Associations of combined phenotypic ageing and genetic risk with incidence of chronic respiratory diseases in the UK Biobank: a prospective cohort study.

BACKGROUND: Accelerated biological ageing has been associated with an increased risk of several chronic respiratory diseases. However, the associations between phenotypic age, a new biological age indicator based on clinical chemistry biomarkers, and common chronic respiratory diseases have not been evaluated. METHODS: We analysed data from 308 592 participants at baseline in the UK Biobank. The phenotypic age was calculated from chronological age and nine clinical chemistry biomarkers, including albumin, alkaline phosphatase, creatinine, glucose, C-reactive protein, lymphocyte percent, mean cell volume, red cell distribution width and white blood cell count. Furthermore, phenotypic age acceleration (PhenoAgeAccel) was calculated by regressing phenotypic age on chronological age. The associations of PhenoAgeAccel with incident common chronic respiratory diseases and cross-sectional lung function were investigated. Moreover, we constructed polygenic risk scores and evaluated whether PhenoAgeAccel modified the effect of genetic susceptibility on chronic respiratory diseases and lung function. RESULTS: The results showed significant associations of PhenoAgeAccel with increased risk of idiopathic pulmonary fibrosis (IPF) (hazard ratio (HR) 1.52, 95% CI 1.45-1.59), COPD (HR 1.54, 95% CI 1.51-1.57) and asthma (HR 1.18, 95% CI 1.15-1.20) per 5-year increase and decreased lung function. There was an additive interaction between PhenoAgeAccel and the genetic risk for IPF and COPD. Participants with high genetic risk and who were biologically older had the highest risk of incident IPF (HR 5.24, 95% CI 3.91-7.02), COPD (HR 2.99, 95% CI 2.66-3.36) and asthma (HR 2.07, 95% CI 1.86-2.31). Mediation analysis indicated that PhenoAgeAccel could mediate 10∼20% of the associations between smoking and chronic respiratory diseases, while ∼10% of the associations between particulate matter with aerodynamic diameter <2.5 µm and the disorders were mediated by PhenoAgeAccel. CONCLUSION: PhenoAgeAccel was significantly associated with incident risk of common chronic respiratory diseases and decreased lung function and could serve as a novel clinical biomarker.

CircZNF609 regulates pulmonary fibrosis via miR-145-5p/KLF4 axis and its translation function.

BACKGROUND: Pulmonary fibrosis is a growing clinical problem that develops as a result of abnormal wound healing, leading to breathlessness, pulmonary dysfunction and ultimately death. However, therapeutic options for pulmonary fibrosis are limited because the underlying pathogenesis remains incompletely understood. Circular RNAs, as key regulators in various diseases, remain poorly understood in pulmonary fibrosis induced by silica. METHODS: We performed studies with fibroblast cell lines and silica-induced mouse pulmonary fibrosis models. The expression of circZNF609, miR-145-5p, and KLF4 was determined by quantitative real-time polymerase chain reaction (qRT-PCR) analysis. RNA immunoprecipitation (RIP) assays and m6A RNA immunoprecipitation assays (MeRIP), Western blotting, immunofluorescence assays, and CCK8 were performed to investigate the role of the circZNF609/miR-145-5p/KLF4 axis and circZNF609-encoded peptides in fibroblast activation. RESULTS: Our data showed that circZNF609 was downregulated in activated fibroblasts and silica-induced fibrotic mouse lung tissues. Overexpression of circZNF609 could inhibit fibroblast activation induced by transforming growth factor-ß1 (TGF-ß1). Mechanically, we revealed that circZNF609 regulates pulmonary fibrosis via miR-145-5p/KLF4 axis and circZNF609-encoded peptides. Furthermore, circZNF609 was highly methylated and its expression was controlled by N6-methyladenosine (m6A) modification. Lastly, in vivo studies revealed that overexpression of circZNF609 attenuates silica-induced lung fibrosis in mice. CONCLUSIONS: Our data indicate that circZNF609 is a critical regulator of fibroblast activation and silica-induced lung fibrosis. The circZNF609 and its derived peptides may represent novel promising targets for the treatment of pulmonary fibrosis.

Targeted delivery of ZNF416 siRNA-loaded liposomes attenuates experimental pulmonary fibrosis.

BACKGROUND: Pulmonary fibrosis is a chronic progressive fibrotic interstitial lung disease characterized by excessive extracellular matrix (ECM) deposition caused by activated fibroblasts. Increasing evidence shows that matrix stiffness is essential in promoting fibroblast activation and profibrotic changes. Here, we investigated the expression and function of matrix stiffness-regulated ZNF416 in pulmonary fibrotic lung fibroblasts. METHODS: 1 kappa (soft), 60 kappa (stiff) gel-coated coverslips, or transforming growth factor-beta 1 (TGF-ß1)-cultured lung fibroblasts and the gain- or loss- of the ZNF416 function assays were performed in vitro. We also established two experimental pulmonary fibrosis mouse models by a single intratracheal instillation with 50 mg/kg silica or 6 mg/kg bleomycin (BLM). ZNF416 siRNA-loaded liposomes and TGF-ß1 receptor inhibitor SB431542 were administrated in vivo. RESULTS: Our study identified that ZNF416 could regulate fibroblast differentiation, proliferation, and contraction by promoting the nuclear accumulation of p-Smad2/3. Besides, ZNF416 siRNA-loaded liposome delivery by tail-vein could passively target the fibrotic area in the lung, and co-administration of ZNF416 siRNA-loaded liposomes and SB431542 significantly protects mice against silica or BLM-induced lung injury and fibrosis. CONCLUSION: In this study, our results indicate that mechanosensitive ZNF416 is a potential molecular target for the treatment of pulmonary fibrosis. Strategies aimed at silencing ZNF416 could be a promising approach to fight against pulmonary fibrosis.

ALKBH5 promotes lung fibroblast activation and silica-induced pulmonary fibrosis through miR-320a-3p and FOXM1.

BACKGROUND: N6-methyladenosine (m6A) is the most common and abundant internal modification of RNA. Its critical functions in multiple physiological and pathological processes have been reported. However, the role of m6A in silica-induced pulmonary fibrosis has not been fully elucidated. AlkB homolog 5 (ALKBH5), a well-known m6A demethylase, is upregulated in the silica-induced mouse pulmonary fibrosis model. Here, we sought to investigate the function of ALKBH5 in pulmonary fibrosis triggered by silica inhalation. METHODS: We performed studies with fibroblast cell lines and silica-induced mouse pulmonary fibrosis models. The expression of ALKBH5, miR-320a-3p, and forkhead box protein M1 (FOXM1) was determined by quantitative real-time polymerase chain reaction (qRT-PCR) analysis. RNA immunoprecipitation (RIP) assays and m6A RNA immunoprecipitation assays (MeRIP), western bolt, immunofluorescence assays, and 5-ethynyl-2'-deoxyuridine (EdU) fluorescence staining were performed to explore the roles of ALKBH5, miR-320a-3p, and FOXM1 in fibroblast activation. RESULTS: ALKBH5 expression was increased in silica-inhaled mouse lung tissues and transforming growth factor (TGF)-ß1-stimulated fibroblasts. Moreover, ALKBH5 knockdown exerted antifibrotic effects in vitro. Simultaneously, downregulation of ALKBH5 elevated miR-320a-3p but decreased pri-miR-320a-3p. Mechanically, ALKBH5 demethylated pri-miR-320a-3p, thus blocking the microprocessor protein DGCR8 from interacting with pri-miR-320a-3p and leading to mature process blockage of pri-miR-320a-3p. We further demonstrated that miR-320a-3p could regulate fibrosis by targeting FOXM1 messenger RNA (mRNA) 3'-untranslated region (UTR). Notably, our study also verified that ALKBH5 could also directly regulate FOXM1 in an m6A-dependent manner. CONCLUSIONS: Our findings suggest that ALKBH5 promotes silica-induced lung fibrosis via the miR-320a-3p/FOXM1 axis or targeting FOXM1 directly. Approaches aimed at ALKBH5 may be efficacious in treating lung fibrosis.

PTX3 alleviates hard metal-induced acute lung injury through potentiating efferocytosis.

Prolonged exposure to hard metal dust results in hard metal lung disease (HMLD) characterized by respiratory symptoms. Understanding the pathogenesis and pathological process of HMLD would be helpful for its early diagnosis and treatment. In this study, we established a mouse model of hard metal-induced acute lung injury through one-time intratracheal instillation of WC-Co dust suspension. We found that WC-Co treatment damaged the lungs of mice, leading to increased production of IL-1ß, TNF-α, IL-6 and IL-18, inflammatory cells infiltration and apoptosis. In vitro, WC-Co induced cytotoxicity, inflammatory response and apoptosis in macrophages (PMA-treated THP-1) and epithelial cells (A549) in a dose-dependent manner. Moreover, RNA-sequence and validation experiments verified that Pentraxin 3 (PTX3), an important mediator in the regulation of inflammation, was elevated both in vivo and in vitro induced by WC-Co. Functional experiments confirmed the PTX3, which was located on the membrane of apoptotic cells, promoted macrophage efferocytosis efficiently. This progress could help block the lung inflammation and contribute to the rapid recovery of WC-Co-induced acute lung injury. These observations provide a further understanding of the molecular mechanism of WC-Co-induced pulmonary injury and disclose PTX3 as a new potential therapeutic approach to relieve WC-Co-induced acute lung injury via efferocytosis.

First Report of Chestnut Blight Caused by Cryphonectria parasitica on Chestnut (Castanea seguinii) in Gansu Province, China.

In China, chestnut blight usually causes insignificant damage to fruit production of Chinese chestnut (Castanea mollissima Blume) and no serious disease epidemics occur, due to the high resistance to Cryphonectria parasitica (Huang et al. 1998). According to recent surveys, chestnut blight was mainly found in sixteen provinces including Shandong, Hebei, Anhui, Hunan, Jiangxi, Beijing, and Fujian, with severe cases occurring occasionally (Guo et al. 2005). The disease incidence has been aggravated with increasing monoculture of newly improved chestnut cultivars in chestnut-producing areas (Yan et al. 2007), though it was not detected in Gansu Province. In September 2021, some chestnut trees (Castanea seguinii) showing symptoms of crown dieback and diffuse sunken cankers on the trunk with swelled margins and subsequent cracking of the outer bark, were collected in mountains of Hui County in Longnan City, Gansu Province (E 104° 15' 5.76″ ，N 35° 11' 30.84″). Symptomatic branches were washed using tap water and dried on sterilized tissue paper. The Junction between diseased and healthy tissue was cut from the bark and sterilized with NaClO (2.5 %) for 2 minutes, then plated on potato dextrose agar (PDA) and incubated at 25 ℃ for 3 to 4 days. After fungal colonies formed, mycelia were transferred and subcultured onto new PDA media and then purified using single spore culture. After 7 days, colonies turned yellow white. Uninucleate conidia were formed in orange pycnidia and the orange pigments could turn purple if in 2% KOH. Conidia were straight or slightly curved, hyaline, with 2.5-3.5 × 1.2-1.5 µm in size. The characteristics of the culture and morphology were similar with those of C. parasitica (Tziros et al. 2016). Perithecia were not found on culture medium. In accordance with previous findings, the sexual stage of C. parasitica appears on diseased trees in late October. For molecular identification, genomic DNA was extracted from mycelium using a Fungal Genomic DNA Extraction Kit (Tsingke Biotech Co. Ltd, Xi'an, China), the ITS region was amplified with primers ITS1/ITS4 (Sorrentino et al. 2019), and the TEF1-α region was amplified with primers TEF-1H/TEF-2T (O'Donnel et al. 1998). Cloning and sequencing of PCR products were carried out by Tsingke Biotech Co. Ltd, Xi'an, China. The resulting sequences were deposited in GenBank (ITS sequence accession number: OM033734, TEF sequence accession number: OM12254). BLAST results revealed that the sequences of ITS and TEF shared identity over 99% with those of C. parasitica strains (GenBank accession number: AY308953, KP524763, KP824756 and KF220299). Based on morphological and molecular characteristic, the fungal isolates were identified as C. parasitica. To verify pathogenicity, thirty 3-year-old chestnut seeding (70 cm high, 1 cm diameter) of Castanea seguinii were used for inoculation. Chestnut branches were wounded (five wounds per sapling) using a hole punch and inoculated with a mycelial plug (5 mm in diameter) from the edge of 7-day-old, actively growing colonies. Pathogen-free PDA plugs were used as controls. To prevent desiccation, inoculated wounds were sealed with parafilm, and saplings were incubated in a greenhouse at 25℃. Each treatment consisted of 5 seedling and the pathogenicity tests were repeated three times. After inoculation for 5 weeks, symptoms of bark cankers were observed on branches similar to those of diseased chestnut trees in the field. Control saplings with sterile PDA discs did not display symptoms. C. parasitica was reisolated from inoculated branches. To our knowledge, this is the first report of C. parasitica causing chestnut blight in Gansu Province, one of the few areas in the China thought to be free of the disease. The specimens were found in the westernmost part of the natural distribution of chestnuts in China. There are more than 2.6 million chestnut trees, which constitute one of the most important economic forests in Hui County Gansu Province (Yang et al. 2005). The occurrence of chestnut blight could be a restricting factor for chestnut forests.

Transcriptome-wide association study identifies PSMB9 as a susceptibility gene for coal workers' pneumoconiosis.

Coal workers' pneumoconiosis (CWP) is a type of typical occupational lung disease caused by prolonged inhalation of coal mine dust. The individuals' different genetic background may underlie their different susceptibility to develop pneumoconiosis, even under the same exposure level. This study aimed to identify susceptibility genes associated with CWP. Based on our previous genome-wide association study (GWAS, 202 CWP cases vs. 198 controls) and gene expression data obtained by analyzing human lungs and whole blood from the Genotype-Tissue Expression (GTEx) Portal, a transcriptome-wide association study (TWAS) was applied to identify CWP risk-related genes. Luciferase report gene assay, qRT-PCR, Western blot, immunofluorescence assay, and TUNEL assay were conducted to explore the potential role of the candidate gene in CWP. Proteasome 20S subunit beta 9 (PSMB9) was identified as a strong risk-related gene of CWP in both lungs and whole blood (Lungs: PTWAS  = 4.22 × 10-4 ; Whole blood: PTWAS  = 2.11 × 10-4 ). Single nucleotide polymorphisms (SNPs) rs2071480 and rs1351383, which locate in the promoter region and the first intron of the PSMB9 gene, were in high linkage disequilibrium (LD, r2  = 0.98) with the best GWAS SNP rs4713600 (G>T, OR = 0.55, 95% CI: 0.42-0.74, P = 6.86 × 10-5 ). Both rs2071480 and rs1351383 significantly enhanced the transcriptional activity of PSMB9. Functional experiments revealed that silica exposure remarkably reduced the PSMB9 expression and caused cell apoptosis, while overexpression of PSMB9 markedly abolished silica-induced cell apoptosis. We here identified PSMB9 as a novel susceptibility gene for CWP and provided important insights into the further exploration of the CWP pathogenesis.

First Report of Northern Root-Knot Nematode Meloidogyne hapla on Bupleurum chinensis in Gansu Province, China.

Bupleurum chinensis is an important traditional medicine with anti-inflammatory and immunomodulatory effects in China (Navarro et al. 2001). So far, the diseases reported on B. chinensis were caused by fungi (rust and root rot) and virus (Cucumber mosaic virus and Broad bean wilt virus 2) (Zhang et al. 2009). However, no diseases caused by nematodes were reported previously. Root-knot nematodes (Meloidogyne spp.) are one of the most destructive plant-parasitic nematodes with strong adaptability and diversity, infecting more than 5,500 plant species (Azevedo de Oliveira et al. 2018). In October 2020, symptoms of dwarf, leaf yellowing and roots with numerous knots on B. chinensis in several fields were observed in Dingxi City, Gansu Province, Northwest China (N 35°19'42″; E 104°2'24″). Subsequently, hundreds of eggs, mature males and females were exuded from dissection of washed root-knots. Morphological characteristics of females, males and J2s were examined under the optical microscope. The perineal patterns of females (n=15) were oval-shaped with a slightly dorsal arches, and the lateral lines and punctations on anus were observed in some specimens. Measurements (mean ± SD, range) of females(n=20): L (body length) = (525.23 ± 59.88 µm, 439.72 to 659.93 µm), W (maximum body width) = (403.92 ± 57.17 µm, 311.01 to 513.34 µm), St (stylet length) = (11.28 ± 1.05 µm, 9.82 to 12.91 µm), MBW (width of the median bulb) = (31.13 ± 3.32 µm, 23.66 to 35.55 µm), MB (distance from anterior end to center of median oesophageal bulb valve) = (64.45 ± 3.44 µm, 58,62 to 71.92 µm), and DGO (dorsal gland orifice to stylet) = (3.79 ± 0.60 µm, 2.72 to 5.00 µm). Male (n=20): L= (1038.25 ± 90.34 µm, 877.28 to 1206.12 µm), St= (18.13 ± 1.48 µm, 15.10 to 20.12 µm), a (body length divided by greatest body width) = (31.77 ± 4.03 µm, 23.29 to 41.16µm), MBW= (10.97 ± 0.78 µm, 9.05 to 12.31 µm), MB= (64.81 ± 3.45 µm, 59.59 to 71.38 µm), DGO= (4.05 ± 0.47 µm, 3.11 to 5.08 µm), and Spic (spicule length) = (22.57 ± 1.91 µm, 19.26 to 26.43 µm). J2 (n=25): L= (381.73 ± 25.85µm, 336.96 to 419.98 µm), St= (10.52 ± 1.03 µm, 9.15 to 12.14 µm), a= (24.35 ± 2.10 µm, 20.45 to 28.29 µm), DGO= (3.02 ± 0.42 µm, 2.42 to 3.79 µm), c (body length divided by tail length) = (8.90 ± 0.86 µm, 7.71 to 10.48 µm), and c' (tail length divided by body width at anus) = (4.18 ± 0.50 µm, 3.47 to 5.04 µm). According to morphological characteristics, root-knot nematode infecting B. chinensis was preliminarily identified as Meloidogyne hapla Chitwood, 1949 (Whitehead 1968). To further verify this result, DNA was extracted from ten individual females, the ITS region and the D2-D3 region of 28S rDNA were amplified using the primer TW81/AB28(GTTTCCGTAGGTGAACCTGC/ ATATGCTTAAGTTCAGCGGGT) (Subbotin et al. 2000) D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/ TCGGAAGGAACCAGCTACTA) (De Ley et al. 1999), respectively. PCR products were purified and sequenced. The sizes of ITS region and D2-D3 region of 28S rDNA were 557 bp and 762 bp, respectively. The sequence of ITS region (GenBank accession number: OK030559) was 99.46%-99.82% identical to the M. hapla from China (MT490918), New Zealand (JX465560), Australia (AF516722) and Japan (LC030357). The sequence of D2-D3 region of 28S rDNA (GenBank accession number: OK030558) was 99.58%-100.00% identical to the M. hapla from Canada (MW182329), Ethiopia (KJ645432), USA (KP901086) and China (MN446015). Furthermore, fragments obtained using the specific primers of M. hapla (Mh-F/Mh-R) were 462 bp, which also was consistent with that of M. hapla (Feng et al. 2008). Through morpho-molecular characterization, the root-knot nematodes on B. chinensis in China were identified as M. hapla. Six seedlings of B. chinensis were planted in 16 cm diameter, 20 cm deep plastic pots with sterilized soil in the greenhouse at 20-25℃ for pathogenicity test. After planted 21 days, 2000 J2s/pot were inoculated, six seedling uninoculated were used as control. After 90 days, all inoculated plants showed similar symptoms observed in the field, and nematode reproduction factor (final population density/initial population density) was 1.47. Meanwhile, no symptoms were observed on control plants. These results proved that the nematode infecting B. chinensis is M. hapla. To our knowledge, this is the first report of B. chinensis as a new host of M. hapla in China. Bupleurum chinensis is widely planted in Gansu Province, the plant species cultivated across an area of about 19.1 million hectares, accounting for 40% of the China's total output (Wang et al. 2017). The root system of B. chinensis infected M. hapla is stunned and short, seriously affect the quality of medicinal materials, and restrict the development of the local Chinese herbal medicine industry.

LncRNA-ATB regulates epithelial-mesenchymal transition progression in pulmonary fibrosis via sponging miR-29b-2-5p and miR-34c-3p.

Dysregulation of non-coding RNAs (ncRNAs) has been proved to play pivotal roles in epithelial-mesenchymal transition (EMT) and fibrosis. We have previously demonstrated the crucial function of long non-coding RNA (lncRNA) ATB in silica-induced pulmonary fibrosis-related EMT progression. However, the underlying molecular mechanism has not been fully elucidated. Here, we verified miR-29b-2-5p and miR-34c-3p as two vital downstream targets of lncRNA-ATB. As opposed to lncRNA-ATB, a significant reduction of both miR-29b-2-5p and miR-34c-3p was observed in lung epithelial cells treated with TGF-ß1 and a murine silicosis model. Overexpression miR-29b-2-5p or miR-34c-3p inhibited EMT process and abrogated the pro-fibrotic effects of lncRNA-ATB in vitro. Further, the ectopic expression of miR-29b-2-5p and miR-34c-3p with chemotherapy attenuated silica-induced pulmonary fibrosis in vivo. Mechanistically, TGF-ß1-induced lncRNA-ATB accelerated EMT as a sponge of miR-29b-2-5p and miR-34c-3p and shared miRNA response elements with MEKK2 and NOTCH2, thus relieving these two molecules from miRNA-mediated translational repression. Interestingly, the co-transfection of miR-29b-2-5p and miR-34c-3p showed a synergistic suppression effect on EMT in vitro. Furthermore, the co-expression of these two miRNAs by using adeno-associated virus (AAV) better alleviated silica-induced fibrogenesis than single miRNA. Approaches aiming at lncRNA-ATB and its downstream effectors may represent new effective therapeutic strategies in pulmonary fibrosis.

Metformin attenuates silica-induced pulmonary fibrosis via AMPK signaling.

BACKGROUND: Silicosis is one of the most common occupational pulmonary fibrosis caused by respirable silica-based particle exposure, with no ideal drugs at present. Metformin, a commonly used biguanide antidiabetic agent, could activate AMP-activated protein kinase (AMPK) to exert its pharmacological action. Therefore, we sought to investigate the role of metformin in silica-induced lung fibrosis. METHODS: The anti-fibrotic role of metformin was assessed in 50 mg/kg silica-induced lung fibrosis model. Silicon dioxide (SiO2)-stimulated lung epithelial cells/macrophages and transforming growth factor-beta 1 (TGF-ß1)-induced differentiated lung fibroblasts were used for in vitro models. RESULTS: At the concentration of 300 mg/kg in the mouse model, metformin significantly reduced lung inflammation and fibrosis in SiO2-instilled mice at the early and late fibrotic stages. Besides, metformin (range 2-10 mM) reversed SiO2-induced cell toxicity, oxidative stress, and epithelial-mesenchymal transition process in epithelial cells (A549 and HBE), inhibited inflammation response in macrophages (THP-1), and alleviated TGF-ß1-stimulated fibroblast activation in lung fibroblasts (MRC-5) via an AMPK-dependent pathway. CONCLUSIONS: In this study, we identified that metformin might be a potential drug for silicosis treatment.

Respiratory traits and coal workers' pneumoconiosis: Mendelian randomisation and association analysis.

OBJECTIVES: Susceptibility loci of idiopathic pulmonary fibrosis and chronic obstructive pulmonary disease were also significantly associated with the predisposition of coal worker's pneumoconiosis (CWP) in recent studies. However, only a few genes and loci were targeted in previous studies. METHODS: To systematically evaluate the genetic associations between CWP and other respiratory traits, we reviewed the reported genome-wide association study loci of five respiratory traits and then conducted a Mendelian randomisation study and a two-stage genetic association study. RESULTS: Interestingly, we found that for each SD unit, higher lung function was associated with a 66% lower risk of CWP (OR=0.34, 95% CI: 0.15 to 0.77, p=0.010) using conventional Mendelian randomisation analysis (inverse variance weighted method). Moreover, we found susceptibility loci of interstitial lung disease (rs2609255, OR=1.29, p=1.61×10-4) and lung function (rs4651005, OR=1.39, p=1.62×10-3; rs985256, OR=0.73, p=8.24×10-4 and rs6539952, OR=1.28, p=4.32×10-4) were also significantly associated with the risk of CWP. Functional annotation showed these variants were significantly associated with the expression of FAM13A (rs2609255, p=7.4 ×10-4), ANGPTL1 (rs4651005, p=5.4 ×10-7), SPATS2L (rs985256, p=1.1 ×10-5) and RP11-463O9.9 (rs6539952, p=7.1 ×10-6) in normal lung tissues, which were related to autophagy pathway simultaneously according to enrichment analysis. CONCLUSIONS: These results provided a deeper understanding of the genetic predisposition basis of CWP.

miR-770-5p inhibits the activation of pulmonary fibroblasts and silica-induced pulmonary fibrosis through targeting TGFBR1.

Silicosis is a devastating interstitial lung disease arising from long-term exposure to inhalable silica. Regrettably, no therapy currently can effectively reverse the silica-induced fibrotic lesion. Emerging evidence has indicated that the dysregulation of microRNAs is involved in silica-induced pulmonary fibrosis. The aim of this study is to explore the expression pattern and underlying mechanisms of miR-770-5p in silica-induced pulmonary fibrosis. Consistent with our previous miRNA microarray analysis, the results of qRT-PCR showed that miR-770-5p expression was downregulated in silica-induced pulmonary fibrosis in humans and animal models. Administration of miR-770-5p agomir significantly reduced the fibrotic lesions in the lungs of mice exposed to silica dust. MiR-770-5p also exhibited a dramatic reduction in TGF-ß1-activated human pulmonary fibroblasts (MRC-5). Transfection of miR-770-5p mimics significantly decreased the viability, migration ability, and S/G0 phase distribution, as well as the expression of fibronectin, collagen I, and α-SMA in TGF-ß1-treated MRC-5 cells. Transforming growth factor-ß receptor 1 (TGFBR1) was confirmed as a direct target of regulation by miR-770-5p. The expression of TGFBR1 was significantly increased in pulmonary fibrosis. Knockdown of TGFBR1 blocked the transduction of the TGF-ß1 signaling pathway and attenuated the activation of MRC-5 cells, while overexpression of TGFBR1 effectively restored the activation of MRC-5 cells inhibited by miR-770-5p. Together, our results demonstrated that miR-770-5p exerted an anti-fibrotic effect in silica-induced pulmonary fibrosis by targeting TGFBR1. Targeting miR-770-5p might provide a new therapeutic strategy to prevent the abnormal activation of pulmonary fibroblasts in silicosis.

LncRNA-PVT1 activates lung fibroblasts via miR-497-5p and is facilitated by FOXM1.

It is little known about the lncRNA-PVT1 effect on occupational pulmonary fibrosis, although researches show it plays an essential role in cancer. Studies reveal that lung fibroblast activation is one of the key events in silica-induced fibrosis. Here, we found that lncRNA-PVT1 promoted the proliferation, activation, and migration of lung fibroblasts. The isolation of cytoplasmic and nuclear RNA assay and fluorescence in situ hybridization experiment showed that lncRNA-PVT1 was abundantly expressed in the cytoplasm. Luciferase reporter gene assay and RNA pull-down experiment indicated that the cytoplasmic-localized lncRNA-PVT1 could competitively bind miR-497-5p. MiR-497-5p was further observed to attenuate silica-induced pulmonary fibrosis by targeting Smad3 and Bcl2. Moreover, the transcription factor FOXM1 acted as a profibrotic factor by elevating lncRNA-PVT1 transcription in lung fibroblasts. Inhibition of FOXM1 expression with thiostrepton alleviated silica-induced pulmonary fibrosis in vivo. Collectively, we revealed that FOXM1-facilitated lncRNA-PVT1 activates lung fibroblasts via miR-497-5p during silica-induced pulmonary fibrosis, which may provide potential therapeutic targets for pulmonary fibrosis.

A new cyst-forming nematode, Cactodera tianzhuensis n. sp. (Nematoda:Heteroderinae) from Polygonum viviparum in China with a key to the Genus Cactodera.

A new cyst-forming nematode, Cactodera tianzhuensis n. sp. was isolated from the rhizosphere soil of Polygonum viviparum L. in Tianzhu county, China. Morphologically, the new species is characterized by lemon-shaped or rounded cysts that have protruding necks and vulval cones. The vulval cone of the new species appeared to be circumfenestrate without bullae and underbridge, vulval denticle present and anus distinct. Second-stage juveniles are vermiform, stylet well-developed with the rounded stylet knobs to slightly concave anteriorly. Lateral field with four incisures. Tail gradually tapering to a finely rounded terminus with a length of ca 54 (47-59) µm, outline of hyaline portion is V-shaped or U-shaped. Egg shells without visible markings or punctations. The phylogenetic analyses based on ITS-rDNA, D2-D3 of 28S-rDNA clearly revealed that the new species formed a separate clade from other Cactodera species, which further support the unique status of C. tianzhuensis n. sp. Therefore, it is described herein as a new species of the genus Cactodera.

First report of potato rot nematode, Ditylenchus destructor Thorne, 1945 infecting Codonopsis pilosula in Gansu province, China.

In November 2019, stem nematode was found on Codonopsis pilosula in Tanchang county, Gansu province, China. The population of stem nematode was identified on the basis of both molecular and morphological methods. The morphological and morphometric characteristics of this nematode population matched with Ditylenchus destructor Thorne, 1945. The sequences of rDNA-ITS and D2/D3 region of 28S-rRNA similarity with the D. destructor. The pathogenicity results revealed the symptom of dry rot on C. pilosula was caused by this nematode. To our knowledge, this is the first report that D. destructor on C. pilosula in China.

Description of Heterodera microulae sp. n. (Nematoda: Heteroderinae) from China - a new cyst nematode in the Goettingiana group.

A new cyst-forming nematode, Heterodera microulae sp. n., was isolated from the roots and rhizosphere soil of Microula sikkimensis in China. Morphologically, the new species is characterized by lemon-shaped body with an extruded neck and obtuse vulval cone. The vulval cone of the new species appeared to be ambifenestrate without bullae and a weak underbridge. The second-stage juveniles have a longer body length with four lateral lines, strong stylets with rounded and flat stylet knobs, tail with a comparatively longer hyaline area, and a sharp terminus. The phylogenetic analyses based on ITS-rDNA, D2-D3 of 28S rDNA, and COI sequences revealed that the new species formed a separate clade from other Heterodera species in Goettingiana group, which further support the unique status of H. microulae sp. n. Therefore, it is described herein as a new species of genus Heterodera; additionally, the present study provided the first record of Goettingiana group in Gansu Province, China.

M10 peptide attenuates silica-induced pulmonary fibrosis by inhibiting Smad2 phosphorylation.

Silica-induced pulmonary fibrosis is a kind of worldwide occupational disease, and there is no effective treatment at present. Peptide therapy has attracted significant attention due to its simple structure, high selectiveness, strong bioactivity, relative safety, and high patient tolerance. In this study, we first confirmed that M10, a 10 amino acid peptide, has anti-fibrotic effects during the early and late stages of silica-induced fibrosis in mouse models and then partly explored the underlying mechanisms in vitro. M10 was detected in both the cell cytoplasm and nuclei. M10 showed no cytotoxicity to pulmonary epithelial cells and fibroblasts at the given concentrations. Functionally, M10 can reverse the silica-induced EMT process in epithelial cells and decrease TGF-ß1-stimulated fibroblast activation. Further mechanism investigations supported that M10 can block TGF-ß1 signalling by inhibiting phosphorylation of Smad2 protein in vitro and in vivo. All of the results indicate that M10 peptide may be a new method for the treatment of silica-induced pulmonary fibrosis.

MiR-326 Inhibits Inflammation and Promotes Autophagy in Silica-Induced Pulmonary Fibrosis through Targeting TNFSF14 and PTBP1.

Silicosis is a kind of irreversible pulmonary fibrosis induced by the long-term inhalation of silica particles. The therapeutic strategy based on the microRNAs might be an effective way for the treatment of silicosis. Our previous miRNA microarray data indicated that miR-326 was decreased in the mouse lung tissues of silica-induced pulmonary fibrosis. However, the specific functions of miR-326 on silica-induced pulmonary fibrosis remain unclear. The objective was to determine the expression and the biological effects of miR-326 in silica-induced pulmonary fibrosis. Methods included mouse models of silica-induced pulmonary fibrosis and miR-326 intervention that were established separately to explore the effect of miR-326 in vivo. The cell models of SiO2-treated lung epithelial cells (HBE and A549) and TGF-ß1-stimulated lung fibroblast cells (MRC-5 and NIH/3T3) were used to investigate the mechanism of miR-326 in vitro. Hematoxylin and eosin staining was used to evaluate the severity and distribution of fibrosis of mouse lung tissues. Western blot and immunofluorescence assays were performed to measure the downstream molecules of miR-326. Transmission electron microscopy pictures showed the autophagy activity. The results showed miR-326 is down-regulated in the fibrotic lung tissues of silica-treated mice, while increased expression of miR-326 attenuates silica-induced pulmonary fibrosis in vivo. Tumor necrosis factor superfamily-14 (TNFSF14) and polypyrimidine tract-binding protein 1 (PTBP1) are identified as the targets of miR-326. MiR-326 dampens pulmonary inflammation through targeting TNFSF14 and promotes autophagy activity of fibroblasts through targeting PTBP1. LncRNA HOTAIR facilitates inflammation via sponging miR-326. In conclusion, we demonstrate that miR-326 inhibits inflammation and promotes autophagy activity by targeting TNFSF14 and PTBP1 separately to alleviate silica-induced pulmonary fibrosis. Our results might shed new light on the therapeutic strategies for silica-induced pulmonary fibrosis.

Long non-coding RNA-ATB promotes EMT during silica-induced pulmonary fibrosis by competitively binding miR-200c.

Long non-coding RNAs (lncRNAs) are important signal transduction regulators that act by various patterns. However, little is known about the molecular mechanisms of lncRNA related pathways in occupational lung fibrosis. Our previous study found that epithelial-mesenchymal transition (EMT) was one of the key events in silica-induced pulmonary fibrosis. This study showed that the lncRNA-ATB promoted EMT by acting as a miR-200c sponge. miR-200c was identified by miRNA array as a potential target of lncRNA-ATB and verified by dual luciferase reporter gene together with RNA pull-down assays. Moreover, our findings demonstrated that lncRNA-ATB is abundantly expressed during EMT of lung epithelial cells, which contributes to decreased levels of miR-200c. miR-200c targeted ZEB1 to relief silicosis by blocking EMT in vivo and in vitro. The results also suggested M2 macrophages secreted transforming growth factor-ß1 (TGF-ß1) to induce EMT process by activating lncRNA-ATB in epithelial cells. Collectively, silica-stimulated macrophages secreted TGF-ß1 to induce lncRNA-ATB in epithelia cells, promoting EMT by binding with miR-200c and releasing ZEB1. These observations provide further understanding of the regulatory network of silica-induced pulmonary fibrosis and identify new therapeutic targets hopefully.

Meta-analysis on the effectiveness of team-based learning on medical education in China.

BACKGROUND: Team-based learning (TBL) has been adopted as a new medical pedagogical approach in China. However, there are no studies or reviews summarizing the effectiveness of TBL on medical education. This study aims to obtain an overall estimation of the effectiveness of TBL on outcomes of theoretical teaching of medical education in China. METHODS: We retrieved the studies from inception through December, 2015. Chinese National Knowledge Infrastructure, Chinese Biomedical Literature Database, Chinese Wanfang Database, Chinese Scientific Journal Database, PubMed, EMBASE and Cochrane Database were searched. The quality of included studies was assessed by the Newcastle-Ottawa scale. Standardized mean difference (SMD) was applied for the estimation of the pooled effects. Heterogeneity assumption was detected by I2 statistics, and was further explored by meta-regression analysis. RESULTS: A total of 13 articles including 1545 participants eventually entered into the meta-analysis. The quality scores of these studies ranged from 6 to 10. Altogether, TBL significantly increased students' theoretical examination scores when compared with lecture-based learning (LBL) (SMD = 2.46, 95% CI: 1.53-3.40). Additionally, TBL significantly increased students' learning attitude (SMD = 3.23, 95% CI: 2.27-4.20), and learning skill (SMD = 2.70, 95% CI: 1.33-4.07). The meta-regression results showed that randomization, education classification and gender diversity were the factors that caused heterogeneity. CONCLUSIONS: TBL in theoretical teaching of medical education seems to be more effective than LBL in improving the knowledge, attitude and skill of students in China, providing evidence for the implement of TBL in medical education in China. The medical schools should implement TBL with the consideration on the practical teaching situations such as students' education level.