Two cycles of adjuvant carboplatin in stage I seminoma: 8-year experience by the Hellenic Cooperative Oncology Group (HECOG).

PURPOSE: Following the establishment of adjuvant carboplatin in stage I testicular seminoma as a standard, we adopted this treatment for all stage I seminoma patients. We report our 8-year experience and compare these results with our previous adjuvant etoposide/cisplatin (EP) strategy. PATIENTS AND METHODS: Patients with stage I seminoma, treated with adjuvant carboplatin and with a minimum follow-up of 1 year, were included. Two cycles of carboplatin [area under the curve (AUC) 6] were administered. RESULTS: A total of 138 patients with median age of 34 years, treated from September 2003 to December 2011, were selected. There were 5 relapses [5-year relapse-free rate (RFR) 96.8 % (95 % confidence interval 91.6-98.8)]: 3 relapses at retroperitoneal lymph nodes, 1 relapse at the adrenal gland, and 1 isolated brain metastasis. Four patients with relapse were cured with salvage chemotherapy. All patients with relapse had tumor diameter ≥4 cm and/or age ≤34 years. Patients with at least 1 of the above risk factors (n = 111) had a significantly higher relapse rate compared with a similar population (n = 64) treated with 2 cycles of adjuvant EP: 5-year RFR was 95 % (SE 2 %) versus 100 % (SE 0 %), (p = 0.067). CONCLUSIONS: Age and tumor diameter were associated with relapse in stage I seminoma treated with adjuvant carboplatin. Although adjuvant carboplatin in patients with age ≤34 and/or tumor diameter ≥4 cm is associated with higher relapse rates than EP, the prognosis of these patients is excellent, and therefore, the use of less toxic treatment is justified.

Baseline insulin-like growth factor-I plasma levels, systemic inflammation, weight loss and clinical outcome in metastatic non-small cell lung cancer patients.

BACKGROUND: Cancer patients frequently suffer from weight loss and systemic inflammation in the context of advanced disease, which is related to adverse outcome. Insulin-like growth factor (IGF)-I is an anabolic molecule implicated in the maintenance of muscle mass and cancer growth. We investigated potential correlations of IGF-I with an inflammatory and weight loss status and with clinical outcome. METHODS: Baseline IGF-I plasma levels were measured in 77 patients (66 males, median age 65.5 ± 10.6 years), diagnosed with metastatic non-small cell lung cancer, and were correlated with serum albumin and C-reactive protein (CRP) levels, weight loss history, treatment response and overall survival. RESULTS: IGF-I correlated with age (p = 0.01), histologic subtype (p = 0.019), albumin (p < 0.001) and CRP (p < 0.001). In univariate analysis, gender (p = 0.005), smoking status (p = 0.012), albumin (p = 0.034) and IGF-I (p = 0.017) were related to time to progression, while IGF-I (p = 0.003), gender (p = 0.049) and smoking status (p = 0.003) retained their significance in multivariate analysis. Age (p = 0.005), gender (p = 0.029), weight loss (p = 0.009), performance status (p < 0.001), number of metastatic sites (p = 0.004), albumin (p = 0.008), CRP (p = 0.022) and IGF-I (p = 0.042) were associated with overall survival, although only gender (p = 0.013), weight loss (p = 0.027), performance status (p = 0.015) and number of metastatic sites (p = 0.021) emerged as independent prognostic factors. CONCLUSION: IGF-I correlates with systemic inflammation and seems to play an independent predictive role in metastatic non-small cell lung cancer.

Neutral endopeptidase 24.11 loss in metastatic human prostate cancer contributes to androgen-independent progression.

Neutral endopeptidase 24.11 (NEP) is a cell-surface enzyme expressed by prostatic epithelial cells that cleaves and inactivates neuropeptides implicated in the growth of androgen-independent prostate cancer (PC). We report that NEP expression and catalytic activity are lost in vitro in androgen-independent but not androgen-dependent PC cell lines. In vivo, NEP protein expression is commonly decreased in cancer cells of metastatic PC specimens from patients with androgen-independent but not androgen-dependent PC. Overexpression of NEP in androgen-independent PC cells or incubation with recombinant NEP inhibits PC cell growth. Furthermore, in androgen-dependent PC cells, expression of NEP is transcriptionally regulated by androgen and decreases with androgen withdrawal. These data suggest that decreased NEP expression, common in androgen-independent PCs, is facilitated by the elimination of androgens, and that NEP loss plays an important role in the development of androgen-independent PC by allowing PC cells to use mitogenic neuropeptides as an alternate source to androgen in order to stimulate cell proliferation.

Prognostic significance of fascin expression in advanced poorly differentiated serous ovarian cancer.

BACKGROUND: High expression of the actin-bundling protein fascin correlates well with histological grade and clinical stage of ovarian carcinoma. This study addresses fascin expression in advanced poorly differentiated serous ovarian cancer with respect to progression free interval (PFI) and overall survival. PATIENTS AND METHODS: Fascin and Ki-67 expression were analysed in paraffin blocks tissue sections of 56 stage III, poorly differentiated (G3) serous adenocarcinoma patients by immunohistochemistry. Fascin expression was tested for correlation with PFI and overall survival. RESULTS: Fascin expression inversely correlated with Ki-67 expression (p=0.016). Strong fascin immunoreactivity was associated with poor prognosis; patients with low fascin expression had a median survival of 36.5 months versus 32 months for high fascin expression (p=0.041), and the median PFI was 24 versus 17.5 months (p=0.034). CONCLUSION: Fascin expression is an independent prognostic factor for survival of advanced ovarian serous carcinoma, and may represent a novel therapeutic target for patients with aggressive forms of ovarian cancer.

Neutral endopeptidase inhibits prostate cancer cell migration by blocking focal adhesion kinase signaling.

Neutral endopeptidase 24.11 (NEP, CD10) is a cell-surface enzyme expressed by prostatic epithelial cells that cleaves and inactivates neuropeptides implicated in the growth of androgen-independent prostate cancer (PC). NEP substrates such as bombesin and endothelin-1 induce cell migration. We investigated the mechanisms of NEP regulation of cell migration in PC cells, including regulation of phosphorylation on tyrosine of focal adhesion kinase (FAK). Western analyses and cell migration assays revealed an inverse correlation between NEP expression and the levels of FAK phosphorylation and cell migration in PC cell lines. Constitutively expressed NEP, recombinant NEP, and induced NEP expression using a tetracycline-repressive expression system inhibited bombesin- and endothelin-1-stimulated FAK phosphorylation and cell migration. This results from NEP-induced inhibition of neuropeptide-stimulated association of FAK with cSrc protein. Expression of a mutated catalytically inactive NEP protein also resulted in partial inhibition of FAK phosphorylation and cell migration. Coimmunoprecipitation experiments show that NEP associates with tyrosine-phosphorylated Lyn kinase, which then binds the p85 subunit of phosphatidylinositol 3-kinase (PI3-K) resulting in an NEP-Lyn-PI3-K protein complex. This complex competitively blocks FAK-PI3-K interaction, suggesting that NEP protein inhibits cell migration via a protein-protein interaction independent of its catalytic function. These experiments demonstrate that NEP can inhibit FAK phosphorylation on tyrosine and PC cell migration through multiple pathways and suggest that cell migration which contributes to invasion and metastases in PC cells can be regulated by NEP.

Retinoid receptor alpha and Beta expression in serous ovarian tumors.

The expression of retinoid acid receptors alpha (RARalpha) and beta (RARbeta) and estrogen receptor alpha (ERalpha) was assessed by immunohistochemistry and Western blotting in normal ovaries, serous cystadenoma (n = 20), serous borderline (n = 14), and serous ovarian cancer (n = 47) and was correlated in cancer cases with stage, grade, progress-free survival (PFS), and survival. RARalpha was increasingly expressed in benign cystadenomas, borderline, and low-stage and advanced-stage neoplasms (p < 0.001). In stage III, G3 serous carcinoma, increased RARalpha expression was an independent prognostic factor associated with lower chemoresponse to first-line chemotherapy (taxol and carboplatin) and shorter PFS (p < 0.002).RARbeta and ERalpha expression did not correlate with RARalpha tumor characteristics or PFS and survival.

Methylation of the neutral endopeptidase gene promoter in human prostate cancers.

Neutral endopeptidase 24.11 (NEP) is a cell surface peptidase expressed by prostatic epithelial cells that cleaves and inactivates neuropeptide growth factors implicated in the growth of androgen-independent prostate cancer (PC). Decreased NEP expression in hormone-refractory metastatic PCs can result from hormonal therapies because NEP transcription is induced by androgens and down-regulated by androgen withdrawal. NEP is encoded by a gene that contains a 5' CpG island spanning a transcriptional regulatory region. In this study, we investigate whether DNA hypermethylation of the NEP promoter accompanies decreased NEP expression in PC cell lines and whether it occurs in human PC tissues in vivo. DNA isolated from PC cell lines and from normal and neoplastic human prostate tissues was restriction-digested with a methylation-sensitive restriction endonuclease and analyzed by Southern blot using a 5' sequence-specific NEP probe. Methylation-specific PCR was performed using PCR primers designed to discriminate between methylated and unmethylated alleles, and reverse transcription-PCR using NEP-specific primers was performed on cDNA extracted from PC cells treated with 5-aza-2'-deoxycytidine. Methylation of the NEP promoter was present in androgen-independent PC cell lines but not in androgen-dependent or small-cell derived PC cell lines and in 3 of 21 (14%) primary PCs from patients with androgen-dependent disease. Exposure of PC cells to the demethylating agent 5-aza-2'-deoxycytidine led to an increase in NEP transcripts in DU-145 and PC-3 cells. These data show that hypermethylation of the 5' CpG NEP island is associated with a loss of NEP expression in PC. Loss of NEP expression via hypermethylation of the NEP promoter may contribute to the development of neuropeptide-stimulated PCs.

Expression of retinoic acid receptor beta in human renal cell carcinomas correlates with sensitivity to the antiproliferative effects of 13-cis-retinoic acid.

The differentiation and growth suppressive effects of retinoic acid are mediated through retinoic acid nuclear receptors (RARs and RXRs), which are ligand-activated transcription factors. Recent data suggest that both altered and regulated expression of RARs are linked to retinoic acid response in a cell context-dependent manner. This study examined the antiproliferative effects of 13-cis-retinoic acid (cRA) on 12 renal cancer cell lines and correlated these findings with the basal and induced expression of RAR-alpha, -beta and -gamma. Eleven of 12 renal cancers that were either resistant to or only minimally inhibited by cRA did not basally express RAR-beta as determined by Northern blot analysis. In these cells, cRA treatment did not induce RAR-beta expression. In contrast, 1 of 12 cell lines (SK-RC-06) was >90% inhibited by cRA and basally expressed RARbeta. Furthermore, RAR-beta mRNA in SK-RC-06 cells was up-regulated by cRA treatment. Amplification of cDNA using PCR and RAR-beta isoform-specific primer pairs revealed that only SK-RC-06 cells expressed the RAR-beta1 isoform. Expression of RAR-alpha transcripts was abundant in all 12 cell lines examined, whereas low levels of RAR-gamma transcripts were detectable in 6 of 10 renal cancers. Expression of RAR-alpha and RAR-gamma was not affected by cRA. These data showing that the majority of renal cancer cell lines are resistant to cRA suggest that: (a) resistance to the antiproliferative action of cRA correlates with repressed RAR-beta mRNA expression; and (b) the antiproliferative effects of cRA in renal cancer cells are mediated through RAR-beta1.

Markers of androgen-independent progression of prostatic carcinoma.

Prostate cancer (PCa) remains the most common cancer and the second leading cause of cancer mortality in men in the United States. The evolution from a localized to a metastatic phenotype coupled with the progression from an androgen-dependent (AD) to an androgen-independent (AI) state leads to a universally fatal disease. Identifying the biologic characteristics associated with PCa progression is a major goal of current research efforts by different groups, in the hope to better predict the natural history of the disease in an individual patient and to design treatments based on the specific biologic behavior.

Identification and characterization of two androgen response regions in the human neutral endopeptidase gene.

Transcription of the human neutral endopeptidase 24.11 (NEP) gene is androgen regulated in prostate cancer cells. Homology search identified a sequence GTCACAaagAGTTCT similar to the ARE consensus sequence GGTACAnnnTGTTCT within the 3'-untranslated region of the NEP mRNA. A double-stranded radiolabelled oligonucleotide containing this NEP-ARE sequence formed a DNA-protein complex with nuclear proteins from LNCaP cells or COS-7 cells co-transfected with an androgen receptor (AR) expression vector, and with full-length AR synthesized by baculovirus in mobility shift assays. Unlabeled NEP-ARE or consensus ARE but not mutated NEP-ARE replaced radiolabelled NEP-ARE. Steroid-dependent enhancement of transcription was assayed by transfecting ptkCAT reporter constructs containing the NEP-ARE into CV-1/AR cells and prostate cancer cells (PC-3/AR). Enhancement of chloramphenicol acetyltransferase (CAT) activity was increased four-fold by androgen, seven-fold by dexamethasone and three-fold by progesterone in CV-1/AR cells, and the NEP-ARE bound to glucocorticoid and progesterone receptor in mobility shift assays. We next performed DNase-I footprinting analysis of the NEP promoter and identified a 23 bp sequence GGTGCGGGTCGGAGGGATGCCCA (NEP-ARR) which was protected from DNase I cleavage by nuclear extracts from COS-7 cells expressing AR. This sequence was 62.5% homologous to an androgen responsive region (PSA-ARR) identified in the promoter of the prostate specific antigen (PSA) gene. A double-stranded radiolabelled oligonucleotide containing this NEP-ARR sequence formed DNA-protein complex with AR but not GR proteins. Unlabeled NEP-ARR, PSA-ARR and NEP-ARE replaced radiolabelled NEP-ARR. Steroid-dependent enhancement of transcription assays in PC-3/AR cells revealed that the enhancement of CAT activity was increased 2.3-fold by androgen, but not by glucocorticoid or progesterone. In a thymidine kinase promoter, the NEP-ARE and NEP-ARR together stimulated a five-fold increase in promoter activity in PC cells. These data suggest that steroid regulation of the NEP gene involves at least two elements including a typical ARE which binds androgen, progesterone and glucocorticoid receptors, and a unique ARR which only binds androgen receptor.

Aminopeptidase A expression and enzymatic activity in primary human renal cancers.

The gp160 human kidney differentiation antigen is identical to human aminopeptidase A (APA), a zinc-dependent cell-surface metallopeptidase which hydrolyzes peptides with N-terminal acidic residues. GP160/APA is constitutively expressed by proximal tubule cells, the normal cellular counterpart of most renal cancers (RCs). Immunohistochemical analysis of gp160/APA protein expression in 62 primary renal tumor specimens using monoclonal antibody S4 revealed heterogeneous or homogeneous expression of gp160/APA in 46/51 (90%) of clear cell carcinomas in contrast with 1/8 (13%) papillary renal tumors and 0/3 oncocytomas (p<0.001). Analysis of five primary clear cell carcinomas for gp160 protein expression immunohistochemically and associated APA catalytic activity revealed one tumor which expressed gp160/APA protein which was enzymatically inactive. Direct sequence analysis of DNA derived from this specimen could not detect mutations within the zinc-binding domain which would eliminate gp160/APA catalytic activity. These data indicate that the gp160/APA protein is expressed by primary clear cell but not papillary RCs or oncocytomas, and that alterations in gp160/APA protein including loss of protein expression or enzymatic activity occur in 20% of primary clear cell RCs.

Expression and sequence analysis of the p21(WAF1/CIP1) gene in renal cancers.

OBJECTIVES: The p21(WAF1/CIP1) cyclin-dependent kinase inhibitor is an Mr 21,000 protein that can arrest cell growth by associating with and inhibiting cyclin-dependent kinase complexes necessary for cells to exit G1. It is a downstream effector in the p53 growth control pathway and can be transcriptionally activated by increasing levels of p53 protein. The objective of this study was to determine if there are mutations or alterations in the expression of p21 in renal cancers that could contribute to renal cancer cell growth. METHODS: Twelve renal cancer cell lines were examined for mutations in the coding region of the p21 gene using single-stranded conformation polymorphism analysis and direct deoxyribonucleic acid (DNA) sequencing. Expression of p21 was determined in all 12 cell lines by Northern analysis using a cDNA probe for p21 and Western analyses using a p21-specific antibody. RESULTS: Nucleotide base substitutions were detected in the p21 gene in two cell lines, which did not result in amino acid substitutions. P21-specific mRNA was present in 8 of 12 renal cancer cell lines, as determined by Northern analysis, although p21 transcripts could be detected by polymerase chain reaction in all 12 renal cancers. Varying levels of p21-specific protein were detected in 9 of 12 renal cancers. CONCLUSIONS: These data indicate that mutation of the p21 gene is rare in renal cancer cell lines and that the uncontrolled growth of renal cancer cells is not due to mutation of the p21 gene. However, expression studies found a wide variation in the level of p21 protein in renal cancer cells, suggesting that aberrant regulation of p21 expression may play a role in renal cancer development.

Reversal of the low-affinity neurotrophin receptor stromal-epithelial expression pattern between benign and malignant human prostate.

Reduced expression of the low-affinity p75 neurotrophin receptor (p75(NTR)) occurs in prostate epithelial cells during malignant transformation. Recent studies indicating that the p75(NTR) can transduce signals that induce apoptosis suggest that diminished p75(NTR) in transformed prostate cells may contribute to immortalization. Mutations in the transmembrane domain of the p75(NTR) gene have been associated with decreased p75(NTR) protein expression and may block the ability of the p75(NTR) to induce apoptosis. Therefore, we used Western blot to analyze prostate cancer (PC) cell lines for p75(NTR) protein expression and gene single strand conformation polymorphism (SSCP) analysis and direct DNA sequencing to analyze mutations in the transmembrane domain of the p75(NTR). p75(NTR) Protein was present in all cell lines, and mutations in the p75(NTR) gene were not detected in cDNA derived from any cell line. To define the expression pattern of p75(NTR) in PCs in vivo, we used immunohistochemical techniques to examine tissue specimens from 20 benign, 19 malignant primary, and 14 metastatic prostate specimens. In benign prostate tissues, expression of p75(NTR) was universally detected in basal cells but not in secretory epithelial or stromal cells. In both primary and metastatic PC tissues, p75(NTR) immunoreactivity could not be detected in malignant prostate epithelial cells. However, in contrast to the benign prostate, p75(NTR) protein was expressed in stromal cells surrounding malignant epithelial cells. Stromal p75(NTR) expression was present in 84% (16 of 19) primary and in 86% (12 of 14) metastatic specimens. These data show that in the benign prostate p75(NTR) protein is expressed by basal cells and not stromal cells whereas in malignant prostate p75(NTR) protein is expressed by stromal cells but not prostatic carcinoma cells. Reversal of the p75(NTR) stromal-epithelial pattern of expression between benign and malignant prostate suggests that p75(NTR) may contribute to the development and maintenance of prostate cancer.

Predictive and prognostic value of LPS-stimulated cytokine secretion in metastatic non-small cell lung cancer.

OBJECTIVE: Cancer patients usually develop malnutrition which may alter their innate immune system integrity. The aim of this study was to investigate the clinical relevance of chemokine response after lipopolysaccharide (LPS)-stimulation in metastatic non-small cell lung cancer (NSCLC). METHODS: Blood samples from metastatic NSCLC patients were incubated with LPS before the onset of systemic therapy. Interleukin (IL)-6 and IL-8 levels at baseline and after LPS-stimulation were measured and the fold change compared to baseline levels was evaluated as the stimulation index for each cytokine per patient. Results were correlated with sex, age, smoking status, histologic subtype, performance status (PS), albumin, Mini Nutritional Assessment (MNA) status and clinical outcomes. RESULTS: Totally 103 patients were evaluated. Mean (±SD) stimulation index was 37.6 (±57.8) for IL-6 and 76.7 (±133.4) for IL-8. The disease control rate after first-line chemotherapy was 44/80 (55 %) and the mean (±SD) progression-free survival (PFS) and overall survival (OS) were 4.2 (±3.9) and 9.2 (±1.1) months, respectively. MNA, PS, albumin, IL-6 and IL-8 stimulation indices were univariately associated with PFS and OS. IL-8 stimulation index emerged as an independent predictor of both PFS and OS, along with PS, and albumin levels. CONCLUSION: The extent of IL-6 and IL-8 stimulation after ex vivo induction with LPS is an important predictor of clinical outcome in metastatic NSCLC patients.

Comparative study of spatial localization of HER-2 and CEP17 signals and of HER-2/CEP17 ratios, in "thin" and "thick" tissue sections.

One presumed drawback of performing fluorescence in situ hybridization on routine tissue sections for HER-2 status evaluation in breast carcinomas is nuclear truncation. Therefore, HER-2/CEP 17 ratios were compared in routine (4 µm) vs. thicker (15 µm) tissue sections. Additionally, the distances of both signals from the nuclear center were measured by three-dimensional image analysis. HER-2 and CEP 17 signals' number increased in thick sections; however, HER-2/CEP 17 ratios were decreased. This could be attributed to a preferential increase in CEP17 signals explained by their more peripheral localization and apparent "loss" in truncated nuclei. The aforementioned decrease of HER-2 ratios did not alter HER-2 status except in cases in the equivocal category where it changed from equivocal to non-amplified. Thus, at least a subset of the equivocal cases could represent an artifactual increase of HER-2 ratio related to nuclear truncation and loss of peripheral CEP 17 signals in routine sections.

Analysis of the insertion/deletion polymorphism of the human angiotensin converting enzyme (ACE) gene in patients with renal cancer.

The angiotensin I-converting enzyme (ACE) contains an insertion/deletion (I/D) polymorphism, with the DD genotype associated with benign renal diseases. The distribution frequencies of the D and I alleles, and the DD, DI and II genotypes were determined in DNA extracted from kidney tissues of 58 renal cancer patients. The observed frequencies in patients who develop renal cancer was not significantly different than the normal population.

Expression and localization of aminopeptidase A, aminopeptidase N, and dipeptidyl peptidase IV in benign and malignant human prostate tissue.

BACKGROUND: Cell-surface peptidases are ectoenzymes which regulate the access of bioactive peptides to their receptors on cell membranes. Abnormalities in their expression and function result in altered peptide activity which contribute to neoplastic transformation and/or progression. METHODS: Expression of aminopeptidase A (APA), aminopeptidase N (APN, CD13), and dipeptidyl peptidase IV (DPP IV, CD26) was immunohistochemically examined in 20 benign and 33 malignant prostate tissues (19 primaries and 14 metastases). RESULTS: Benign prostatic stroma exhibited no APA, APN, or DPP IV immunoreactivity. Stromal cells surrounding prostatic carcinoma cells demonstrated increased APA expression in 24/33 (73%) of tumors. Benign prostatic epithelial cells strongly expressed APN and DPP IV but not APA. In contrast, APN was expressed in > 80% of tumor cells in 5/33 (15%) of specimens, heterogeneously expressed (20-80% of cells positive) in 4/33 (12%) of specimens, and minimally expressed or absent in 24/33 (73%) of tumor specimens, with a similar pattern of expression in primary and metastatic tumors. DPP IV was expressed by > 80% of tumor cells in 18/19 (95%) of primary prostate cancer specimens, but in only 7/14 (50%) of metastases. CONCLUSIONS: These data show that cell-surface peptidases are differentially expressed by normal prostatic stromal and epithelial cells, with increased expression of APA in the stroma surrounding prostate cancer cells, absent APN expression in most tumor cells, and a decreased frequency of DPP IV expression in metastatic tumors. Further studies will elucidate the biological effects of the presence or loss of cell-surface peptidases in the benign and malignant prostate.

Bone-targeted therapy for advanced androgen-independent carcinoma of the prostate: a randomised phase II trial.

BACKGROUND: Prostate carcinoma is linked to osteoblastic metastasis. We therefore investigated the value of bone-targeted consolidation therapy in selected patients with advanced androgen-independent carcinoma of the prostate. METHODS: 103 patients received induction chemotherapy, consisting of ketoconazole and doxorubicin alternating with estramustine and vinblastine. After two or three cycles of induction chemotherapy, we randomly assigned 72 patients who were clinically stable or responders to receive doxorubicin with or without strontium-89 (Sr-89) every week for 6 weeks. FINDINGS: Overall 62 of the 103 (60%, 95% CI 50-70) patients had a 50% or greater reduction in serum prostate-specific antigen concentration that was maintained for at least 8 weeks, and 43 (42%, 32-52) had an 80% or greater reduction. 49 (52%) patients with bone pain at registration had complete resolution of pain. After follow-up of 67 patients until death, the estimated median survival for all 103 patients was 17.5 months (range 0.5-37.7). For the 36 patients randomly assigned to receive Sr-89 and doxorubicin, the median survival time was 27.7 months (4.9-37.7), and for the 36 who received doxorubicin alone it was 16.8 months (4.4-34.2) (p=0.0014). The hazard ratio was 2.76 (95% CI 1.44-5.29). INTERPRETATION: Bone-targeted consolidation therapy consisting of one dose of Sr-89 plus doxorubicin once a week for 6 weeks, when given to patients with stable or responding advanced androgen-independent carcinoma of the prostate after induction chemotherapy, improved overall survival.

Alternating dose-dense chemotherapy in patients with high volume disseminated non-seminomatous germ cell tumours.

Only about half of patients with a poor-prognosis non-seminomatous germ-cell tumours can achieve a cure. The aim of this phase II study was to assess the efficacy and toxicity of a dose-dense alternating chemotherapy regimen in this subset of patients. High volume non-seminomatous germ-cell tumours was defined as follows: at least two sites of non pulmonary metastases, an extragonadal primary tumour, a serum human chorionic gonadotropin level higher than 10 000 mIU x ml(-1), or a alpha-foetoprotein level higher than 2000 mIU ml(-1). Patients who fulfilled these criteria were treated with the so-called BOP-CISCA-POMB-ACE regimen (bleomycin, vincristine, and cisplatin; cisplatin, cyclophosphamide, and doxorubicin; cisplatin, vincristine, methotrexate, and bleomycin; etoposide, dactinomycin, and cyclophosphamide) plus granulocyte colony-stimulating factor. A total of 58 patients were enrolled. Patients were retrospectively classified according to the International Germ-Cell Cancer Consensus Group classification; 38 patients (66%) had poor-prognosis disease and 19 patients (33%) had intermediate-prognosis. Patients received a median of 2.5 courses (range 0.25 to five courses) of the BOP-CISCA-POMB-ACE regimen. Forty-two patients (72.4%) had a complete response to therapy. With a median follow-up time of 31 months, the 3-year progression-free survival rate was 71% (95% confidence interval, 60 to 84%) and the 3-year overall survival rate was 73% (95% confidence interval: 62 to 86%). The 3-year PFS rates were 83% (95% confidence interval: 68 to 100%) in the intermediate-prognosis group and 65% (95% confidence interval: 51 to 82%) in the poor-prognosis group. Early side effects included mainly grade 4 haematologic toxicity (neutropaenia in 79% of patients, thrombocytopaenia in 69%, anaemia in 22%), grade 4 stomatitis (19%), and four early deaths (7% of patients), at least partially related to toxicity. The dose-dense BOP-CISCA-POMB-ACE regimen is highly active in patients with non-seminomatous germ-cell tumours classified as intermediate-prognosis or poor-prognosis according to the International Germ-Cell Cancer Consensus Group. Because outcomes with this regimen compare favourably with outcome after standard therapy, dose-dense chemotherapy should be further investigated in this subset of patients.