Validation of the Greek version of the distress thermometer compared to the clinical interview for depression.

BACKGROUND: The Distress Thermometer (DT) is worldwide the most commonly used instrument for quick screening of emotional burden in patients with cancer. In order to validate the Greek version of the DT in the Greek population we aimed to explore the capacity of the DT to identify patients with comorbid depressive diagnosis. METHODS: We analyzed the routinely collected clinical data from 152 patients with cancer who had been evaluated by the consultation-liaison psychiatric service and had received a diagnosis of either depressive disorder or no psychiatric diagnosis. The score of the DT accompanied by the list of problems in the Problem List, the depression status, and the clinical and demographic characteristics entered the data sheet. RESULTS: The ROC analysis revealed that the DT achieved a significant discrimination with an area under the curve of 0.79. At a cut-off point of 4, the DT identified 85% of the patients with an ICD-10 depressive diagnosis (sensitivity) and 60% of the patients without a psychiatric diagnosis (specificity). The positive predictive value was 44%, the negative predictive value 92% and the diagnostic odd ratio 8.88. Fatigue and emotional difficulties were the most commonly reported problems by the patients. CONCLUSION: The Greek version of the DT has a sufficient overall accuracy in classifying patients regarding the existence of depressive disorders, in the oncology setting. Therefore, it can be considered as a valid initial screening tool for depression in patients with cancer; patients scoring ≥4 should be assessed by a more thorough mental evaluation.

Two cycles of adjuvant carboplatin in stage I seminoma: 8-year experience by the Hellenic Cooperative Oncology Group (HECOG).

PURPOSE: Following the establishment of adjuvant carboplatin in stage I testicular seminoma as a standard, we adopted this treatment for all stage I seminoma patients. We report our 8-year experience and compare these results with our previous adjuvant etoposide/cisplatin (EP) strategy. PATIENTS AND METHODS: Patients with stage I seminoma, treated with adjuvant carboplatin and with a minimum follow-up of 1 year, were included. Two cycles of carboplatin [area under the curve (AUC) 6] were administered. RESULTS: A total of 138 patients with median age of 34 years, treated from September 2003 to December 2011, were selected. There were 5 relapses [5-year relapse-free rate (RFR) 96.8 % (95 % confidence interval 91.6-98.8)]: 3 relapses at retroperitoneal lymph nodes, 1 relapse at the adrenal gland, and 1 isolated brain metastasis. Four patients with relapse were cured with salvage chemotherapy. All patients with relapse had tumor diameter ≥4 cm and/or age ≤34 years. Patients with at least 1 of the above risk factors (n = 111) had a significantly higher relapse rate compared with a similar population (n = 64) treated with 2 cycles of adjuvant EP: 5-year RFR was 95 % (SE 2 %) versus 100 % (SE 0 %), (p = 0.067). CONCLUSIONS: Age and tumor diameter were associated with relapse in stage I seminoma treated with adjuvant carboplatin. Although adjuvant carboplatin in patients with age ≤34 and/or tumor diameter ≥4 cm is associated with higher relapse rates than EP, the prognosis of these patients is excellent, and therefore, the use of less toxic treatment is justified.

Sexual dysfunction in testicular cancer patients subjected to post-chemotherapy retroperitoneal lymph node dissection: a focus beyond ejaculation disorders.

Post-chemotherapy retroperitoneal lymph node dissection (PC-RPLND) represents an integral part of multidisciplinary treatment of advanced germ cell cancer; however, it is associated with a high complications rate. The present study aimed to describe sexual disorders in 53 patients with testicular cancer who underwent full bilateral, non-nerve-sparing PC-RPLND in our institution, focusing beyond ejaculatory dysfunction. The International Index for Erectile Function (IIEF) questionnaire was used as diagnostic tool of male sexual functioning pre-operatively and three months after RPLND, while post-operatively patients were asked to describe and evaluate changes in selected sexual parameters. Study findings demonstrate mixed pattern of changes in sexual functioning, with no difference in erectile functioning before and after operation. However, orgasmic function and intercourse and overall sexual satisfaction were found significantly impaired post-operatively. Sexual desire and frequency of attempted sexual intercourses were found significantly increased post-operatively, in comparison with pre-operative levels. With regard to patients' subjective perception on sexual functioning alterations after PC-RPLND, a significant number of patients reported higher levels of sexual desire, no difference in erectile function and worse orgasmic function and satisfaction post-operatively. Thus, patients subjected to PC-RPLND should be closely and routinely evaluated due to close relationship of sexual dissatisfaction with secondary psychological disorders.

Revised Healthy Lifestyle-Diet Index and associations with obesity and iron deficiency in schoolchildren: The Healthy Growth Study.

BACKGROUND: The Healthy Lifestyle-Diet Index (HLD-index), previously developed to assess the degree of adherence to dietary and lifestyle guidelines for primary schoolchildren, was revised according to updated recommendations. Τhe association of the revised HLD-index (R-HLD-index) with obesity and iron deficiency (ID) was also examined. METHODS: A representative sample of 2660 primary schoolchildren from Greece (9-13 years old) participating in the 'Healthy Growth Study' was examined. Twelve components related to dietary and lifestyle patterns were used to develop the R-HLD-index. Scores from 0 up to 4 were assigned to each one of these components, giving a total score ranging from 0 to 48. The associations between the R-HLD-index, obesity and ID were examined via logistic regression analysis. RESULTS: The total score of the R-HLD-index calculated for each one of the study participants was found to range between 2 and 32 units, with higher scores being indicative of a healthier lifestyle and better diet quality. After adjusting for potential confounders, logistic regression analysis showed that an increase in the R-HLD-index score by one unit was associated with 6% lower odds for obesity. However, no significant association was observed between the R-HLD-index score and ID. CONCLUSIONS: The R-HLD-index may be a useful tool for public health policy makers and healthcare professionals when assessing diet quality and lifestyle patterns of primary schoolchildren. Identification of children with lower scores in the R-HLD-index and its individual components could guide tailored made interventions targeting specific children and behaviors.

Mutation profile of KRAS and BRAF genes in patients with colorectal cancer: association with morphological and prognostic criteria.

KRAS and BRAF mutations are well-recognized molecular alterations during colorectal carcinogenesis, but there is little agreement on their effect on tumor characteristics. Therefore, we aimed to evaluate the distribution of the most common KRAS and BRAF mutations in Greek patients with colorectal cancer and their possible associations with clinical histopathological parameters. In this study, 322 and 188 colorectal carcinomas were used for the mutation analysis of KRAS (exon 2) and BRAF (exon 15) genes, respectively. The mutational status of both genes was evaluated by polymerase chain reaction and sequencing analysis. Although the overall frequency of KRAS mutations (36.6%) seemed to be similar to those reported for other populations, the rate of point mutations at codon 13 was significantly lower (12%) in Greek patients with colorectal cancer and associated with male gender (P < 0.05). Tumors with G>T codon 12 transversions and G>C transitions showed more frequent lymph node metastasis (P < 0.05, P < 0.005, respectively). The rate of KRAS mutations gradually decreased with increasing histological grade (P < 0.05), as opposed to BRAF mutations, which were strongly associated with poorly differentiated tumors (P < 0.005). Additionally, we found that the histological features of preexisting adenoma were associated with the absence of BRAF mutations, in contrast to KRAS (P < 0.05). Our data suggested that there seems to be a correlation between morphological criteria and discrete genetic pathways in colorectal carcinogenesis. Moreover, ethnic or geographic factors may have an impact on genetic background of colorectal carcinomas, and specific types of KRAS mutations may influence the metastatic potential of colorectal tumors.

GIDEON (Global Investigation of therapeutic DEcisions in hepatocellular carcinoma and Of its treatment with sorafeNib): second interim analysis.

BACKGROUND: GIDEON (Global Investigation of therapeutic DEcisions in hepatocellular carcinoma [HCC] and Of its treatment with sorafeNib) is a global, prospective, non-interventional study undertaken to evaluate the safety of sorafenib in patients with unresectable HCC in real-life practice, including Child-Pugh B patients who were excluded from clinical trials. METHODS: Patients with unresectable HCC, for whom the decision to treat with sorafenib, based on the approved label and prescribing guidelines, had been taken by their physician, were eligible for inclusion. Demographic data and disease/medical history were recorded at entry. Sorafenib dosing and adverse events (AEs) were collected at follow-up visits. The second interim analysis was undertaken when ~1500 treated patients were followed up for ≥ 4 months. RESULTS: Of the 1571 patients evaluable for safety, 61% had Child-Pugh A status and 23% Child-Pugh B. The majority of patients (74%) received the approved 800 mg initial sorafenib dose, regardless of Child-Pugh status; however, median duration of therapy was shorter in Child-Pugh B patients. The majority of drug-related AEs were grade 1 or 2, and the most commonly reported were consistent with previous reports. The incidence and nature of drug-related AEs were broadly similar across Child-Pugh, Barcelona Clinic Liver Cancer (BCLC) and initial dosing subgroups, and consistent with the overall population. CONCLUSIONS: Consistent with the first interim analysis, overall safety profile and dosing strategy are similar across Child-Pugh subgroups. Safety findings also appear comparable irrespective of initial sorafenib dose or BCLC stage. Final analyses in > 3000 patients are ongoing.

Coronary heart disease mortality in relation to dietary, lifestyle and biochemical risk factors in the countries of the Seven Countries Study: a secondary dataset analysis.

BACKGROUND: The present study explored coronary heart disease (CHD) mortality rates in 2011 in countries that participated in the Seven Countries Study (SCS) in relation to several dietary and anthropometric/biochemical risk factors. Special focus was given to Crete and the Ionian Islands. METHODS: This was a cross-sectional study of secondary analysis of databases using data from the World Health Organization, the Food and Agriculture Organization database and the Greek National Cadaster and Cartography Organization. Geographically weighted regression was applied to identify the high-risk regions in relation to the significant factors. RESULTS: Crete, the Ionian Islands and Japan had the lowest mortality rates (28.9, 30.1 and 31.2 deaths/100,000 people, respectively) in contrast to Serbia/Montenegro that presented the highest rates (105.1 deaths/100,000 people). Diet, physical inactivity and hypertension were found to be the most significant factors in the model (P < 0.05). Regions of no risk were Crete, Ionian Islands and Japan (exponent B = 0.65; 95% confidence interval = 0.293-0.942; P < 0.001), whereas Serbia/Montenegro and Finland were identified as high-risk areas with a 2.97-fold higher probability for CHD mortality (95% confidence interval = 1.736-4.028; P < 0.001). CONCLUSIONS: Observed patterns of CHD mortality and related factors may be helpful for appropriate management by health planners when aiming to reduce its prevalence, particularly in high-risk areas.

"Leaner and less fit" children have a better cardiometabolic profile than their "heavier and more fit" peers: the Healthy Growth Study.

BACKGROUND AND AIMS: To examine differences in cardiometabolic risk factors between children of different BMI and fitness levels. METHODS AND RESULTS: From a representative sample of 1222 boys and 1188 girls, aged 9-13 years, anthropometric, body composition, physical activity, cardiorespiratory fitness, biochemical and blood pressure data was collected. The prevalence of overweight and obesity was 29.9% and 11.8% respectively. In both genders, plasma HDL cholesterol concentration was higher in the 'leaner and less fit' group (lowest quartile of BMI and lowest quartile of fitness) compared to the 'heavier and more fit' (highest quartile of BMI and highest quartile of fitness) and intermediate (all other children) groups (p < 0.05). Furthermore, the 'leaner and less fit' groups in both genders had lower triacylglycerol concentration, total-to-HDL cholesterol ratio, HOMA-IR, insulin and systolic blood pressure levels compared to the 'heavier and more fit' and/or intermediate groups. Similar trends were observed for hypertension in boys and insulin resistance for both genders. Finally, the effect size of being 'leaner and less fit' on serum levels of cardiometabolic risk indices was mainly small to medium (i.e. Cohen's d 0.2-0.5). CONCLUSION: Leaner and less fit boys and girls had better cardiometabolic risk profiles than their heavier and more fit peers, probably suggesting a higher importance of leanness over fitness in children from a cardiometabolic health benefit perspective.

First interim analysis of the GIDEON (Global Investigation of therapeutic decisions in hepatocellular carcinoma and of its treatment with sorafeNib) non-interventional study.

AIMS: Global Investigation of therapeutic DEcisions in hepatocellular carcinoma and Of its treatment with sorafeNib (GIDEON), a global, non-interventional, surveillance study, aims to evaluate the safety of sorafenib in all patients with unresectable hepatocellular carcinoma (uHCC) under real-life practice conditions, particularly Child-Pugh B patients, who were not well represented in clinical trials. METHODS: Treatment decisions are determined by each physician according to local prescribing guidelines and clinical practice. Patients with uHCC who are candidates for systemic therapy, and for whom a decision has been made to treat with sorafenib, are eligible for inclusion. Demographic data and medical and disease history are recorded at entry. Sorafenib dosing and adverse events (AEs) are collected throughout the study. RESULTS: From January 2009 to April 2011, >3000 patients from 39 countries were enrolled. The prespecified first interim analysis was conducted when the initial approximately 500 treated patients had been followed up for ≥4 months; 479 were valid for safety evaluation. Preplanned subgroup analyses indicate differences in patient characteristics, disease aetiology and previous treatments by region. Variation in sorafenib dosing by specialty are also observed; Child-Pugh status did not appear to influence the starting dose of sorafenib. The type and incidence of AEs was consistent with findings from previous clinical studies. AE profiles were comparable between Child-Pugh subgroups. DISCUSSION: The GIDEON study is generating a large, robust database from a broad population of patients with uHCC. First interim analyses have shown global and regional differences in patient characteristics, disease aetiology and practice patterns. Subsequent planned analyses will allow further evaluation of early trends.

Baseline insulin-like growth factor-I plasma levels, systemic inflammation, weight loss and clinical outcome in metastatic non-small cell lung cancer patients.

BACKGROUND: Cancer patients frequently suffer from weight loss and systemic inflammation in the context of advanced disease, which is related to adverse outcome. Insulin-like growth factor (IGF)-I is an anabolic molecule implicated in the maintenance of muscle mass and cancer growth. We investigated potential correlations of IGF-I with an inflammatory and weight loss status and with clinical outcome. METHODS: Baseline IGF-I plasma levels were measured in 77 patients (66 males, median age 65.5 ± 10.6 years), diagnosed with metastatic non-small cell lung cancer, and were correlated with serum albumin and C-reactive protein (CRP) levels, weight loss history, treatment response and overall survival. RESULTS: IGF-I correlated with age (p = 0.01), histologic subtype (p = 0.019), albumin (p < 0.001) and CRP (p < 0.001). In univariate analysis, gender (p = 0.005), smoking status (p = 0.012), albumin (p = 0.034) and IGF-I (p = 0.017) were related to time to progression, while IGF-I (p = 0.003), gender (p = 0.049) and smoking status (p = 0.003) retained their significance in multivariate analysis. Age (p = 0.005), gender (p = 0.029), weight loss (p = 0.009), performance status (p < 0.001), number of metastatic sites (p = 0.004), albumin (p = 0.008), CRP (p = 0.022) and IGF-I (p = 0.042) were associated with overall survival, although only gender (p = 0.013), weight loss (p = 0.027), performance status (p = 0.015) and number of metastatic sites (p = 0.021) emerged as independent prognostic factors. CONCLUSION: IGF-I correlates with systemic inflammation and seems to play an independent predictive role in metastatic non-small cell lung cancer.

Neutral endopeptidase 24.11 loss in metastatic human prostate cancer contributes to androgen-independent progression.

Neutral endopeptidase 24.11 (NEP) is a cell-surface enzyme expressed by prostatic epithelial cells that cleaves and inactivates neuropeptides implicated in the growth of androgen-independent prostate cancer (PC). We report that NEP expression and catalytic activity are lost in vitro in androgen-independent but not androgen-dependent PC cell lines. In vivo, NEP protein expression is commonly decreased in cancer cells of metastatic PC specimens from patients with androgen-independent but not androgen-dependent PC. Overexpression of NEP in androgen-independent PC cells or incubation with recombinant NEP inhibits PC cell growth. Furthermore, in androgen-dependent PC cells, expression of NEP is transcriptionally regulated by androgen and decreases with androgen withdrawal. These data suggest that decreased NEP expression, common in androgen-independent PCs, is facilitated by the elimination of androgens, and that NEP loss plays an important role in the development of androgen-independent PC by allowing PC cells to use mitogenic neuropeptides as an alternate source to androgen in order to stimulate cell proliferation.

Prognostic significance of fascin expression in advanced poorly differentiated serous ovarian cancer.

BACKGROUND: High expression of the actin-bundling protein fascin correlates well with histological grade and clinical stage of ovarian carcinoma. This study addresses fascin expression in advanced poorly differentiated serous ovarian cancer with respect to progression free interval (PFI) and overall survival. PATIENTS AND METHODS: Fascin and Ki-67 expression were analysed in paraffin blocks tissue sections of 56 stage III, poorly differentiated (G3) serous adenocarcinoma patients by immunohistochemistry. Fascin expression was tested for correlation with PFI and overall survival. RESULTS: Fascin expression inversely correlated with Ki-67 expression (p=0.016). Strong fascin immunoreactivity was associated with poor prognosis; patients with low fascin expression had a median survival of 36.5 months versus 32 months for high fascin expression (p=0.041), and the median PFI was 24 versus 17.5 months (p=0.034). CONCLUSION: Fascin expression is an independent prognostic factor for survival of advanced ovarian serous carcinoma, and may represent a novel therapeutic target for patients with aggressive forms of ovarian cancer.

Neutral endopeptidase inhibits prostate cancer cell migration by blocking focal adhesion kinase signaling.

Neutral endopeptidase 24.11 (NEP, CD10) is a cell-surface enzyme expressed by prostatic epithelial cells that cleaves and inactivates neuropeptides implicated in the growth of androgen-independent prostate cancer (PC). NEP substrates such as bombesin and endothelin-1 induce cell migration. We investigated the mechanisms of NEP regulation of cell migration in PC cells, including regulation of phosphorylation on tyrosine of focal adhesion kinase (FAK). Western analyses and cell migration assays revealed an inverse correlation between NEP expression and the levels of FAK phosphorylation and cell migration in PC cell lines. Constitutively expressed NEP, recombinant NEP, and induced NEP expression using a tetracycline-repressive expression system inhibited bombesin- and endothelin-1-stimulated FAK phosphorylation and cell migration. This results from NEP-induced inhibition of neuropeptide-stimulated association of FAK with cSrc protein. Expression of a mutated catalytically inactive NEP protein also resulted in partial inhibition of FAK phosphorylation and cell migration. Coimmunoprecipitation experiments show that NEP associates with tyrosine-phosphorylated Lyn kinase, which then binds the p85 subunit of phosphatidylinositol 3-kinase (PI3-K) resulting in an NEP-Lyn-PI3-K protein complex. This complex competitively blocks FAK-PI3-K interaction, suggesting that NEP protein inhibits cell migration via a protein-protein interaction independent of its catalytic function. These experiments demonstrate that NEP can inhibit FAK phosphorylation on tyrosine and PC cell migration through multiple pathways and suggest that cell migration which contributes to invasion and metastases in PC cells can be regulated by NEP.

Retinoid receptor alpha and Beta expression in serous ovarian tumors.

The expression of retinoid acid receptors alpha (RARalpha) and beta (RARbeta) and estrogen receptor alpha (ERalpha) was assessed by immunohistochemistry and Western blotting in normal ovaries, serous cystadenoma (n = 20), serous borderline (n = 14), and serous ovarian cancer (n = 47) and was correlated in cancer cases with stage, grade, progress-free survival (PFS), and survival. RARalpha was increasingly expressed in benign cystadenomas, borderline, and low-stage and advanced-stage neoplasms (p < 0.001). In stage III, G3 serous carcinoma, increased RARalpha expression was an independent prognostic factor associated with lower chemoresponse to first-line chemotherapy (taxol and carboplatin) and shorter PFS (p < 0.002).RARbeta and ERalpha expression did not correlate with RARalpha tumor characteristics or PFS and survival.

Methylation of the neutral endopeptidase gene promoter in human prostate cancers.

Neutral endopeptidase 24.11 (NEP) is a cell surface peptidase expressed by prostatic epithelial cells that cleaves and inactivates neuropeptide growth factors implicated in the growth of androgen-independent prostate cancer (PC). Decreased NEP expression in hormone-refractory metastatic PCs can result from hormonal therapies because NEP transcription is induced by androgens and down-regulated by androgen withdrawal. NEP is encoded by a gene that contains a 5' CpG island spanning a transcriptional regulatory region. In this study, we investigate whether DNA hypermethylation of the NEP promoter accompanies decreased NEP expression in PC cell lines and whether it occurs in human PC tissues in vivo. DNA isolated from PC cell lines and from normal and neoplastic human prostate tissues was restriction-digested with a methylation-sensitive restriction endonuclease and analyzed by Southern blot using a 5' sequence-specific NEP probe. Methylation-specific PCR was performed using PCR primers designed to discriminate between methylated and unmethylated alleles, and reverse transcription-PCR using NEP-specific primers was performed on cDNA extracted from PC cells treated with 5-aza-2'-deoxycytidine. Methylation of the NEP promoter was present in androgen-independent PC cell lines but not in androgen-dependent or small-cell derived PC cell lines and in 3 of 21 (14%) primary PCs from patients with androgen-dependent disease. Exposure of PC cells to the demethylating agent 5-aza-2'-deoxycytidine led to an increase in NEP transcripts in DU-145 and PC-3 cells. These data show that hypermethylation of the 5' CpG NEP island is associated with a loss of NEP expression in PC. Loss of NEP expression via hypermethylation of the NEP promoter may contribute to the development of neuropeptide-stimulated PCs.

Expression of retinoic acid receptor beta in human renal cell carcinomas correlates with sensitivity to the antiproliferative effects of 13-cis-retinoic acid.

The differentiation and growth suppressive effects of retinoic acid are mediated through retinoic acid nuclear receptors (RARs and RXRs), which are ligand-activated transcription factors. Recent data suggest that both altered and regulated expression of RARs are linked to retinoic acid response in a cell context-dependent manner. This study examined the antiproliferative effects of 13-cis-retinoic acid (cRA) on 12 renal cancer cell lines and correlated these findings with the basal and induced expression of RAR-alpha, -beta and -gamma. Eleven of 12 renal cancers that were either resistant to or only minimally inhibited by cRA did not basally express RAR-beta as determined by Northern blot analysis. In these cells, cRA treatment did not induce RAR-beta expression. In contrast, 1 of 12 cell lines (SK-RC-06) was >90% inhibited by cRA and basally expressed RARbeta. Furthermore, RAR-beta mRNA in SK-RC-06 cells was up-regulated by cRA treatment. Amplification of cDNA using PCR and RAR-beta isoform-specific primer pairs revealed that only SK-RC-06 cells expressed the RAR-beta1 isoform. Expression of RAR-alpha transcripts was abundant in all 12 cell lines examined, whereas low levels of RAR-gamma transcripts were detectable in 6 of 10 renal cancers. Expression of RAR-alpha and RAR-gamma was not affected by cRA. These data showing that the majority of renal cancer cell lines are resistant to cRA suggest that: (a) resistance to the antiproliferative action of cRA correlates with repressed RAR-beta mRNA expression; and (b) the antiproliferative effects of cRA in renal cancer cells are mediated through RAR-beta1.

Markers of androgen-independent progression of prostatic carcinoma.

Prostate cancer (PCa) remains the most common cancer and the second leading cause of cancer mortality in men in the United States. The evolution from a localized to a metastatic phenotype coupled with the progression from an androgen-dependent (AD) to an androgen-independent (AI) state leads to a universally fatal disease. Identifying the biologic characteristics associated with PCa progression is a major goal of current research efforts by different groups, in the hope to better predict the natural history of the disease in an individual patient and to design treatments based on the specific biologic behavior.

Identification and characterization of two androgen response regions in the human neutral endopeptidase gene.

Transcription of the human neutral endopeptidase 24.11 (NEP) gene is androgen regulated in prostate cancer cells. Homology search identified a sequence GTCACAaagAGTTCT similar to the ARE consensus sequence GGTACAnnnTGTTCT within the 3'-untranslated region of the NEP mRNA. A double-stranded radiolabelled oligonucleotide containing this NEP-ARE sequence formed a DNA-protein complex with nuclear proteins from LNCaP cells or COS-7 cells co-transfected with an androgen receptor (AR) expression vector, and with full-length AR synthesized by baculovirus in mobility shift assays. Unlabeled NEP-ARE or consensus ARE but not mutated NEP-ARE replaced radiolabelled NEP-ARE. Steroid-dependent enhancement of transcription was assayed by transfecting ptkCAT reporter constructs containing the NEP-ARE into CV-1/AR cells and prostate cancer cells (PC-3/AR). Enhancement of chloramphenicol acetyltransferase (CAT) activity was increased four-fold by androgen, seven-fold by dexamethasone and three-fold by progesterone in CV-1/AR cells, and the NEP-ARE bound to glucocorticoid and progesterone receptor in mobility shift assays. We next performed DNase-I footprinting analysis of the NEP promoter and identified a 23 bp sequence GGTGCGGGTCGGAGGGATGCCCA (NEP-ARR) which was protected from DNase I cleavage by nuclear extracts from COS-7 cells expressing AR. This sequence was 62.5% homologous to an androgen responsive region (PSA-ARR) identified in the promoter of the prostate specific antigen (PSA) gene. A double-stranded radiolabelled oligonucleotide containing this NEP-ARR sequence formed DNA-protein complex with AR but not GR proteins. Unlabeled NEP-ARR, PSA-ARR and NEP-ARE replaced radiolabelled NEP-ARR. Steroid-dependent enhancement of transcription assays in PC-3/AR cells revealed that the enhancement of CAT activity was increased 2.3-fold by androgen, but not by glucocorticoid or progesterone. In a thymidine kinase promoter, the NEP-ARE and NEP-ARR together stimulated a five-fold increase in promoter activity in PC cells. These data suggest that steroid regulation of the NEP gene involves at least two elements including a typical ARE which binds androgen, progesterone and glucocorticoid receptors, and a unique ARR which only binds androgen receptor.

Expression and sequence analysis of the SDI1/WAF1/CIP1/p21 tumor suppressor gene in prostate cancer cell lines.

The SDI1/WAF1/CIP1 gene encodes a M(r) 21,000 protein (p21) that can arrest cell growth by associating with and inhibiting cyclin-dependent kinase complexes necessary for cells to exit G(1). It is a critical downstream effector in the p53 growth control pathway and can be transcriptionally upregulated by increasing levels of wild-type p53 protein. Somatic mutations in the p21 gene have been detected in 17% of primary prostate cancers. In the current study, we examined four prostate cancer cell lines for expression of and mutations in the p21 gene. Transcripts for p21 mRNA were present in all PC cell lines; p21 protein was detected in androgen-dependent LNCaP cells, as well as in androgen-independent DU-145 and TSU-Pr1 cells but not in androgen-independent PC-3 cells. Examination of the entire coding region of the p21 gene by SSCP analysis and direct DNA sequencing did not detect mutations in the coding domains of the p21 gene. These data indicate that mutations of the SDI1/WAF1/CIP1/p21 gene are not present in cultured PC cells and suggest that defects in the p21 gene are infrequent in prostate cancers.

Aminopeptidase A expression and enzymatic activity in primary human renal cancers.

The gp160 human kidney differentiation antigen is identical to human aminopeptidase A (APA), a zinc-dependent cell-surface metallopeptidase which hydrolyzes peptides with N-terminal acidic residues. GP160/APA is constitutively expressed by proximal tubule cells, the normal cellular counterpart of most renal cancers (RCs). Immunohistochemical analysis of gp160/APA protein expression in 62 primary renal tumor specimens using monoclonal antibody S4 revealed heterogeneous or homogeneous expression of gp160/APA in 46/51 (90%) of clear cell carcinomas in contrast with 1/8 (13%) papillary renal tumors and 0/3 oncocytomas (p<0.001). Analysis of five primary clear cell carcinomas for gp160 protein expression immunohistochemically and associated APA catalytic activity revealed one tumor which expressed gp160/APA protein which was enzymatically inactive. Direct sequence analysis of DNA derived from this specimen could not detect mutations within the zinc-binding domain which would eliminate gp160/APA catalytic activity. These data indicate that the gp160/APA protein is expressed by primary clear cell but not papillary RCs or oncocytomas, and that alterations in gp160/APA protein including loss of protein expression or enzymatic activity occur in 20% of primary clear cell RCs.