolina stress in the sesame. The collinearity analysis with other plant species revealed that the duplication of SiLRR-RLK genes occurred after the differentiation of dicotyledons and monocotyledons. The expression profile analysis and functional annotation of SiLRR-RLK genes indicated that they play a vital role in biotic stress. Furthermore, the protein-protein interaction and coexpression networks suggested that SiLRR-RLKs contributed to sesame resistance to Macrophomina phaseolina by acting alone or as a polymer with other SiLRR-RLKs. In conclusion, the comprehensive analysis of the SiLRR-RLK gene family provided a framework for further functional studies on SiLRR-RLK genes.

Genomic evolution and insights into agronomic trait innovations of Sesamum species.

Sesame is an ancient oilseed crop with high oil content and quality. However, the evolutionary history and genetic mechanisms of its valuable agronomic traits remain unclear. Here, we report chromosome-scale genomes of cultivated sesame (Sesamum indicum L.) and six wild Sesamum species, representing all three karyotypes within this genus. Karyotyping and genome-based phylogenic analysis revealed the evolutionary route of Sesamum species from n = 13 to n = 16 and revealed that allotetraploidization occurred in the wild species Sesamum radiatum. Early divergence of the Sesamum genus (48.5-19.7 million years ago) during the Tertiary period and its ancient phylogenic position within eudicots were observed. Pan-genome analysis revealed 9164 core gene families in the 7 Sesamum species. These families are significantly enriched in various metabolic pathways, including fatty acid (FA) metabolism and FA biosynthesis. Structural variations in SiPT1 and SiDT1 within the phosphatidyl ethanolamine-binding protein gene family lead to the genomic evolution of plant-architecture and inflorescence-development phenotypes in Sesamum. A genome-wide association study (GWAS) of an interspecific population and genome comparisons revealed a long terminal repeat insertion and a sequence deletion in DIR genes of wild Sesamum angustifolium and cultivated sesame, respectively; both variations independently cause high susceptibility to Fusarium wilt disease. A GWAS of 560 sesame accessions combined with an overexpression study confirmed that the NAC1 and PPO genes play an important role in upregulating oil content of sesame. Our study provides high-quality genomic resources for cultivated and wild Sesamum species and insights that can improve molecular breeding strategies for sesame and other oilseed crops.

Identification and testing of reference genes for Sesame gene expression analysis by quantitative real-time PCR.

Sesame (Sesamum indicum L.) is an ancient and important oilseed crop. However, few sesame reference genes have been selected for quantitative real-time PCR until now. Screening and validating reference genes is a requisite for gene expression normalization in sesame functional genomics research. In this study, ten candidate reference genes, i.e., SiACT, SiUBQ6, SiTUB, Si18S rRNA, SiEF1α, SiCYP, SiHistone, SiDNAJ, SiAPT and SiGAPDH, were chosen and examined systematically in 32 sesame samples. Three qRT-PCR analysis methods, i.e., geNorm, NormFinder and BestKeeper, were evaluated systematically. Results indicated that all ten candidate reference genes could be used as reference genes in sesame. SiUBQ6 and SiAPT were the optimal reference genes for sesame plant development; SiTUB was suitable for sesame vegetative tissue development, SiDNAJ for pathogen treatment, SiHistone for abiotic stress, SiUBQ6 for bud development and SiACT for seed germination. As for hormone treatment and seed development, SiHistone, SiCYP, SiDNAJ or SiUBQ6, as well as SiACT, SiDNAJ, SiTUB or SiAPT, could be used as reference gene, respectively. To illustrate the suitability of these reference genes, we analyzed the expression variation of three functional sesame genes of SiSS, SiLEA and SiGH in different organs using the optimal qRT-PCR system for the first time. The stability levels of optimal and worst reference genes screened for seed development, anther sterility and plant development were validated in the qRT-PCR normalization. Our results provided a reference gene application guideline for sesame gene expression characterization using qRT-PCR system.

Genome-wide analysis of the U-box E3 ubiquitin ligase family role in drought tolerance in sesame (Sesamum indicum L.).

Plant U-box (PUB) proteins belong to a class of ubiquitin ligases essential in various biological processes. Sesame (Sesamum indicum L.) is an important and worldwide cultivated oilseed crop. However few studies have been conducted to explore the role of PUBs in drought tolerance in sesame. This study identified a total of 56 members of the sesame PUB family (SiPUB) genes distributed unevenly across all 13 chromosomes. Based on phylogenetic analysis, all 56 SiPUB genes were classified into six groups with various structures and motifs. Cis-acting element analysis suggested that the SiPUB genes are involved in response to various stresses including drought. Based on RNA-seq analysis and quantitative real-time PCR, we identified nine SiPUB genes with significantly different expression profiles under drought stress. The expression patterns of six SiPUB genes in root, leaf and stem tissues corroborated the reliability of the RNA-seq datasets. These findings underscore the importance of SiPUB genes in enhancing drought tolerance in sesame plants. Our study provides novel insights into the evolutionary patterns and variations of PUB genes in sesame and lays the foundation for comprehending the functional characteristics of SiPUB genes under drought-induced stress conditions.

Development and validation of genic-SSR markers in sesame by RNA-seq.

BACKGROUND: Sesame (Sesamum indicum L.) is one of the most important oil crops; however, a lack of useful molecular markers hinders current genetic research. We performed transcriptome sequencing of samples from different sesame growth and developmental stages, and mining of genic-SSR markers to identify valuable markers for sesame molecular genetics research. RESULTS: In this study, 75 bp and 100 bp paired-end RNA-seq was used to sequence 24 cDNA libraries, and 42,566 uni-transcripts were assembled from more than 260 million filtered reads. The total length of uni-transcript sequences was 47.99 Mb, and 7,324 SSRs (SSRs ≥15 bp) and 4,440 SSRs (SSRs ≥18 bp) were identified. On average, there was one genic-SSR per 6.55 kb (SSRs ≥15 bp) or 10.81 kb (SSRs ≥18 bp). Among perfect SSRs (≥18 bp), di-nucleotide motifs (48.01%) were the most abundant, followed by tri- (20.96%), hexa- (25.37%), penta- (2.97%), tetra- (2.12%), and mono-nucleotides (0.57%). The top four motif repeats were (AG/CT)n [1,268 (34.51%)], (CA/TG)n [281 (7.65%)], (AT/AT)n [215 (5.85%)], and (GAA/TTC)n [131 (3.57%)]. A total of 2,164 SSR primer pairs were identified in the 4,440 SSR-containing sequences (≥18 bp), and 300 SSR primer pairs were randomly chosen for validation. These SSR markers were amplified and validated in 25 sesame accessions (24 cultivated accessions, one wild species). 276 (92.0%) primer pairs yielded PCR amplification products in 24 cultivars. Thirty two primer pairs (11.59%) exhibited polymorphisms. Moreover, 203 primer pairs (67.67%) yielded PCR amplicons in the wild accession and 167 (60.51%) were polymorphic between species. A UPGMA dendrogram based on genetic similarity coefficients showed that the correlation between genotype and geographical source was low and that the genetic basis of sesame in China is narrow, as previously reported. The 32 polymorphic primer pairs were validated using an F2 mapping population; 18 primer pairs exhibited polymorphisms between the parents, and 14 genic-SSRs could be integrated into 9 main linkage groups. CONCLUSIONS: 2,164 genic-SSR markers have been developed in sesame using transcriptome sequencing. 276 of 300 validated primer pairs successfully yielded PCR amplicons in 24 cultivated sesame accessions. These markers increase current SSR marker resources and will greatly benefit genetic diversity, qualitative and quantitative trait mapping and marker-assisted selection studies in sesame.

Identification of Candidate Genes Regulating the Seed Coat Color Trait in Sesame (Sesamum indicum L.) Using an Integrated Approach of QTL Mapping and Transcriptome Analysis.

Seed coat color is an important seed quality trait in sesame. However, the genetic mechanism of seed coat color variation remains elusive in sesame. We conducted a QTL mapping of the seed coat color trait in sesame using an F2 mapping population. With the aid of the newly constructed superdense genetic linkage map comprised of 22,375 bins distributed in 13 linkage groups (LGs), 17 QTLs of the three indices (i.e., L, a, and b values) of seed coat color were detected in seven intervals on four LGs, with a phenotype variance explanation rate of 4.46-41.53%. A new QTL qSCa6.1 on LG 6 and a QTL hotspot containing at least four QTLs on LG 9 were further identified. Variants screening of the target intervals showed that there were 84 genes which possessed the variants that were high-impact and co-segregating with the seed coat color trait. Meanwhile, we performed the transcriptome comparison of the developing seeds of a white- and a black-seeded variety, and found that the differentially expressed genes were significantly enriched in 37 pathways, including three pigment biosynthesis related pathways. Integration of variants screening and transcriptome comparison results suggested that 28 candidate genes probably participated in the regulation of the seed coat color in sesame; of which, 10 genes had been proved or suggested to be involved in pigments biosynthesis or accumulation during seed formation. The findings gave the basis for the mechanism of seed coat color regulation in sesame, and exhibited the effects of the integrated approach of genome resequencing and transcriptome analysis on the genetics analysis of the complex traits.

Ultra-dense SNP genetic map construction and identification of SiDt gene controlling the determinate growth habit in Sesamum indicum L.

Sesame (Sesamum indicum L.) is an important oilseed crop and has an indeterminate growth habit. Here we resequenced the genomes of the parents and 120 progeny of an F2 population derived from crossing Yuzhi 11 (indeterminate, Dt) and Yuzhi DS899 (determinate, dt1), and constructed an ultra-dense SNP map for sesame comprised of 3,041 bins including 30,193 SNPs in 13 linkage groups (LGs) with an average marker density of 0.10 cM. Results indicated that the same recessive gene controls the determinacy trait in dt1 and a second determinate line, dt2 (08TP092). The QDt1 locus for the determinacy trait was located in the 18.0 cM-19.2 cM interval of LG8. The target SNP, SiDt27-1, and the determinacy gene, DS899s00170.023 (named here as SiDt), were identified in Scaffold 00170 of the Yuzhi 11 reference genome, based on genetic mapping and genomic association analysis. Unlike the G397A SNP change in the dt1 genotype, the SiDt allele in dt2 line was lost from the genome. This example of map-based gene cloning in sesame provides proof-of-concept of the utility of ultra-dense SNP maps for accurate genome research in sesame.

Association mapping of seed oil and protein content in Sesamum indicum L. using SSR markers.

Sesame is an important oil crop for the high oil content and quality. The seed oil and protein contents are two important traits in sesame. To identify the molecular markers associated with the seed oil and protein contents in sesame, we systematically performed the association mapping among 369 worldwide germplasm accessions under 5 environments using 112 polymorphic SSR markers. The general linear model (GLM) was applied with the criteria of logP ≥ 3.0 and high stability under all 5 environments. Among the 369 sesame accessions, the oil content ranged from 27.89%-58.73% and the protein content ranged from 16.72%-27.79%. A significant negative correlation of the oil content with the protein content was found in the population. A total of 19 markers for oil content were detected with a R2 value range from 4% to 29%; 24 markers for protein content were detected with a R2 value range from 3% to 29%, of which 19 markers were associated with both traits. Moreover, partial markers were confirmed using mixed linear model (MLM) method, which suggested that the oil and protein contents are controlled mostly by major genes. Allele effect analysis showed that the allele associated with high oil content was always associated with low protein content, and vice versa. Of the 19 markers associated with oil content, 17 presented near the locations of the plant lipid pathway genes and 2 were located just next to a fatty acid elongation gene and a gene encoding Stearoyl-ACP Desaturase, respectively. The findings provided a valuable foundation for oil synthesis gene identification and molecular marker assistant selection (MAS) breeding in sesame.

Insights from the complete chloroplast genome into the evolution of Sesamum indicum L.

Sesame (Sesamum indicum L.) is one of the oldest oilseed crops. In order to investigate the evolutionary characters according to the Sesame Genome Project, apart from sequencing its nuclear genome, we sequenced the complete chloroplast genome of S. indicum cv. Yuzhi 11 (white seeded) using Illumina and 454 sequencing. Comparisons of chloroplast genomes between S. indicum and the 18 other higher plants were then analyzed. The chloroplast genome of cv. Yuzhi 11 contains 153,338 bp and a total of 114 unique genes (KC569603). The number of chloroplast genes in sesame is the same as that in Nicotiana tabacum, Vitis vinifera and Platanus occidentalis. The variation in the length of the large single-copy (LSC) regions and inverted repeats (IR) in sesame compared to 18 other higher plant species was the main contributor to size variation in the cp genome in these species. The 77 functional chloroplast genes, except for ycf1 and ycf2, were highly conserved. The deletion of the cp ycf1 gene sequence in cp genomes may be due either to its transfer to the nuclear genome, as has occurred in sesame, or direct deletion, as has occurred in Panax ginseng and Cucumis sativus. The sesame ycf2 gene is only 5,721 bp in length and has lost about 1,179 bp. Nucleotides 1-585 of ycf2 when queried in BLAST had hits in the sesame draft genome. Five repeats (R10, R12, R13, R14 and R17) were unique to the sesame chloroplast genome. We also found that IR contraction/expansion in the cp genome alters its rate of evolution. Chloroplast genes and repeats display the signature of convergent evolution in sesame and other species. These findings provide a foundation for further investigation of cp genome evolution in Sesamum and other higher plants.

Genetic analysis and QTL mapping of seed coat color in sesame (Sesamum indicum L.).

Seed coat color is an important agronomic trait in sesame, as it is associated with seed biochemical properties, antioxidant content and activity and even disease resistance of sesame. Here, using a high-density linkage map, we analyzed genetic segregation and quantitative trait loci (QTL) for sesame seed coat color in six generations (P1, P2, F1, BC1, BC2 and F2). Results showed that two major genes with additive-dominant-epistatic effects and polygenes with additive-dominant-epistatic effects were responsible for controlling the seed coat color trait. Average heritability of the major genes in the BC1, BC2 and F2 populations was 89.30%, 24.00%, and 91.11% respectively, while the heritability of polygenes was low in the BC1 (5.43%), in BC2 (0.00%) and in F2 (0.89%) populations. A high-density map was constructed using 724 polymorphic markers. 653 SSR, AFLP and RSAMPL loci were anchored in 14 linkage groups (LG) spanning a total of 1,216.00 cM. The average length of each LG was 86.86 cM and the marker density was 1.86 cM per marker interval. Four QTLs for seed coat color, QTL1-1, QTL11-1, QTL11-2 and QTL13-1, whose heritability ranged from 59.33%-69.89%, were detected in F3 populations using CIM and MCIM methods. Alleles at all QTLs from the black-seeded parent tended to increase the seed coat color. Results from QTLs mapping and classical genetic analysis among the P1, P2, F1, BC1, BC2 and F2 populations were comparatively consistent. This first QTL analysis and high-density genetic linkage map for sesame provided a good foundation for further research on sesame genetics and molecular marker-assisted selection (MAS).

Genome sequencing of the important oilseed crop Sesamum indicum L.

The Sesame Genome Working Group (SGWG) has been formed to sequence and assemble the sesame (Sesamum indicum L.) genome. The status of this project and our planned analyses are described.