Use of Capillary Zone Electrophoresis Coupled to Electrospray Mass Spectrometry for the Detection and Absolute Quantitation of Peptidoglycan-Derived Peptides in Bacterial Cytoplasmic Extracts.

Peptidoglycan (PGN) is an essential structure found in the bacterial cell wall. During the bacterial life cycle, PGN continuously undergoes biosynthesis and degradation to ensure bacterial growth and division. The resulting PGN fragments (muropeptides and peptides), which are generated by the bacterial autolytic system, are usually transported into the cytoplasm to be recycled. On the other hand, PGN fragments can act as messenger molecules involved in the bacterial cell wall stress response as in the case of ß-lactamase induction in the presence of ß-lactam antibiotic or in triggering mammalian innate immune response. During their cellular life, bacteria modulate their PGN degradation by their autolytic system or their recognition by the mammalian innate immune system by chemically modifying their PGN. Among these modifications, the amidation of the ε-carboxyl group of meso-diaminopimelic acid present in the PGN peptide chain is frequently observed. Currently, the detection and quantitation of PGN-derived peptides is still challenging because of the difficulty in separating these highly hydrophilic molecules by RP-HPLC as these compounds are eluted closely after the column void volume or coeluted in many cases. Here, we report the use of capillary zone electrophoresis coupled via an electrospray-based CE-MS interface to high-resolution mass spectrometry for the quantitation of three PGN peptides of interest and their amidated derivatives in bacterial cytoplasmic extracts. The absolute quantitation of the tripeptide based on the [13C,15N] isotopically labeled standard was also performed in crude cytoplasmic extracts of bacteria grown in the presence or absence of a ß-lactam antibiotic (cephalosporin C). Despite the high complexity of the samples, the repeatability of the CZE-MS quantitation results was excellent, with relative standard deviations close to 1%. The global reproducibility of the method including biological handling was better than 20%.

Effective Temperature and Structural Rearrangement in Trapped Ion Mobility Spectrometry.

Modern ion mobility instrumentation is typically operated above the low field limit, which may activate the ions and cause structural rearrangement or fragmentation during analysis. Here, we quantitatively assessed the internal heating experienced by ions during trapped ion mobility spectrometry (TIMS) experiments. To this end, the fragmentation yields of fragile benzylpyridinium "thermometer" ions were monitored during both the accumulation and analysis steps inside the TIMS tunnel. The corresponding fragmentation rate constants were translated into a vibrational effective temperature Teff,vib. Our results demonstrate significant fragmentation upstream and inside the TIMS tunnel that corresponds to Teff,vib ≈ 510 K during both the accumulation and analysis steps. Broadening our scope to cytochrome c and lysozyme, we showed that although compact "native" folds can be preserved, the collision cross section distributions are highly sensitive to the transmission voltages and the analysis time scale. Our results are discussed with regard to Teff,vib data previously acquired on traveling-wave (TWIMS) ion mobility in the context of native mass spectrometry and conformational landscape exploration.

Multi-Enzymatic Limited Digestion: The Next-Generation Sequencing for Proteomics?

Over the past 40 years, proteomics, generically defined as the field dedicated to the identification and analysis of proteins, has tremendously gained in popularity and potency through advancements in genome sequencing, separative techniques, mass spectrometry, and bioinformatics algorithms. As a consequence, its scope of application has gradually enlarged and diversified to meet specialized topical biomedical subjects. Although the tryptic bottom-up approach is widely regarded as the gold standard for rapid screening of complex samples, its application for precise and confident mapping of protein modifications is often hindered due to partial sequence coverage, poor redundancy in indicative peptides, and lack of method flexibility. We here show how the synergic and time-limited action of a properly diluted mix of multiple enzymes can be exploited in a versatile yet straightforward protocol to alleviate present-day drawbacks. Merging bottom-up and middle-down ideologies, our results highlight broad assemblies of overlapping peptides that enable refined and reliable characterizations of proteins, including variant identification, and their carried modifications, including post-translational modifications, truncations, and cleavages. Beyond this boost in performance, our methodology also offers efficient de novo sequencing capabilities, in view of which we here present a dedicated custom assembly algorithm.

Covalent Cross-Linking as an Enabler for Structural Mass Spectrometry.

The number of studies referring to the structural elucidation of intact biomolecular systems using mass spectrometry techniques has gradually increased in the post-2000s literature topics. As part of native mass spectrometry, this domain capitalizes on the kinetic trapping of physiological folds in view of probing solution-like conformational properties of isolated molecules or complexes after their electrospray transfer to the gas phase. Despite its efficiency for a wide array of analytes, this approach is expected to be pushed to its limits when considering highly dynamic systems or when dealing with nonideal operating conditions. To circumvent these limitations, we challenge the adequacy of an original strategy based on cross-linkers to improve the gas-phase stability of isolated proteins and ensure the preservation of folded conformations when measuring with strong transmission voltages, by spraying from denaturing solvents, or trapping for extended periods of time. Tested on cytochrome c, myoglobin, and ß-lactoglobulin cross-linked using BS3, we validated the process as structurally nonintrusive in solution using far-ultraviolet circular dichroism and unraveled the preservation of folded conformations showing better resilience to denaturation on cross-linked species using ion mobility. The resulting collision cross sections were found in agreement with the native fold, and a preservation of the proteins' secondary and tertiary structures was evidenced using molecular dynamics simulations. Our results provide new insights concerning the fate of electro-sprayed cross-linked conformers in the gas phase, while constituting promising evidence for the validation of this technique as part of future structural mass spectrometry workflows.

Proteomic signatures reveal a dualistic and clinically relevant classification of anal canal carcinoma.

Aetiologically linked to HPV infection, malignancies of the anal canal have substantially increased in incidence over the last 20 years. Although most anal squamous cell carcinomas (SCCs) respond well to chemoradiotherapy, about 30% of patients experience a poor outcome, for undetermined reasons. Despite cumulative efforts for discovering independent predictors of overall survival, both nodal status and tumour size are still the only reliable factors predicting patient outcome. Recent efforts have revealed that the biology of HPV-related lesions in the cervix is strongly linked to the originally infected cell population. To address the hypothesis that topography also influences both gene expression profile and behaviour of anal (pre)neoplastic lesions, we correlated both proteomic signatures and clinicopathological features of tumours arising from two distinct portions of the anal canal: the lower part (squamous zone) and the more proximal anal transitional zone. Although microdissected cancer cells appeared indistinguishable by morphology (squamous phenotype), unsupervised clustering analysis of the whole proteome significantly highlighted the heterogeneity that exists within anal canal tumours. More importantly, two region-specific subtypes of SCC were revealed. The expression profile (sensitivity/specificity) of several selected biomarkers (keratin filaments) further confirmed the subclassification of anal (pre)cancers based on their cellular origin. Less commonly detected compared to their counterparts located in the squamous mucosa, SCCs originating in the transitional zone more frequently displayed a poor or basaloid differentiation, and were significantly correlated with reduced disease-free and overall survivals. Taken together, we present direct evidence that anal canal SCC comprises two distinct entities with different cells of origin, proteomic signatures, and survival rates. This study forms the basis for a dualistic classification of anal carcinoma, with implications for management, outcome expectations, and possibly therapy. Copyright © 2016 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

Targeting G-quadruplex structure in the human c-Kit promoter with short PNA sequences.

The cKit87up sequence d((5')AGGGAGGGCGCTGGGAGGAGGG(3')) can form a unique G-quadruplex structure in the promoter region of the human c-kit protooncogene. It provides a peculiar platform for the design of selective quadruplex-binding agents, which could potentially repress the protooncogene transcription. In this study, we examined the binding of a small library of PNA probes (P1-P5) targeting cKit87up quadruplex in either K(+)- or NH(4)(+)-containing solutions by using a combination of UV, CD, PAGE, ITC, and ESI-MS methodologies. Our results showed that (1) P1-P4 interact with the cKit87up quadruplex, and (2) the binding mode depends on the quadruplex stability. In K(+) buffer, P1-P4 bind the ckit87up quadruplex structure as "quadruplex-binding agents". The same holds for P1 in NH(4)(+) solution. On the contrary, in NH(4)(+) solution, P2-P4 overcome the quadruplex structure by forming PNA/DNA hybrid complexes, thus acting as "quadruplex openers".

Human Liver-Derived Extracellular Matrix for the Culture of Distinct Human Primary Liver Cells.

The lack of robust methods to preserve, purify and in vitro maintain the phenotype of the human liver's highly specialized parenchymal and non-parenchymal cell types importantly hampers their exploitation for the development of research and clinical applications. There is in this regard a growing interest in the use of tissue-specific extracellular matrix (ECM) to provide cells with an in vitro environment that more closely resembles that of the native tissue. In the present study, we have developed a method that allows for the isolation and downstream application of the human liver's main cell types from cryopreserved material. We also isolated and solubilized human liver ECM (HL-ECM), analyzed its peptidomic and proteomic composition by mass spectrometry and evaluated its interest for the culture of distinct primary human liver cells. Our analysis of the HL-ECM revealed proteomic diversity, type 1 collagen abundance and partial loss of integrity following solubilization. Solubilized HL-ECM was evaluated either as a coating or as a medium supplement for the culture of human primary hepatocytes, hepatic stellate cells and liver sinusoidal endothelial cells. Whereas the solubilized HL-ECM was suitable for cell culture, its impact on the phenotype and/or functionality of the human liver cells was limited. Our study provides a first detailed characterization of solubilized HL-ECM and a first report of its influence on the culture of distinct human primary liver cells.

Proteome of fraction from Tityus serrulatus venom reveals new enzymes and toxins.

BACKGROUND: Tityus serrulatus venom (Ts venom) is a complex mixture of several compounds with biotechnological and therapeutical potentials, which highlights the importance of the identification and characterization of these components. Although a considerable number of studies have been dedicated to the characterization of this complex cocktail, there is still a limitation of knowledge concerning its venom composition. Most of Ts venom studies aim to isolate and characterize their neurotoxins, which are small, basic proteins and are eluted with high buffer concentrations on cation exchange chromatography. The first and largest fraction from carboxymethyl cellulose-52 (CMC-52) chromatography of Ts venom, named fraction I (Fr I), is a mixture of proteins of high and low molecular masses, which do not interact with the cation exchange resin, being therefore a probable source of components still unknown of this venom. Thus, the present study aimed to perform the proteome study of Fraction I from Ts venom, by high resolution mass spectrometry, and its biochemical characterization, by the determination of several enzymatic activities. METHODS: Fraction I was obtained by a cation exchange chromatography using 50 mg of crude venom. This fraction was subjected to a biochemical characterization, including determination of L-amino acid oxidase, phospholipase, hyaluronidase, proteases activities and inhibition of angiotensin converting enzyme (ACE) activity. Fraction I was submitted to reduction, alkylation and digestion processes, and the tryptic digested peptides obtained were analyzed in a Q-Exactive Orbitrap mass spectrometer. Data analysis was performed by PEAKS 8.5 software against NCBI database. RESULTS: Fraction I exhibits proteolytic activity and it was able to inhibit ACE activity. Its proteome analysis identified 8 different classes of venom components, among them: neurotoxins (48%), metalloproteinases (21%), hypotensive peptides (11%), cysteine-rich venom protein (9%), antimicrobial peptides (AMP), phospholipases and other enzymes (chymotrypsin and lysozymes) (3%) and phosphodiesterases (2%). CONCLUSIONS: The combination of a proteomic and biochemical characterization strategies leads us to identify new components in the T. serrulatus scorpion venom. The proteome of venom´s fraction can provide valuable direction in the obtainment of components in their native forms in order to perform a preliminary characterization and, consequently, to promote advances in biological discoveries in toxinology.

Proteome of fraction from Tityus serrulatus venom reveals new enzymes and toxins

Tityus serrulatus venom (Ts venom) is a complex mixture of several compounds with biotechnological and therapeutical potentials, which highlights the importance of the identification and characterization of these components. Although a considerable number of studies have been dedicated to the characterization of this complex cocktail, there is still a limitation of knowledge concerning its venom composition. Most of Ts venom studies aim to isolate and characterize their neurotoxins, which are small, basic proteins and are eluted with high buffer concentrations on cation exchange chromatography. The first and largest fraction from carboxymethyl cellulose-52 (CMC-52) chromatography of Ts venom, named fraction I (Fr I), is a mixture of proteins of high and low molecular masses, which do not interact with the cation exchange resin, being therefore a probable source of components still unknown of this venom. Thus, the present study aimed to perform the proteome study of Fraction I from Ts venom, by high resolution mass spectrometry, and its biochemical characterization, by the determination of several enzymatic activities. Methods: Fraction I was obtained by a cation exchange chromatography using 50 mg of crude venom. This fraction was subjected to a biochemical characterization, including determination of L-amino acid oxidase, phospholipase, hyaluronidase, proteases activities and inhibition of angiotensin converting enzyme (ACE) activity. Fraction I was submitted to reduction, alkylation and digestion processes, and the tryptic digested peptides obtained were analyzed in a Q-Exactive Orbitrap mass spectrometer. Data analysis was performed by PEAKS 8.5 software against NCBI database. Results: Fraction I exhibits proteolytic activity and it was able to inhibit ACE activity. Its proteome analysis identified 8 different classes of venom components, among them: neurotoxins (48%), metalloproteinases (21%), hypotensive peptides (11%), cysteine-rich venom protein (9%), antimicrobial peptides (AMP), phospholipases and other enzymes (chymotrypsin and lysozymes) (3%) and phosphodiesterases (2%). Conclusions: The combination of a proteomic and biochemical characterization strategies leads us to identify new components in the T. serrulatus scorpion venom. The proteome of venom´s fraction can provide valuable direction in the obtainment of components in their native forms in order to perform a preliminary characterization and, consequently, to promote advances in biological discoveries in toxinology.(AU)

Peptidomic investigation of Neoponera villosa venom by high-resolution mass spectrometry: seasonal and nesting habitat variations

Advancements in proteomics, including the technological improvement in instrumentation, have turned mass spectrometry into an indispensable tool in the study of venoms and toxins. In addition, the advance of nanoscale liquid chromatography coupled to nanoelectrospray mass spectrometry allows, due to its high sensitivity, the study of venoms from species previously left aside, such as ants. Ant venoms are a complex mixture of compounds used for defense, predation or communication purposes. The venom from Neoponera ants, a genus restricted to Neotropical regions, is known to have cytolytic, hemolytic, antimicrobial and insecticidal activities. Moreover, venoms from several Neoponera species have been compared and differences in their toxicity related to nesting habitat variation were reported. Therefore, the present study aimed to perform a deep peptidomic analysis of Neoponera villosa venom and a comparison of seasonal and nesting habitat variations using high-resolution mass spectrometry. Methods: Specimens of N. villosa ants were captured in Panga Natural Reserve (Uberlândia, MG, Brazil) from arboreal and ground-dwelling nests during summer and winter time. The venom glands were dissected, pooled and disrupted by ultra-sonic waves. The venom collected from different habitats (arboreal and ground-dwelling) and different seasons (summer and winter) was injected into a nanoACQUITY ULPC hyphened to a Q-Exactive Orbitrap mass spectrometer. The raw data were analyzed using PEAKS 7. Results: The results showed a molecular diversity of more than 500 peptides among these venoms, mostly in the mass range of 800-4000 Da. Mutations and post-translational modifications were described and differences among the venoms were observed. Part of the peptides matched with ponericins, a well-known antimicrobial peptide family. In addition, smaller fragments related to ponericins were also identified, suggesting that this class of antimicrobial peptide might undergo enzymatic cleavages. Conclusion: There are substantial differences among the venom of N. villosa ants collected in different seasons and from different nest habitats. The venom composition is affected by climate changes that influence prey availability and predator presence. Clearly, nano-LC-MS boosted the knowledge about ant venom, a rich source of unexplored and promising bioactive compounds.(AU)

Peptidomic investigation of Neoponera villosa venom by high-resolution mass spectrometry: seasonal and nesting habitat variations

Background: Advancements in proteomics, including the technological improvement in instrumentation, have turned mass spectrometry into an indispensable tool in the study of venoms and toxins. In addition, the advance of nanoscale liquid chromatography coupled to nanoelectrospray mass spectrometry allows, due to its high sensitivity, the study of venoms from species previously left aside, such as ants. Ant venoms are a complex mixture of compounds used for defense, predation or communication purposes. The venom from Neoponera ants, a genus restricted to Neotropical regions, is known to have cytolytic, hemolytic, antimicrobial and insecticidal activities. Moreover, venoms from several Neoponera species have been compared and differences in their toxicity related to nesting habitat variation were reported. Therefore, the present study aimed to perform a deep peptidomic analysis of Neoponera villosa venom and a comparison of seasonal and nesting habitat variations using high-resolution mass spectrometry. Methods: Specimens of N. villosa ants were captured in Panga Natural Reserve (Uberlândia, MG, Brazil) from arboreal and ground-dwelling nests during summer and winter time. The venom glands were dissected, pooled and disrupted by ultra-sonic waves. The venom collected from different habitats (arboreal and ground-dwelling) and different seasons (summer and winter) was injected into a nanoACQUITY ULPC hyphened to a Q-Exactive Orbitrap mass spectrometer. The raw data were analyzed using PEAKS 7. Results: The results showed a molecular diversity of more than 500 peptides among these venoms, mostly in the mass range of 8004000 Da. Mutations and post-translational modifications were described and differences among the venoms were observed. Part of the peptides matched with ponericins, a well-known antimicrobial peptide family...

Advantages and drawbacks of nanospray for studying noncovalent protein-DNA complexes by mass spectrometry.

The noncovalent complexes between the BlaI protein dimer (wild-type and GM2 mutant) and its double-stranded DNA operator were studied by nanospray mass spectrometry and tandem mass spectrometry (MS/MS). Reproducibility problems in the nanospray single-stage mass spectra are emphasized. The relative intensities depend greatly on the shape of the capillary tip and on the capillary-cone distance. This results in difficulties in assessing the relative stabilities of the complexes simply from MS(1) spectra of protein-DNA mixtures. Competition experiments using MS/MS are a better approach to determine relative binding affinities. A competition between histidine-tagged BlaIWT (BlaIWTHis) and the GM2 mutant revealed that the two proteins have similar affinities for the DNA operator, and that they co-dimerize to form heterocomplexes. The low sample consumption of nanospray allows MS/MS spectra to be recorded at different collision energies for different charge states with 1 microL of sample. The MS/MS experiments on the dimers reveal that the GM2 dimer is more kinetically stable in the gas phase than the wild-type dimer. The MS/MS experiments on the complexes shows that the two proteins require the same collision energy to dissociate from the complex. This indicates that the rate-limiting step in the monomer loss from the protein-DNA complex arises from the breaking of the protein-DNA interface rather than the protein-protein interface. The dissociation of the protein-DNA complex proceeds by the loss of a highly charged monomer (carrying about two-thirds of the total charge and one-third of the total mass). MS/MS experiments on a heterocomplex also show that the two proteins BlaIWTHis and BlaIGM2 have slightly different charge distributions in the fragments. This emphasizes the need for better understanding the dissociation mechanisms of biomolecular complexes.

Triplex and quadruplex DNA structures studied by electrospray mass spectrometry.

DNA triplex and quadruplex structures have been successfully detected by electrospray ionization mass spectrometry (ESI-MS). Circular dichroism and UV-melting experiments show that these structures are stable in 150 mM ammonium acetate at pH 7 for the quadruplexes and pH 5.5 for the triplexes. The studied quadruplexes were the tetramer [d(TGGGGT)](4), the dimer [d(GGGGTTTTGGGG)](2), and the intramolecular folded strand dGGG(TTAGGG)(3), which is an analog of the human telomeric sequence. The absence of sodium contamination allowed demonstration of the specific inclusion of n - 1 ammonium cations in the quadruplex structures, where n is the number of consecutive G-tetrads. We also detected the complexes between the quadruplexes and the quadruplex-specific drug mesoporphyrin IX. MS/MS spectra of [d(TGGGGT)](4) and the complex with the drug are also reported. As the drug does not displace the ammonium cations, one can conclude that the drug binds at the exterior of the tetrads, and not between them. For the triplex structure the ESI-MS spectra show the detection of the specific triplex, at m/z values typically higher than those typically observed for duplex species. Upon MS/MS the antigene strand, which is bound into the major groove of the duplex, separates from the triplex. This is the same dissociation pathway as in solution. To our knowledge this is the first report of a triplex DNA structure by electrospray mass spectrometry.

Rapid identification of environmental bacterial strains by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry.

In recent years, various mass spectrometry procedures have been developed for bacterial identification. The accuracy and speed with which data can be obtained by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOFMS) could make this a powerful tool for environmental monitoring. However, minor variations in the sample preparation can influence the mass spectra significantly. Therefore, the first objectives of this study were the adjustment and the optimization of experimental parameters allowing a rapid identification of whole bacterial cells without laborious sample preparation. The tested experimental parameters were matrix, extraction solvent, salt content, deposition method, culture medium and incubation time. This standardized protocol was applied to identify reference and environmental bacterial strains of Escherichia coli, Salmonella and Acinetobacter. The environmental bacterial strains were isolated from sewage sludge using an original microextraction procedure based on repeated sonications and enzymatic treatments. The bacterial identification was realized by the observation of the respective genus-, species- and strain-specific biomarkers. This bacterial taxonomy could be completed within one hour, with minimal sample preparation, provided that sufficient bacteria had been collected prior to MALDI-TOF analysis.

PTV-LV-GC/MS/MS as screening and complementary method to HRMS for the monitoring of dioxin levels in food and feed.

Recent developments in trapping efficiency inside ion trap mass spectrometer permitted to lower instrument detection limit (IDL). An IDL of 200fgmul(-1) injected with a signal-to-noise ratio of 5:1 for tetrachlorodibenzo-p-dioxin (TCDD) was obtained by gas chromatography coupled to a quadrupole ion storage mass spectrometer in tandem mode (GC/MS/MS). Coupling large volume programmable temperature vaporizer (PTV-LV) injection to GC/MS/MS provides an alternative and complementary method to classical splitless-GC injection connected to high-resolution mass spectrometry (splitless-GC/HRMS) method for dioxin monitoring in food and feed. An injection volume of 10mul was found to be the best compromise between the sensitivity requirements and the robustness required for a high throughput method. PTV-LV-GC/MS/MS and Splitless-GC/HRMS were compared by performing analysis on five different matrices such as beef fat, yolk eggs, milk powder, animal feed and serum samples covering a concentration range of two orders of magnitude (i.e. 0.2-25ng WHO-TEQkg(-1)). An analysis of variance (ANOVA) was carried out. Fisher tests pointed out that the method effect for all the 2,3,7,8 congeners was not significant, indicating that the null hypothesis (H(0): mu(1)=mu(2)=...=mu(n)) was not rejected. Moreover, the interaction effects between methods and matrices were not significant for most of the 2,3,7,8 congeners. However, three congeners (2,3,7,8-TCDF; 1,2,3,4,7,8-HxCDD and 1,2,3,4,6,7,8-HpCDD) were characterized by P-values lower than the significance level (alpha=0.05). In toxic equivalence (TEQ), the study showed that no significant bias was observed between the two methods. Consequently, PTV-LV-GC/MS/MS is an attractive technique and can be used as a cost effective complementary method to HRMS for dioxin levels monitoring in food and feed.

A strategy to identify specific biomarkers related to the effects of a PCDD/F mixture on the immune system of marine mammals.

The cell lines chosen have demonstrated a positive response in terms of cell proliferation and associated modifications in proteins content, evaluated through DNA and proteins synthesis, at environmentally relevant dose of dioxins, brought by a typical environmental PCDD/F mixture. The response is time and species dependent. After completion of the identification of proteins affected by the intoxication, we will identify a set of specific proteins whose expression is correlated to the dioxin dose and submit the cell culture to the treatment with a single chemical as well as with mixtures. We hope that this will allow us to construct and validate a set of protein biomarkers of exposure to pollutants that will show a predictive aspect for unknown chemicals. The quantitative analysis of the set of biomarkers can then be a more specific bioassay and an alternative to physico-chemical or other already established bioanalytical methods for screening purposes.