Hypoxia-inducible transcription factors, HIF1A and HIF2A, increase in aging mucosal tissues.

Hypoxia (i.e. oxygen deprivation) activates the hypoxia-signalling pathway, primarily via hypoxia-inducible transcription factors (HIF) for numerous target genes, which mediate angiogenesis, metabolism and coagulation, among other processes to try to replenish tissues with blood and oxygen. Hypoxia signalling dysregulation also commonly occurs during chronic inflammation. We sampled gingival tissues from rhesus monkeys (Macaca mulatta; 3-25 years old) and total RNA was isolated for microarray analysis. HIF1A, HIF1B and HIF2A were significantly different in healthy aged tissues, and both HIF1A and HIF3A were positively correlated with aging. Beyond these transcription factor alterations, analysis of patterns of gene expression involved in hypoxic changes in tissues showed specific increases in metabolic pathway hypoxia-inducible genes, whereas angiogenesis pathway gene changes were more variable in healthy aging tissues across the animals. With periodontitis, aging tissues showed decreases in metabolic gene expression related to carbohydrate/lipid utilization (GBE1, PGAP1, TPI1), energy metabolism and cell cycle regulation (IER3, CCNG2, PER1), with up-regulation of transcription genes and cellular proliferation genes (FOS, EGR1, MET, JMJD6) that are hypoxia-inducible. The potential clinical implications of these results are related to the epidemiological findings of increased susceptibility and expression of periodontitis with aging. More specifically the findings describe that hypoxic stress may exist in aging gingival tissues before documentation of clinical changes of periodontitis and, so, may provide an explanatory molecular risk factor for an elevated capacity of the tissues to express destructive processes in response to changes in the microbial biofilms characteristic of a more pathogenic microbial challenge.

Cytokine gene expression profiles during initiation, progression and resolution of periodontitis.

AIM: Variations in the expression of cytokines during the progression of periodontitis remain ill-defined. We evaluated the expression of 19 cytokine genes related to T-cell phenotype/function during initiation, progression and resolution of periodontitis, and related these to the expression of soft and bone tissue destruction genes (TDGs). MATERIALS AND METHODS: A ligature-induced periodontitis model was used in rhesus monkeys (M. mulatta) (n = 18). Gingival tissues were taken at baseline pre-ligation, 2 weeks and 1 month (Initiation) and 3 months (progression) post ligation. Ligatures were removed and samples taken 2 months later (resolution). Total RNA was isolated and the Rhesus Gene 1.0 ST (Affymetrix) used for gene expression analysis. Significant expression changes were validated by qRT-PCR. RESULTS: Disease initiation/progression was characterized by overexpression of Th17/Treg cytokine genes (IL-1ß, IL-6, TGFß and IL-21) and down-regulation of Th1/Th2 cytokine genes (IL-18 and IL-25). Increased IL-2 and decreased IL-10 levels were seen during disease resolution. Several Th17/Treg cytokine genes positively correlated with TDGs, whereas most Th1/Th2 genes exhibited a negative correlation. CONCLUSION: Initiation, progression and resolution of periodontitis involve over- and underexpression of cytokine genes related to various T-helper subsets. In addition, variations in individual T-helper response subset/genes during disease progression correlated with protective/destructive outcomes.

Change in periodontitis during pregnancy and the risk of pre-term birth and low birthweight.

AIM: Determine whether periodontitis progression during pregnancy is associated with adverse birth outcomes. METHODS: We used clinical data and birth outcomes from the Obstetrics and Periodontal Therapy Study, in which randomly selected women received periodontal treatment before 21 weeks of gestation (N=413) or after delivery (410). Birth outcomes were available for 812 women and follow-up periodontal data for 722, including 75 whose pregnancies ended <37 weeks. Periodontitis progression was defined as >or=3 mm loss of clinical attachment. Birth outcomes were compared between non-progressing and progressing groups using the log rank and t tests, separately in all women and in untreated controls. RESULTS: The distribution of gestational age at the end of pregnancy (p>0.1) and mean birthweight (3295 versus 3184 g, p=0.11) did not differ significantly between women with and without disease progression. Gestational age and birthweight were not associated with change from baseline in percentage of tooth sites with bleeding on probing or between those who did versus did not progress according to a published definition of disease progression (p>0.05). CONCLUSIONS: In these women with periodontitis and within this study's limitations, disease progression was not associated with an increased risk for delivering a pre-term or a low birthweight infant.

Correction: Activation of Notch-1 in oral epithelial cells by P. gingivalis triggers the expression of the antimicrobial protein PLA2-IIA.

The sequence for the Reverse primer used to amplify the human gene PLA2G2A presented in table 1 is incorrect. The following, is the correct sequence: Reverse 5' - GCTCCCTCTGCAGTGTTTATT -3.

Activation of Notch-1 in oral epithelial cells by P. gingivalis triggers the expression of the antimicrobial protein PLA2-IIA.

P. gingivalis (Pg) is an oral pathogen with the ability to induce oral dysbiosis and periodontal disease. Nevertheless, the mechanisms by which mucosal responses to the oral microbiota in the presence of specific pathogens such as Pg could abrogate the host-microbe symbiotic relationship leading to periodontitis remain unclear. Herein, we identified the Notch-1/PLA2-IIA axis as a new molecular pathway through which Pg could be specifically modulating oral epithelial antimicrobial and inflammatory responses. Pg activated Notch-1, and inhibition or silencing of Notch-1 completely abrogated Pg-induced PLA2-IIA in oral epithelial cells (OECs). Activation of Notch-1 and PLA2-IIA production were associated with Pg-produced gingipains. Other oral Gram-positive and Gram-negative species failed to induce similar responses. Pg enhanced OEC antimicrobial activity through PLA2-IIA. Increased Notch-1 activation correlated with higher PLA2-IIA gingival expression and changes in the abundance of specific oral bacteria phyla during periodontal disease. Oral bacterial species exhibited differential antimicrobial susceptibility to PLA2-IIA. These findings support previous evidence suggesting an important role for epithelial Notch-1 activation and PLA2-IIA production during health and disease at mucosal surfaces, and provide new mechanistic information concerning the regulation of epithelial antimicrobial and pro-inflammatory responses modulated by oral pathogenic bacteria associated with periodontal disease.