RESUMEN
Objectives: This study sought to describe our institutional experience of repeated percutaneous stellate ganglion blockade (R-SGB) as a treatment option for drug-refractory electrical storm in patients with nonischemic cardiomyopathy (NICM). Methods: This prospective observational study included 8 consecutive NICM patients who had drug-refractory electrical storm and underwent R-SGB between June 1, 2021 and January 31, 2022. Lidocaine (5 ml, 1%) was injected in the vicinity of the left stellate ganglion under the guidance of ultrasound, once per day for 7 days. Data including clinical characteristics, immediate and long-term outcomes, and procedure related complications were collected. Results: The mean age was (51.5±13.6) years. All patients were male. 5 patients were diagnosed as dilated cardiomyopathy, 2 patients as arrhythmogenic right ventricular cardiomyopathy and 1 patient as hypertrophic cardiomyopathy. The left ventricular ejection fraction was 37.8%±6.6%. After the treatment of R-SGB, 6 (75%) patients were free of electrical storm. 24 hours Holter monitoring showed significant reduction in ventricular tachycardia (VT) episodes from 43.0 (13.3, 276.3) to 1.0 (0.3, 34.0) on the first day following R-SGB (P<0.05) and 0.5 (0.0, 19.3) after whole R-SGB process (P<0.05). There were no procedure-related major complications. The mean follow-up was (4.8±1.1) months, and the median time of recurrent VT was 2 months. Conclusion: Minimally invasive R-SGB is a safe and effective method to treat electrical storm in patients with NICM.
Asunto(s)
Cardiomiopatías , Ablación por Catéter , Taquicardia Ventricular , Humanos , Masculino , Adulto , Persona de Mediana Edad , Anciano , Femenino , Volumen Sistólico , Ganglio Estrellado/cirugía , Función Ventricular Izquierda , Cardiomiopatías/terapia , Cardiomiopatías/complicaciones , Taquicardia Ventricular/terapia , Resultado del TratamientoRESUMEN
A doubly Q-switched (DQS) Ho:LuAG laser resonantly pumped by a 1.91-µm laser was first presented with an acoustic-optic modulator (AOM) and a Cr2+:ZnS saturable absorber. A comparison among the active Q-switched (AQS), passively Q-switched (PQS), and DQS laser performances was carried out. The maximum continuous wave (CW) output power of 6 W with the central wavelength of 2100.65 nm was obtained at an incident pump power of 35.2 W. Compared with CW laser, the AQS, PQS, and DQS lasers shared the same central wavelength of 2098.34 nm under the same incident pump power. The central wavelength of the AQS and DQS lasers remained constant with the change of AOM repetition frequency (RF). When the incident pump power was 35.2 W and the AOM RF was 15 kHz, the DQS Ho:LuAG laser at a maximum RF of 2.13 kHz achieved the maximum average output power of 4.95 W. At the AOM RF of 10 kHz, the DQS Ho:LuAG laser achieved the shortest pulse width of 40.4 ns with the highest peak power of 61.5 kW. At an incident pump power of 35.2 W, the PQS Ho:LuAG laser obtained the shortest pulse width of 46.1 ns, corresponding to the RF of 2.25 kHz. Experiment results showed that the pulse width could be compressed effectively with a significant increase of peak power for a 2-µm DQS laser.
Asunto(s)
Láseres de Estado Sólido , Acústica , Diseño de Equipo , Humanos , Fenómenos ÓpticosRESUMEN
No information is available on segregation analysis of DNA markers involving both pollen and self-progeny. Therefore, we used capillary electrophoresis- and fluorescence-based DNA fingerprinting together with single pollen collection and polymerase chain reaction (PCR) to investigate simple sequence repeat (SSR) marker segregation among 964 single pollens and 288 self-progenies (S1) of sugarcane cultivar LCP 85-384. Twenty SSR DNA fragments (alleles) were amplified by five polymorphic SSR markers. Only one non-parental SSR allele was observed in 2392 PCRs. SSR allele inheritance was in accordance with Mendelian laws of segregation and independent assortment. Highly significant correlation coefficients were found between frequencies of observed and expected genotypes in pollen and S1 populations. Within the S1 population, the most frequent genotype of each SSR marker was the parental genotype of the same marker. The number of genotypes was higher in pollen than S1 population. PIC values of the five SSR markers were greater in pollen than S1 populations. Eleven of 20 SSR alleles (55%) were segregated in accordance with Mendelian segregation ratios expected from pollen and S1 populations of a 2n = 10x polyploid. Six of 20 SSR alleles were segregated in a 3:1 (presence:absence) ratio and were simplex markers. Four and one alleles were segregated in 77:4 and 143:1 ratios and considered duplex and triplex markers, respectively. Segregation ratios of remaining alleles were unexplainable. The results provide information about selection of crossing parents, estimation of seedling population optimal size, and promotion of efficient selection, which may be valuable for sugarcane breeders.
Asunto(s)
Segregación Cromosómica , Repeticiones de Microsatélite , Poliploidía , Saccharum/genética , Alelos , Genotipo , Polen/genéticaRESUMEN
A striking characteristic of modern sugarcane is that all sugarcane cultivars (Saccharum spp) share a common cytoplasm from S. officinarum. To explore the potential value of S. spontaneum cytoplasm, new Saccharum hybrids with an S. spontaneum cytoplasm were developed at the United States Department of Agriculture-Agricultural Research Service, Sugarcane Research Laboratory, through a combination of conventional and molecular breeding approaches. In this study, we analyzed the genetic variability among the chloroplast genomes of four sugarcane cultivars, eight S. spontaneum clones, and three F1 progeny containing an S. spontaneum cytoplasm. Based on the complete chloroplast genome sequence information of two sugarcane cultivars (NCo 310 and SP 80-3280) and five related grass species (barley, maize, rice, sorghum, and wheat), 19 polymerase chain reaction primer pairs were designed targeting various chloroplast DNA (cpDNA) segments with a total length varying from 4781 to 4791 bp. Ten of the 19 cpDNA segments were polymorphic, harboring 14 mutation sites [a 15-nt insertion/deletion (indel), a 5-nt indel, two poly (T) tracts, and 10 single nucleotide polymorphisms]. We demonstrate for the first time that the chloroplast genome of S. spontaneum was maternally inherited. Comparative sequence homology analyses clustered sugarcane cultivars into a distinctive group away from S. spontaneum and its progeny. Three mutation sites with a consistent, yet species-specific, nucleotide composition were found, namely, an A/C transversion and two indels. The genetic variability among cpDNA of sugarcane cultivars and S. spontaneum will be useful information to determine the maternal origin in the Saccharum genus.
Asunto(s)
Cromosomas de las Plantas/genética , Citoplasma/genética , Saccharum/genética , Variación Genética , Genoma del Cloroplasto , Mutación , Oryza/genética , Especificidad de la Especie , Estados Unidos , Zea mays/genéticaRESUMEN
Red rod is an economically important disease of sugarcane caused by the fungus Colletotrichum falcatum. We used a simple sequence repeat (SSR)-based marker system to identify and analyze genetic relationships of red rot resistant and susceptible sugarcane cultivars grown in Pakistan. Twenty-one highly polymorphic SSR markers were used for DNA fingerprinting and genetic diversity analysis of 20 sugarcane cultivars. These SSR markers were found to be highly robust; we identified 144 alleles, with 3-11 alleles per marker and a mean of 6.8. Three SSR markers were able to identify all 20 cultivars. DNAMAN(®)-generated homology tree was used to analyze genetic diversity among these cultivars; all cultivars shared 58% or more similarity. We correlated polymorphism information content and resolving power values with marker effectiveness in the process of sugarcane cultivar identification. We concluded that a small number of SSR-derived DNA markers will allow breeders to identify red rot resistant and susceptible cultivars.
Asunto(s)
Dermatoglifia del ADN , Secuencias Repetitivas de Ácidos Nucleicos , Saccharum/genética , Secuencia de Bases , Cartilla de ADN , Electroforesis Capilar , Heterocigoto , Humanos , Reacción en Cadena de la Polimerasa , Polimorfismo GenéticoRESUMEN
Sugarcane (Saccharum hybrids), the second largest cash crop of Pakistan, is planted on 1.029 million ha with an annual production of 50 million tons. During a survey of the sugarcane crop in Faisalabad, Sargodha, and the Dera Ghazi Khan Division of the Punjab Province of Pakistan from 2007 to 2010, symptoms consistent with ratoon stunting, including stunted growth and reddening of the vascular bundles at the nodal regions (1), was observed on sugarcane cvs. CP77-400, SPF-241, CP72-2086, and NCo-310. CP72-2086 and NCo-310 showed severely stunted growth in both crop cycles. A chemical test was performed for detecting ratoon stunt from the field. Longitudinal sections of mature nodes were treated with a combination of hydrogen peroxide and hydrochloric acid. Healthy canes developed a blue-green color in the parenchymatous tissue around the fibrovascular bundles, diseased cane did not. This field test illustrated that as much as 25% of the plants were infected by ratoon stunt in the survey area. Aerobic bacteria were isolated from a stunted sample (NCo-310) on modified sugarcane medium (17 g of cornmeal agar, 8 g of peptone from soy meal, 1 g of K2HPO4, 1 g of KH2PO4, 0.2 g of MgSO4·7H2O, 0.5 g of glucose, 1 g of cysteinefree base, 2 g of bovine serum albumin, and 15 mg of bovine hemin chloride) and incubated for 3 to 4 weeks at 28°C. Light, off-white, round, and raised growth bacterial colonies (1.5 to 4.5 × 0.2 to 0.35 µm). Isolates were positive for the gram and catalase reactions and negative for oxidase, aesculin hydrolysis, urease production, and motility. The pathogen was identified as Leifsonia xyli subsp. xyli (formerly Clavibacter xyli subsp. xyli) based on its morphological characteristics (2). A direct antigen coating-ELISA was developed with antiserum raised against L. xyli subsp. xyli at the National Institute for Biotechnology and Genetic Engineering, Faisalabad, Pakistan. Infected or suspected to be infected plants of different cultivars were used for an ELISA test. Results showed that sugarcane cvs. NCo-310 (Log 1.342 CFU/ml) and CP72-2086 (Log 0.118 CFU/ml) had higher L. xyli subsp. xyli titres than the other cultivars tested (SPF-213 [Log 0.071CFU/ml], CPF-237 [Log 0.077CFU/ml], HSF-240 [Log 0.069 CFU/ml], NSG-555 [Log 0.060 CFU/ml], SPSG-26 [Log 0.076 CFU/ml], SPSG-79 [Log 0.074 CFU/ml], SPF-238 [Log 0.057 CFU/ml], and CP77-400 [Log 0.063 CFU/ml]). Cv. SPF-241 (Log 0.107 CFU/ml) was weakly positive for ratoon stunt (4). Axillary buds of sugarcane were injected via a sterile hypodermic syringe with an 18-gauge needle to deliver a bacterial suspension of 109 cells/ml (3). Inoculated sugarcane plants were examined at intervals over 9 months for the development of symptoms and the presence of bacteria. Cultivars were evaluated on the basis of average number of colonized vascular bundles. SPF-213, CPF-237, HSF-240, NSG-555, SPSG-26, SPSG-79, SPF-238, and CP77-400 were resistant; SPF-241 showed moderate resistance and CP72-2086 and NCo-310 were highly susceptible to ratoon stunt. The pathogen was reisolated from the inoculated plants and identified as L. xyli subsp. xyli by bacteriological tests and its serological reaction. To our knowledge, this is the first report of ratoon stunt of sugarcane in Punjab Province of Pakistan. References: (1) M. J. Davis et al. Science 210:1365, 1980. (2) L. I. Evtushenko et al. Int. J. Syst. Evol. Microbiol. 50:371, 2000. (3) M. P. Nayiager et al. Phytopathol. Z. 99:273, 1980. (4) G.-P. Rao and G.-P. Singh. Sugar Tech. 2:35, 2000.
RESUMEN
Leaf samples from 693 sugarcane plants showing mosaic symptoms were collected in 2001, 2002, and 2003 at 12 locations within the Louisiana sugarcane industry. Virus isolates associated with the diseased plants were identified using reverse-transcriptase polymerase chain reaction (RT-PCR) to distinguish between Sugarcane mosaic virus (SCMV) and Sorghum mosaic virus (SrMV). No SCMV strain was associated with any diseased plant collected during the survey. RT-PCR-based restriction fragment length polymorphism (RFLP) analysis showed that SrMV strains I, H, and M were associated with 67, 10, and 2% of the plants with mosaic symptoms, respectively. In previous surveys conducted between 1978 and 1995, over 90% of the plants sampled were infected with SrMV strain H. The remaining plants mostly were infected with SrMV strain I, except for an occasional sample with SrMV strain M. RT-PCR showed that approximately 13% of the samples collected between 2001 and 2003 were infected with SrMV, but the RFLP banding pattern did not match any described strain. Twelve plants were co-infected by two SrMV strains and two plants by three SrMV strains. No RT-PCR product was produced by either the SCMV- or the SrMV-specific RT-PCR primer set for 8% of the plants showing mosaic symptoms, suggesting that another virus may cause sugarcane mosaic in Louisiana.
RESUMEN
A real-time, polymerase chain reaction (PCR) assay was developed for detecting Leifsonia xyli subsp. xyli in sugarcane leaf tissue. Real-time PCR assays were conducted on the youngest, fully expanded leaf of three cultivars collected bi-weekly from field nurseries between 11 April and 19 July 2005. L. xyli subsp. xyli infection was detected in leaves collected at all sampling dates, including those from 1-month-old plants on 11 April. Assays conducted on older, more rapidly growing plants (28 July and 21 October 2005) indicated that leaf position affects assay efficiency. Conventional PCR was less efficient than real-time PCR for detecting L. xyli subsp. xyli in leaf tissue. Real-time PCR was used to rank cultivars for susceptibility to L. xyli subsp. xyli infection based on the relative titer of L. xyli subsp. xyli in leaves of inoculated, 3- and 4-month-old greenhouse-grown plants. The ranking of cultivars by real-time PCR was in close agreement with the ranking determined by tissue-blot enzyme immunoassay performed on tissue from 7- to 9-month-old stalks.
RESUMEN
This study addresses the question of the activation of quiescent transposable elements in maize breeding lines. The a-ruq reporter allele of the Uq transposable element system expresses Uq activity (spots or sectors of spots in otherwise colorless aleurone tissue) when exposed to various genotypes of assorted maize inbred lines lacking any active Uq element. This activation of quiescent Uq elements occurs randomly during the growth of the endosperm. It is concluded that there are components in the genome that enhance the rare activation of quiescent Uq elements. Further, it seems that this activation occurs in the absence of any stress-inducing treatment, but that normal growth conditions provide sufficient stimulus for such activation.
RESUMEN
The spontaneous germinal activation of quiescent Uq transposable elements is reported. Thirty-nine spotted exceptions were observed at a rate of about 2 x 10(-4) from 687 otherwise colorless ears produced from the cross of a-ruq/a-ruq (colorless or occasionally sectored) X an a-ruq tester (colorless). All exceptions had spotting patterns distinct from the pattern of our original standard Uq (Uq1)-a-ruq spotting. From these spotted exceptions five new Uq elements (Uq2, Uq3, Uq4, Uq5 and Uq6) have been isolated. Genetic evidence for the Uq nature of the five germinal isolates is presented. First, each of the five spotted exceptions was homozygous for the a-ruq reporter allele. Second, four new Uq isolates (Uq2, Uq3, Uq4 and Uq5), after being reconstituted into a alpha degrees sh2/alpha degrees sh2 (no Uq) line, could transactivate the standard a-ruq allele and continue to produce their distinct spotting phenotypes. Third, these five new Uqs are also capable of transactivating the c-ruq65 and c-ruq67 alleles. However, the transactivation of c-ruq is generally weaker than that of a-ruq.
Asunto(s)
Elementos Transponibles de ADN/genética , Regulación de la Expresión Génica , Activación Transcripcional/genética , Zea mays/genética , Genes Letales , Variación Genética/genética , Homocigoto , Mutagénesis/genética , Fenotipo , Pigmentación/genética , Semillas/anatomía & histología , Semillas/crecimiento & desarrollo , Zea mays/crecimiento & desarrolloRESUMEN
Sonic hedgehog (Shh) functions as a conserved morphogen in the development of various organs in metazoans ranging from Drosophila to humans. Here, we have investigated the potential roles and underlying mechanisms of Shh signaling in murine placentation. Immunostaining revealed the abundant expression of the main components of Shh pathway in both the trophectoderm of blastocysts and developing placentas. Disruption of Shh led to impaired vascularogenesis of yolk sac, less branching and malformation of placental labyrinth, thereby leading to a robust decrease in capacity of transplacental passages. Moreover, placenta-specific gene incorporation by lentiviral transduction of mouse blastocysts and blastocyst transplantation robustly knocked down the expression of Gli3 and Gli2 in placenta but not in embryos. Finally, Gli3 knockdown in Shh(-/-) placentas partially rescued the defects of both yolk sac and placental labyrinth, and robustly restored the capacity of transplacental passages. Gli2 knockdown in Shh(+/)(-) placentas affected neither the capacity of tranplacental passages nor the vascularogenesis of yolk sac, however, it partially phenocopied the labyrinthine defects of Shh(-/-) placentas. Taken together, these results uncover that both Shh/Gli2 and Shh/Gli3 signals are required for proper development of murine placentas and are possibly essential for pregnant maintenance.
Asunto(s)
Proteínas Hedgehog/metabolismo , Factores de Transcripción de Tipo Kruppel/metabolismo , Proteínas del Tejido Nervioso/metabolismo , Placenta/metabolismo , Animales , Western Blotting , Femenino , Proteínas Hedgehog/genética , Inmunohistoquímica , Factores de Transcripción de Tipo Kruppel/genética , Ratones , Ratones Endogámicos C57BL , Ratones Mutantes , Microscopía Electrónica de Transmisión , Proteínas del Tejido Nervioso/genética , Placenta/embriología , Embarazo , Reacción en Cadena de la Polimerasa de Transcriptasa Inversa , Proteína Gli2 con Dedos de Zinc , Proteína Gli3 con Dedos de ZincRESUMEN
A polymerase chain reaction (PCR) protocol was developed that amplified a 360-bp DNA product unique to Xanthomonas albilineans (Xa), the causal agent of sugarcane leaf scald disease. The assay utilizes previously described PCR primers that target the intergenic transcribed spacer (ITS) region between the 16S and 23S rRNA genes. Primer pair Ala4/L1 allowed amplification of a 360-bp DNA fragment from 71 Xa strains including representatives of serovars I, II, and III. Fragments of different sizes were also amplified from three unidentified saprophytic bacteria from sugarcane. Xa could be detected at a lower bacterial concentration with the PCR protocol than with a serological dot blot assay. With PCR, as little as 1.25 pg of Xa genomic DNA (125 fg if followed by Southern blot hybridization), or as few as 0 to 5 CFU of Xa per reaction were detected from infected sugarcane sap and leaf diffusate. Five CFU of Xa per reaction were detected from suspension culture. The PCR protocol provides a rapid, reliable, and economical tool for routine detection and identification of Xa.
RESUMEN
A polymerase chain reaction (PCR) protocol was developed that specifically detected Clavibacter xyli subsp. xyli, the causal agent of sugarcane ratoon stunting disease. Generic PCR products from the intergenic transcribed spacer (ITS) region of 16S-23S ribosomal DNA of C. xyli subsp. xyli and C. xyli subsp. cynodontis were cloned and sequenced. Based on a multiple sequence alignment among these two sequences and other nonredundant highly homologous sequences from the database, two C. xyli subsp. xyli-specific PCR primers were designed, Cxx1 (5' CCGAAGTGAGCAGATTGACC) and Cxx2 (5' ACCCTGTGTTGTTTTCAACG). These two 20-mer oligonucleotides primed the specific amplification of a 438-bp DNA product from genomic DNA samples of 21 C. xyli subsp. xyli strains. Amplification was not observed with genomic DNA of one C. xyli subsp. cynodontis strain, five strains of four other Clavibacter species, and two strains of two Rathayibacter species. The 438-bp PCR product also was amplified directly from cultured C. xyli subsp. xyli cells and from C. xyli subsp. xyli-infected sugarcane vascular sap with a unique reaction buffer containing polyvinylpyrrolidone and ficoll. Extraction of genomic DNA was not necessary prior to PCR assay.
RESUMEN
New primers were developed that greatly improved the specificity of the polymerase chain reaction (PCR) protocol for Xanthomonas albilineans, the causal agent of sugarcane leaf scald disease. Length-polymorphic PCR products, amplified under the current PCR protocol from the 16S-23S ribosomal DNA intergenic transcribed spacers (ITS) of X. albilineans and three unidentified sugarcane saprophytic bacterial species, were cloned and sequenced. Fourteen other nonredundant ITS sequences retrieved from the database were highly homologous to the sequence of X. albilineans. Two X. albilineans-specific PCR primers, namely, PGBL1 (5' CTT TGG GTC TGT AGC TCA GG) and PGBL2 (5' GCC TCA AGG TCA TAT TCA GC), were designed based on a multiple sequence alignment among these 18 sequences. These two primers permitted specific PCR amplification of a 288-bp DNA product from all 71 diverse X. albilineans strains tested. No amplification product was observed from any other bacterial species tested, including the three unidentified sugarcane saprophytes. The new PCR protocol has been routinely used to detect the leaf scald pathogen from infected sugarcane tissues.
RESUMEN
Cadmium (Cd) is the major component of polluted environment, which has numerous undesirable effects on health. Cd could induce apoptosis of HEK293 cells, and the mitochondria may play a key role. However, the mode of action is unclear. In the present study, we aimed to evaluate the ability of the Cd to induce dysfunction of mitochondria. We examined the effect of cadmium chloride (1, 5 and 10 µM) on mitochondrial membrane permeability and potential as well as oxidative stress markers in mitochondria isolated from HEK293 cells. We found that Cd could directly increase in permeability and decrease in membrane potential of mitochondria, even resulted in mitochondrial swelling, and that Cd could inhibit the activities of ATPase, lactate dehydrogenase (LDH), superoxide dismutase (SOD) and glutathione peroxidase (GSH-Px), enhanced the levels of reactive oxygen species (ROS) and lipid peroxidation (LPO). On the whole, the results show that Cd can directly lead to mitochondrial dysfunction of HEK293 cells, including increased permeability, inhibiting respiration and evoking oxidative stress. Thus, for the first time, this paper makes an overall analysis of Cd-induced changes of structure and function of isolated mitochondria. Our findings may also have general implications in Cd-induced apoptosis by mitochondria pathway.
Asunto(s)
Apoptosis/efectos de los fármacos , Cloruro de Cadmio/toxicidad , Contaminantes Ambientales/toxicidad , Mitocondrias/efectos de los fármacos , Adenosina Trifosfatasas/metabolismo , Técnicas de Cultivo de Célula , Células HEK293 , Humanos , Peroxidación de Lípido/efectos de los fármacos , Potencial de la Membrana Mitocondrial/efectos de los fármacos , Microscopía Electrónica de Transmisión , Mitocondrias/metabolismo , Mitocondrias/ultraestructura , Proteínas Mitocondriales/metabolismo , Dilatación Mitocondrial/efectos de los fármacos , Especies Reactivas de Oxígeno/metabolismoRESUMEN
A quiescent Uq transposable element has been activated in a maize plant treated with 5-aza-2'-deoxycytidine. This activated Uq cosegregates with a heritable dominant miniature (Mn) kernel phenotype, indicating its physical association with a maize miniature locus (Mn::Uq). The Mn::Uq mutant is dominant in producing a miniature seed phenotype of variable size and in reducing seedling vigor in the early growth stage. Genetic experiments indicate that the Mn::Uq mutant also affects the activity of the male gametophyte, whereby pollen germination is inhibited, thus lacking pollen tube growth resulting in the male nontransmissibility of this mutant. Proof for the Uq element in this mutant is derived by its ability to transactivate the standard a-ruq reporter allele to yield spotted aleurone tissue. However, the Mn::Uq mutant does not transactivate a normally Uq-responsive c-ruq allele, suggesting a structural difference between the two ruq receptors at the A1 and C1 loci. It is anticipated that cloning of the Uq transposable element would facilitate the molecular cloning and characterization of the maize miniature gene.
Asunto(s)
Elementos Transponibles de ADN , Genes de Plantas , Zea mays/genética , Ligamiento Genético , Fenotipo , Zea mays/crecimiento & desarrolloRESUMEN
Allelism tests between the standard Uq element (Uq1) and five newly activated germinal Uq elements (Uq2, Uq3, UQ4, Uq5, and Uq6) demonstrate that these new Uq elements are independent of Uq1. Gametes that either contain one Uq or various combinations of two different and phenotypically distinguishable Uq elements, have been constructed either with or without the a-ruq reporter allele. Genetic analyses of the progenies of the gametes (using the standard a-ruq tested line as the other parent) have indicated that (i) each Uq element, when present alone, has the capacity to express full activity except when a secondary transposition or loss of activity has occurred; (ii) all five new Uq elements are independent of Uq1 with respect to transposition activity; and (iii) these newly originated Uqs are clustered on one linkage group. Uq2 is allelic to Uq4, and Uq3 is allelic to Uq5, whereas Uq6 is linked to both allelic pairs. A putative linkage map of these Uq elements is presented. In reciprocal crosses there is a striking difference in phenotypic segregation of Uq; when transmitted via the male parent Uq loses full expression capacity.
Asunto(s)
Ligamiento Genético , Zea mays/genética , Alelos , Elementos Transponibles de ADN , GenotipoRESUMEN
5S rRNA intergenic spacers were amplified from two elite sugarcane (Saccharum hybrids) cultivars and their related taxa by polymerase chain reaction (PCR) with 5S rDNA consensus primers. Resulting PCR products were uniform in length from each accession but exhibited some degree of length variation among the sugarcane accessions and related taxa. These PCR products did not always cross hybridize in Southern blot hybridization experiments. These PCR products were cloned into a commercial plasmid vector PCR 2.1 and sequenced. Direct sequencing of cloned PCR products revealed spacer length of 231-237 bp for S. officinarum, 233-237 for sugarcane cultivars, 228-238 bp for S. spontaneum, 239-252 bp for S. giganteum, 385-410 bp for Erianthus spp., 226-230 bp for Miscanthus sinensis Zebra, 206-207 bp for M. sinensis IMP 3057, 207-209 bp for Sorghum bicolor, and 247-249 bp for Zea mays. Nucleotide sequence polymorphism were found at both the segment and single nucleotide level. A consensus sequence for each taxon was obtained by Align X. Multiple sequences were aligned and phylogenetic trees constructed using Align X. CLUSTAL and DNAMAN programs. In general, accessions of the following taxa tended to group together to form distinct clusters: S. giganteum, Erianthus spp., M. sinensis, S. bicolor, and Z. mays. However, the two S. officinarum clones and two sugarcane cultivars did not form distinct clusters but interrelated within the S. spontaneum cluster. The disclosure of these 5S rRNA intergenic spacer sequences will facilitate marker-assisted breeding in sugarcane.