RESUMEN
We assessed the efficacy of dish detergent in removing Neisseria gonorrhoeae, HIV-1, herpes simplex virus type 2 and Chlamydia trachomatis organisms from the surface of inoculated female condoms. The reductions achieved in organism counts with dish detergent were compared with those for household bleach and water. New (out-of-package) and pre-washed/re-lubricated female condoms were used. Dish detergent was as efficacious as bleach in reducing organism counts from the surface of inoculated female condoms. Both bleach and dish detergent performed better than water, although >3 log(10) reductions were achieved with water alone. There was little difference in organism reduction between new and pre-washed condoms. Furthermore, 30 seconds of mechanical agitation (washing) had minimal added impact on organism removal. Reduction in organism counts with water alone suggests that dilution effect may have been as important in organism removal as the microbicidal properties of the detergent.
Asunto(s)
Condones Femeninos/microbiología , Detergentes , Enfermedades Virales de Transmisión Sexual/prevención & control , Enfermedades de Transmisión Sexual/prevención & control , Hipoclorito de Sodio , Infecciones Bacterianas/prevención & control , Chlamydia trachomatis/efectos de los fármacos , Condones Femeninos/virología , VIH-1/efectos de los fármacos , Herpesvirus Humano 2/efectos de los fármacos , Enfermedades Virales de Transmisión Sexual/microbiologíaRESUMEN
We have recently described the existence of a chaperone activity for the dimeric peptidyl-prolyl cis/trans isomerase FkpA from the periplasm of Escherichia coli that is independent of its isomerase activity. We have now investigated the molecular mechanism of these two activities in vitro in greater detail. The isomerase activity with a protein substrate (RNaseT1) is characterized by a 100-fold higher k(cat)/K(M) value than with a short tetrapeptide substrate. This enhanced activity with a protein is due to an increased affinity towards the protein substrate mediated by a polypeptide-binding site that is distinct from the active site. The chaperone activity is also mediated by interaction of folding and unfolding intermediates with a binding site that is most likely identical to the polypeptide-binding site which enhances catalysis. Both activities are thus mechanistically related, being based on the transient interaction with this high-affinity polypeptide-binding site. Only the isomerase activity, but not the chaperone activity, with the substrate citrate synthase can be inhibited by FK520. Experiments with the isolated domains of FkpA imply that both the isomerase and the chaperone site are located on the highly conserved FKBP domain. The additional amino-terminal domain mediates the dimerization and thus places the two active sites of the FKBP domains in juxtaposition, such that they can simultaneously interact with a protein, and this is required for full catalytic activity.
Asunto(s)
Escherichia coli/enzimología , Inmunofilinas/metabolismo , Proteínas de la Membrana/metabolismo , Chaperonas Moleculares/metabolismo , Isomerasa de Peptidilprolil/metabolismo , Tacrolimus/análogos & derivados , Sitios de Unión , Unión Competitiva , Catálisis , Citrato (si)-Sintasa/química , Citrato (si)-Sintasa/metabolismo , Secuencia Conservada , Dimerización , Proteínas de Escherichia coli , Haemophilus influenzae/enzimología , Inmunofilinas/antagonistas & inhibidores , Inmunofilinas/química , Isomerismo , Cinética , Proteínas de la Membrana/antagonistas & inhibidores , Proteínas de la Membrana/química , Modelos Biológicos , Modelos Moleculares , Chaperonas Moleculares/química , Isomerasa de Peptidilprolil/antagonistas & inhibidores , Isomerasa de Peptidilprolil/química , Unión Proteica , Desnaturalización Proteica , Pliegue de Proteína , Renaturación de Proteína , Estructura Cuaternaria de Proteína , Estructura Terciaria de Proteína , Ribonucleasa T1/química , Ribonucleasa T1/metabolismo , Tacrolimus/metabolismo , Tacrolimus/farmacología , Proteína 1A de Unión a Tacrolimus/química , Proteína 1A de Unión a Tacrolimus/metabolismo , TermodinámicaRESUMEN
Fluorescence measurements and H/2H exchange experiments monitored by mass spectrometry have been applied to investigate the influence of the conserved disulfide bridges on the folding behavior and in vitro aggregation properties of the scFv fragment of the antibody hu4D5-8. A set of four proteins, carrying none, one, or both of the disulfide bridges have been compared regarding their stabilities, folding kinetics and tendency to aggregate. The results show that refolding of all four scFvs is ultimately limited by a slow proline isomerization in the VLdomain, since the native cis -conformation of proline L95 seems to be a prerequisite for formation of the native interface. Starting from short-term denatured protein, with the proline residues in their native conformation, a kinetically trapped intermediate is populated depending on the conditions, whose rate of conversion is slower than that of the fast-folding molecules. According to deuteron protection patterns determined by mass spectrometry, those domains retaining the disulfide bridge are able to form stable native-like structure, independent of native interface formation. The disulfide-free domains, in contrast, require the native interface for sufficient stabilization. The resistance of the scFvs towards aggregation seems to be critically dependent on the presence of the disulfide bridge in the VHdomain, and thus on the ability of the VHdomain to form stable structure prior to interaction with the VLdomain. The presence of a stable VLdomain in combination with a disulfide-free VHdomain appears to further promote aggregation, indicating the involvement of structured domains in the aggregates.
Asunto(s)
Secuencia Conservada/genética , Disulfuros/metabolismo , Fragmentos de Inmunoglobulinas/química , Región Variable de Inmunoglobulina/química , Mutación , Pliegue de Proteína , Deuterio/metabolismo , Disulfuros/química , Guanidina , Humanos , Hidrógeno/metabolismo , Fragmentos de Inmunoglobulinas/genética , Fragmentos de Inmunoglobulinas/aislamiento & purificación , Fragmentos de Inmunoglobulinas/metabolismo , Región Variable de Inmunoglobulina/genética , Región Variable de Inmunoglobulina/aislamiento & purificación , Región Variable de Inmunoglobulina/metabolismo , Isomerismo , Cinética , Espectrometría de Masas , Prolina/química , Prolina/metabolismo , Conformación Proteica , Desnaturalización Proteica , Solubilidad , Espectrometría de Fluorescencia , TermodinámicaRESUMEN
Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms, respectively, in tomato exhibited defined differences in the RNase T1 and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the 'severe' strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.
Asunto(s)
Enfermedades de las Plantas , Virus de Plantas/análisis , ARN Viral/análisis , Viroides/análisis , Secuencia de Bases , Endonucleasas , Conformación de Ácido Nucleico , Ribonucleasa T1 , Ribonucleasa Pancreática , RibonucleasasRESUMEN
Out of the 140 adult patients with chronic subdural haematoma 17% were female. An overall relationship of CSH cases to the total number of subdural haematomas was 27%. In only 78% of the CSH could a history of trauma be traced. Most of the patients were between the ages of 50 and 70. The main symptoms were headache, abnormal psychic behaviour and paresis. Alcoholism and anticoagulant therapy accounted for only 13% and 3% respectively. Recurrent bleeding occurred in 25% of cases not only after craniotomy but also after burr-holes. The total mortality was 15%. With regard to diagnosis and the indications for operation, angiography which was previously used has, since 1977, been superseded by the CT-scan.
Asunto(s)
Hematoma Subdural/diagnóstico por imagen , Adolescente , Adulto , Anciano , Lesiones Encefálicas/complicaciones , Angiografía Cerebral , Niño , Enfermedad Crónica , Femenino , Cefalea/etiología , Hematoma Subdural/etiología , Humanos , Masculino , Persona de Mediana Edad , Parálisis/etiología , Recurrencia , Tomografía Computarizada por Rayos XRESUMEN
We recently identified FkpA by selecting for the increased yield of antibody single-chain Fv (scFv) fragments in phage display, even of those not containing cis-prolines. We have now investigated the properties of FkpA in vitro. The peptidylprolyl cis-trans-isomerase activity of FkpA was found to be among the highest of any such enzyme with a protein substrate, yet FkpA is not able to enhance the proline-limited refolding rate of the disulfide-free hu4D5-8 scFv fragment, probably due to inaccessibility of Pro-L95. Nevertheless, the yield of the soluble and functional scFv fragment was dramatically increased in vitro in the presence of FkpA. Similar effects were observed for an scFv fragment devoid of cis-prolines. We are thus forced to conclude that the observed folding-assisting function is independent of the isomerase activity of the protein. The beneficial effect of FkpA was found to be due to two components. First, FkpA interacts with early folding intermediates, thus preventing their aggregation. Additionally, it has the ability to reactivate inactive protein, possibly also by binding to a partially unfolded species that may exist in equilibrium with the aggregated form, which may thus be released on a productive pathway. These in vitro measurements therefore fully reflect the in vivo results from periplasmic overexpression of FkpA.
Asunto(s)
Escherichia coli/enzimología , Inmunofilinas/metabolismo , Proteínas de la Membrana/metabolismo , Chaperonas Moleculares/metabolismo , Isomerasa de Peptidilprolil , Periplasma/enzimología , Estabilidad de Enzimas , Proteínas de Escherichia coli , Fragmentos de Inmunoglobulinas/inmunología , Fragmentos de Inmunoglobulinas/metabolismo , Inmunofilinas/química , Cinética , Proteínas de la Membrana/química , Prolina/metabolismo , Pliegue de Proteína , TermodinámicaRESUMEN
From tomato leaf tissue we sequenced and characterized a 7S RNA which consists of 299 nucleotides with either two or three additional uridine nucleotides at its 3'-terminus. About 56% of the nucleotides of this higher plant 7S RNA are in nearly identical positions as those of the human 7SL RNA which is an integral component of the signal recognition particle (SRP) that mediates protein translocation. Computer modelling and digestion studies with nucleases led to a secondary structure model for tomato 7S RNA, the overall shape of which is very similar to that of the human 7SL (SRP) RNA. This structural similarity strongly suggests that tomato 7S RNA is actually an SRP RNA and an integral part of the plant SRP, and that the protein translocation system of higher plants is very similar to the one operating in mammalian cells. Tomato SRP RNA contains a stretch of 36-53 nucleotides which exhibit a high degree of sequence complementarity to five viroid 'species' that cause disease in tomato. In the case of potato spindle tuber viroid and citrus exocortis viroid this complementarity spans the lower strand of the region, the nucleotides of which are known to modulate virulence. This extensive sequence complementarity could lead to a thermodynamically favoured base-pairing in vivo which renders the tomato SRP RNA a possible host target with which viroids could interact and thus incite disease.
Asunto(s)
Plantas/metabolismo , ARN/metabolismo , Ribonucleoproteínas/metabolismo , Secuencia de Bases , Modelos Moleculares , Datos de Secuencia Molecular , Conformación de Ácido Nucleico , Homología de Secuencia de Ácido Nucleico , Partícula de Reconocimiento de Señal , Viroides/metabolismoRESUMEN
A new viroid which does not seem to produce any symptoms of disease, and is therefore tentatively named hop latent viroid (HLV) was found to occur worldwide in hops. HLV proved to be infectious when mechanically inoculated onto viroid- and virus-free hops. The viroid nature of HLV was also substantiated by sequence analysis which revealed that HLV is a circular RNA consisting of 256 nucleotides, that can be arranged into the viroid-specific, rod-like secondary structure. HLV also contains the central conserved region typical for most of the presently known viroids. However HLV does not contain the viroid-specific oligo(A) stretch in the upper left part of its rod-like molecule. Because of this feature and a sequence similarity with the prototypes of the other viroid groups below 55%, HLV can be regarded as the first member of a new viroid group.
Asunto(s)
Virus de Plantas/genética , ARN Viral/genética , Viroides/genética , Secuencia de Bases , ADN Viral/genética , Datos de Secuencia Molecular , Conformación de Ácido Nucleico , Hibridación de Ácido Nucleico , Virus de Plantas/aislamiento & purificación , ARN Viral/aislamiento & purificación , ADN Polimerasa Dirigida por ARN , Viroides/aislamiento & purificaciónRESUMEN
The outcome of anti-emetic therapy (AT) to women with gynaecological cancer receiving chemotherapy, in total 552 courses, was registered for a 1-year period. A quality improvement (QI) programme was established, based on three standardized AT regimens. Evaluation and documentation of AT effects were performed by the patients themselves, reporting the number of emetic episodes and degree of nausea for 5 days following the chemotherapeutic treatment. The results were visualized in monthly graphic displays. Various factors which might contribute to the achieved improvements are discussed. In conclusion, the continuous QI process seems to be a suitable method in guiding direct patient care.
Asunto(s)
Antieméticos/administración & dosificación , Antineoplásicos/efectos adversos , Neoplasias de los Genitales Femeninos/tratamiento farmacológico , Servicio de Oncología en Hospital/normas , Garantía de la Calidad de Atención de Salud , Vómitos/tratamiento farmacológico , Antieméticos/efectos adversos , Antineoplásicos/uso terapéutico , Relación Dosis-Respuesta a Droga , Esquema de Medicación , Quimioterapia Combinada , Femenino , Humanos , Estudios Prospectivos , Resultado del Tratamiento , Vómitos/inducido químicamenteRESUMEN
Biosynthesis of the phytotoxin, tentoxin, its regulation and the enzymic synthesis steps were studied in vivo and in vitro. The physiology of biosynthesis of tentoxin in vivo was investigated by using sections of mycelial mats incubated in buffer. Differentiated mycelia could be studied under defined conditions. The de novo synthesis of tentoxin was measured by incorporation of [U-14C]leucine into tentoxin. The investigation system was stable for 10 h. Biosynthesis and the growth of biomass started before day 5 of culture, with the maximum between days 9 and 12. After this, biosynthesis quickly declined. pH values about 7 were optimal, and pH values above and below this led to an increased release of tentoxin stored in the cells. The formation of tentoxin by older mycelia was not regulated by acetate, phosphate or glucose, which was not utilized. Precursor amino acids, applied at the start of the culture, slightly activated the synthesis of tentoxin. Older mycelia were inhibited. Substances from the host plant (Brassica chinensis) reduced the de novo synthesis of tentoxin. Enzyme separation studies suggested that biosynthesis of tentoxin involves a multienzyme (> or = 400 kDa), which is a polyfunctional protein without subunits. Experiments suggested that the synthetase contains active SH-groups and an integrated activity of methyltransferase. The precursor amino acids are activated by ATP and bound at the enzyme. N-Methylation occurs with the enzyme-bound amino acids or during the elongation of the growing peptide chain. Methionine is the primary donor of the methyl groups, but the immediate methylation reaction needs 5-adenosyl methionine (SAM). The methylation is essential for the continuation of biosynthesis. The elongation proceeds either stepwise from glycine by binding alanine/methylalanine, phenylalanine/methylphenylalanine and leucine or by formation and linkage of two dipeptides glycine-alanine/methylalanine and phenylalanine/methylphenylalanine-leucine. At the end of this process dihydrotentoxin, the direct precursor of tentoxin, is released from the synthetase probably by cyclization. Independent of this first enzyme, dihydrotentoxin is transformed into tentoxin. This last reaction step is reversible. The rate of transformation of dihydrotentoxin to tentoxin is higher, but in this direction the native turnover is relatively low.(ABSTRACT TRUNCATED AT 400 WORDS)
Asunto(s)
Alternaria/metabolismo , Micotoxinas/biosíntesis , Péptidos Cíclicos/biosíntesis , Adenosina Trifosfato/metabolismo , Alternaria/efectos de los fármacos , Alternaria/crecimiento & desarrollo , Secuencia de Aminoácidos , Aminoácidos/metabolismo , Ditiotreitol/farmacología , Concentración de Iones de Hidrógeno , Datos de Secuencia Molecular , Peso Molecular , Complejos Multienzimáticos/química , Complejos Multienzimáticos/metabolismo , Micotoxinas/química , Péptidos Cíclicos/químicaRESUMEN
The response rate and survival obtained with the combined regimen of bleomycin, ifosfamide, and cis-platinum (BIP) were analyzed in a series of 24 patients with recurrent cervical carcinoma in previously irradiated area. The doses were 30 mg, 5000 mg/m2, and 50 mg/m2, respectively. Mesna was given simultaneously (6000 mg/m2). None of the patients were treated with prior chemotherapy. All the patients were evaluable for toxicity and 20 for response. The median survival in patients evaluable for response was 9 months. No complete and 3 partial responses (15%) were observed, with a median duration of survival of 10+ months (range, 9(+) -16). Stable disease was observed in 8 patients (40%) with a median duration of survival of 9.5 months (range, 6(+) -20). Progressive disease was observed in 9 patients (45%) with a median duration of survival of 6 months (range, 3-25+). Four patients received one course only because of toxicity. One of these patients died at home 6 days after the first course, probably because of dehydration. The main toxicities were myelosuppression, renal impairment, alopecia, and nausea/vomiting. In conclusion, the BIP regimen has considerable toxicity. We were not able to confirm the high response rates earlier reported in pelvic recurrence inside a previously irradiated area. Emphasis in future studies must continue to be placed on the development of more active single agents and combinations.
Asunto(s)
Protocolos de Quimioterapia Combinada Antineoplásica/uso terapéutico , Recurrencia Local de Neoplasia/tratamiento farmacológico , Neoplasias del Cuello Uterino/tratamiento farmacológico , Protocolos de Quimioterapia Combinada Antineoplásica/efectos adversos , Bleomicina/administración & dosificación , Bleomicina/efectos adversos , Cisplatino/administración & dosificación , Cisplatino/efectos adversos , Esquema de Medicación , Femenino , Humanos , Ifosfamida/administración & dosificación , Ifosfamida/efectos adversos , Dosificación Radioterapéutica , Tasa de Supervivencia , Neoplasias del Cuello Uterino/mortalidad , Neoplasias del Cuello Uterino/radioterapiaRESUMEN
The complete nucleotide sequence of genome segment S4 of rice ragged stunt oryzavirus (RRSV, Thai-isolate) was determined. The 3823 bp sequence contains two large open reading frames (ORFs). ORF1, spanning nucleotides 12 to 3776, is capable of encoding a protein of M(r) 141,380 (P4a). The P4a amino acid sequence predicted from the nucleotide sequence contains sequence motifs conserved in RNA-dependent RNA polymerases (RDRPs). When compared for evolutionary relationships with RDRPs of other reoviruses using the amino acid sequences around the conserved GDD motif, P4a was shown to be more related to Nilaparvata lugens reovirus and reovirus serotype 3 than to rice dwarf phytoreovirus, bovine rotavirus or bluetongue virus. The ORF2, spanning nucleotides 491 to 1468, is out of frame with ORF1 and is capable of encoding a protein of 36,920 (P4b). Coupled in vitro transcription-translation from cloned ORF2 in wheat germ extract confirmed the existence of ORF2 but in vivo production and possible function of P4b is yet to be determined.
Asunto(s)
Genoma Viral , Oryza/virología , ARN Polimerasa Dependiente del ARN/genética , Reoviridae/genética , Proteínas Virales/genética , Secuencia de Aminoácidos , Secuencia de Bases , Datos de Secuencia Molecular , Sistemas de Lectura Abierta , ARN Polimerasa Dependiente del ARN/química , Proteínas Virales/químicaRESUMEN
The nucleotide sequences of genome segments S7 and S10 of a Thai-isolate of rice ragged stunt virus (RRSV) were determined. The 1938 bp S7 sequence contains a single large open reading frame (ORF) spanning nucleotides 20 to 1843 that is predicted to encode a protein of M(r) 68,025. The 1,162 bp S10 sequence has a major ORF spanning nucleotides 142 to 1,032 that is predicted to encode a protein of M(r) 32,364. This S10 ORF is preceded by a small ORF (nt 20-55) which is probably a minicistron. Coupled in vitro transcription-translation from the two major ORFs gave protein products of the expected sizes. However, no protein was visualised from S10 when the small ORF sequence was included. Proteins were expressed in Escherichia coli from the full length ORF of S7 (P7) and from a segment of the S10 ORF (P10) fused to the ORF of glutathione S-transferase (GST). Neither fusion protein was recognised by polyclonal antibodies raised against RRSV particles. Furthermore, polyclonal antibodies raised against GST-P7 fusion protein did not recognise any virion structural polypeptides. These data strongly suggest that the proteins P7 and P10 do not form part of RRSV particle. This is further supported by observed sequence homology (though very weak) of predicted RRSV P7 and P10 with those of rice dwarf virus (RDV) non-structural proteins Pns6 and Pns9, respectively.
Asunto(s)
Oryza/virología , Reoviridae/genética , Proteínas no Estructurales Virales/genética , Secuencia de Aminoácidos , Secuencia de Bases , Genoma Viral , Datos de Secuencia MolecularRESUMEN
The complete nucleotide sequence of citrus exocortis viroid (CEV, propagated in Gymura) and chrysanthemum stunt viroid (CSV, propagated in Cineraria) has been established, using labelling in vitro and direct RNA sequencing methods and a new screening procedure for the rapid selection of suitable RNA fragments from limited digests. The covalently closed circular single-stranded viroid RNAs consist of 371 (CEV) and 354 (CSV) nucleotides, respectively. As previously shown for potato spindle tuber viroid (PSTV, 359 nucleotides), CEV and CSV also contain a long polypurine sequence. Maximal base-pairing of the established CEV and CSV sequences results in an extended rod-like secondary structure similar to that previously established for PSTV and as predicted from detailed physicochemical studies of all these viroids. Although the three viroid species sequenced to date differ in size and nucleotide sequence, there is 60--73% homology between them. As PSTV, CEV and CSV also contain conserved complementary sequences which are separated from each other in the native secondary structure. We postulate that the resulting 'secondary' hairpins, being formed and observed in vitro during the complex process of thermal denaturation of viroid RNA, must have a vital, although yet unknown, function in vivo. The possible origin and function of viroids are discussed on the basis of the characteristic structural features and of a considerable homology with U1a RNA found for a region highly conserved in the three viroids.