Transcriptomic underpinnings of high and low mirror aggression zebrafish behaviours.

BACKGROUND: Aggression is an adaptive behaviour that animals use to protect offspring, defend themselves and obtain resources. Zebrafish, like many other animals, are not able to recognize themselves in the mirror and typically respond to their own reflection with aggression. However, mirror aggression is not an all-or-nothing phenomenon, with some individuals displaying high levels of aggression against their mirror image, while others show none at all. In the current work, we have investigated the genetic basis of mirror aggression by using a classic forward genetics approach - selective breeding for high and low mirror aggression zebrafish (HAZ and LAZ). RESULTS: We characterized AB wild-type zebrafish for their response to the mirror image. Both aggressive and non-aggressive fish were inbred over several generations. We found that HAZ were on average more aggressive than the corresponding LAZ across generations and that the most aggressive adult HAZ were less anxious than the least aggressive adult LAZ after prolonged selective breeding. RNAseq analysis of these fish revealed that hundreds of protein-encoding genes with important diverse biological functions such as arsenic metabolism (as3mt), cell migration (arl4ab), immune system activity (ptgr1), actin cytoskeletal remodelling (wdr1), corticogenesis (dgcr2), protein dephosphorylation (ublcp1), sialic acid metabolism (st6galnac3) and ketone body metabolism (aacs) were differentially expressed between HAZ and LAZ, suggesting a strong genetic contribution to this phenotype. DAVID pathway analysis showed that a number of diverse pathways are enriched in HAZ over LAZ including pathways related to immune function, oxidation-reduction processes and cell signalling. In addition, weighted gene co-expression network analysis (WGCNA) identified 12 modules of highly correlated genes that were significantly associated with aggression duration and/or experimental group. CONCLUSIONS: The current study shows that selective breeding based of the mirror aggression phenotype induces strong, heritable changes in behaviour and gene expression within the brain of zebrafish suggesting a strong genetic basis for this behaviour. Our transcriptomic analysis of fish selectively bred for high and low levels of mirror aggression revealed specific transcriptomic signatures induced by selective breeding and mirror aggression and thus provides a large and novel resource of candidate genes for future study.

Endothelial Lipase Modulates Paraoxonase 1 Content and Arylesterase Activity of HDL.

Endothelial lipase (EL) is a strong modulator of the high-density lipoprotein (HDL) structure, composition, and function. Here, we examined the impact of EL on HDL paraoxonase 1 (PON1) content and arylesterase (AE) activity in vitro and in vivo. The incubation of HDL with EL-overexpressing HepG2 cells decreased HDL size, PON1 content, and AE activity. The EL modification of HDL did not diminish the capacity of HDL to associate with PON1 when EL-modified HDL was incubated with PON1-overexpressing cells. The overexpression of EL in mice significantly decreased HDL serum levels but unexpectedly increased HDL PON1 content and HDL AE activity. Enzymatically inactive EL had no effect on the PON1 content of HDL in mice. In healthy subjects, EL serum levels were not significantly correlated with HDL levels. However, HDL PON1 content was positively associated with EL serum levels. The EL-induced changes in the HDL-lipid composition were not linked to the HDL PON1 content. We conclude that primarily, the interaction of enzymatically active EL with HDL, rather than EL-induced alterations in HDL size and composition, causes PON1 displacement from HDL in vitro. In vivo, the EL-mediated reduction of HDL serum levels and the consequently increased PON1-to-HDL ratio in serum increase HDL PON1 content and AE activity in mice. In humans, additional mechanisms appear to underlie the association of EL serum levels and HDL PON1 content.

Synergistic and antagonistic interactions between antibiotics and synbiotics in modifying the murine fecal microbiome.

PURPOSE: Pro- and synbiotics have been reported to ameliorate the adverse (dysbiotic) effects of antibiotics on the gut microbial architecture, but little is known how synbiotics and antibiotics interact with each other in shaping the gut microbiota. To explore this mutual interaction we examined, first, the effect of a multi-strain synbiotic on antibiotic-induced dysbiosis and, second, the dysbiotic effect of antibiotics followed by prolonged synbiotic exposure. METHODS: The synbiotic containing nine bacterial strains was administered to male mice via the drinking water, while the antibiotic mix containing bacitracin, meropenem, neomycin, and vancomycin was administered via oral gavage. Two experimental protocols were used. In protocol 1, mice were administered placebo or synbiotic for 3 weeks prior to and during an 11-day vehicle or antibiotic treatment. In protocol 2 the synbiotic was administered for a prolonged period of time, starting 3 weeks prior and continuing for 12 weeks after an 11-day vehicle or antibiotic treatment. Subsequently, the fecal microbiome was analyzed by 16S rRNA sequencing using oligonucleotide primers 16s_515_S3_fwd: GATTGCCAGCAGCCGCGGTAA and 16s_806_S2_rev: GGACTACCAGGGTATCTAAT followed by sequencing using the Ion Torrent One. The final sequence files were analyzed by QIIME 1.8 workflow scripts. RESULTS: Antibiotic treatment markedly decreased the bacterial richness and diversity of the fecal microbiota. Synbiotic administration for 3 weeks prior to and during an 11-day antibiotic treatment preserved the Lactobacillales and expanded the Verrucomicrobiales and Bifidobacteriales order, but did not prevent the depletion of Bacteroidales and the short-term proliferation of Enterobacteriales. When the synbiotic administration was continued for 12 weeks after the end of antibiotic treatment, the rise of Verrucomicrobiales was maintained, whereas the preservation of Lactobacillales and boost of Bifidobacteriales was lost. The abundance of Clostridiales was enhanced by long-term synbiotic treatment after short-term exposure to antibiotics, while the antibiotic-depleted Bacteroidales underwent a delayed recovery. CONCLUSIONS: There are complex synergistic and antagonistic interactions of synbiotics and antibiotics in influencing distinct bacterial orders of the fecal microbiota. The impact of a short-term antibiotic exposure is profoundly different when analyzed after synbiotic pretreatment or following prolonged synbiotic administration in the post-antibiotic period.

Amyloid-beta impairs insulin signaling by accelerating autophagy-lysosomal degradation of LRP-1 and IR-ß in blood-brain barrier endothelial cells in vitro and in 3XTg-AD mice.

Aberrant insulin signaling constitutes an early change in Alzheimer's disease (AD). Insulin receptors (IR) and low-density lipoprotein receptor-related protein-1 (LRP-1) are expressed in brain capillary endothelial cells (BCEC) forming the blood-brain barrier (BBB). There, insulin may regulate the function of LRP-1 in Aß clearance from the brain. Changes in IR-ß and LRP-1 and insulin signaling at the BBB in AD are not well understood. Herein, we identified a reduction in cerebral and cerebrovascular IR-ß levels in 9-month-old male and female 3XTg-AD (PS1M146V, APPSwe, and tauP301L) as compared to NTg mice, which is important in insulin mediated signaling responses. Reduced cerebral IR-ß levels corresponded to impaired insulin signaling and LRP-1 levels in brain. Reduced cerebral and cerebrovascular IR-ß and LRP-1 levels in 3XTg-AD mice correlated with elevated levels of autophagy marker LC3B. In both genotypes, high-fat diet (HFD) feeding decreased cerebral and hepatic LRP-1 expression and elevated cerebral Aß burden without affecting cerebrovascular LRP-1 and IR-ß levels. In vitro studies using primary porcine (p)BCEC revealed that Aß peptides 1-40 or 1-42 (240 nM) reduced cellular levels and interaction of LRP-1 and IR-ß thereby perturbing insulin-mediated signaling. Further mechanistic investigation revealed that Aß treatment accelerated the autophagy-lysosomal degradation of IR-ß and LRP-1 in pBCEC. LRP-1 silencing in pBCEC decreased IR-ß levels through post-translational pathways further deteriorating insulin-mediated responses at the BBB. Our findings indicate that LRP-1 proves important for insulin signaling at the BBB. Cerebral Aß burden in AD may accelerate LRP-1 and IR-ß degradation in BCEC thereby contributing to impaired cerebral and cerebromicrovascular insulin effects.

High-fat diet induces depression-like behaviour in mice associated with changes in microbiome, neuropeptide Y, and brain metabolome.

Objectives: The biological mechanisms linking diet-related obesity and depression remain unclear. Therefore, we examined the impact of high-fat diet (HFD) on murine behaviour, intestinal microbiome, brain metabolome, neuropeptide Y (NPY) expression, and dipeptidyl peptidase-4 (DPP-4) activity.Methods: Male C57Bl/6J mice were fed an HFD (60 kJ% from fat) or control diet (12 kJ% from fat) for 8 weeks, followed by behavioural phenotyping. Caecal microbiome was analysed by 16S rDNA sequencing, brain metabolome by 1H nuclear magnetic resonance, NPY expression by PCR and immunoassay, and dipeptidyl peptidase-4 (DPP-4) activity by enzymatic assay. The effect of a 4-week treatment with imipramine (7 mg/kg/day) and the DPP-4 inhibitor sitagliptin (50 mg/kg/day) on HFD-induced behavioural changes was also tested.Results: HFD led to a depression-like phenotype as revealed by reduced sociability and sucrose preference. In the caecum, HFD diminished the relative abundance of Bacteroidetes and increased the relative abundance of Firmicutes and Cyanobacteria. In the brain, HFD modified the metabolome of prefrontal cortex and striatum, changing the relative concentrations of molecules involved in energy metabolism (e.g. lactate) and neuronal signalling (e.g. γ-aminobutyric acid). The expression of NPY in hypothalamus and hippocampus was decreased by HFD, whereas plasma NPY and DPP-4-like activity were increased. The HFD-induced anhedonia remained unaltered by imipramine and sitagliptin.Discussion: The depression-like behaviour induced by prolonged HFD in mice is associated with distinct alterations of intestinal microbiome, brain metabolome, NPY system, and DPP-4-like activity. Importantly, the HFD-evoked behavioural disturbance remains unaltered by DPP-4 inhibition and antidepressant treatment with imipramine.

Diverse action of lipoteichoic acid and lipopolysaccharide on neuroinflammation, blood-brain barrier disruption, and anxiety in mice.

Microbial metabolites are known to affect immune system, brain, and behavior via activation of pattern recognition receptors such as Toll-like receptor 4 (TLR4). Unlike the effect of the TLR4 agonist lipopolysaccharide (LPS), the role of other TLR agonists in immune-brain communication is insufficiently understood. We therefore hypothesized that the TLR2 agonist lipoteichoic acid (LTA) causes immune activation in the periphery and brain, stimulates the hypothalamic-pituitary-adrenal (HPA) axis and has an adverse effect on blood-brain barrier (BBB) and emotional behavior. Since LTA preparations may be contaminated by LPS, an extract of LTA (LTAextract), purified LTA (LTApure), and pure LPS (LPSultrapure) were compared with each other in their effects on molecular and behavioral parameters 3h after intraperitoneal (i.p.) injection to male C57BL/6N mice. The LTAextract (20mg/kg) induced anxiety-related behavior in the open field test, enhanced the circulating levels of particular cytokines and the cerebral expression of cytokine mRNA, and blunted the cerebral expression of tight junction protein mRNA. A dose of LPSultrapure matching the amount of endotoxin/LPS contaminating the LTAextract reproduced several of the molecular and behavioral effects of LTAextract. LTApure (20mg/kg) increased plasma levels of tumor necrosis factor-α (TNF-α), interleukin-6 and interferon-γ, and enhanced the transcription of TNF-α, interleukin-1ß and other cytokines in the amygdala and prefrontal cortex. These neuroinflammatory effects of LTApure were associated with transcriptional down-regulation of tight junction-associated proteins (claudin 5, occludin) in the brain. LTApure also enhanced circulating corticosterone, but failed to alter locomotor and anxiety-related behavior in the open field test. These data disclose that TLR2 agonism by LTA causes peripheral immune activation and initiates neuroinflammatory processes in the brain that are associated with down-regulation of BBB components and activation of the HPA axis, although emotional behavior (anxiety) is not affected. The results obtained with an LTA preparation contaminated with LPS hint at a facilitatory interaction between TLR2 and TLR4, the adverse impact of which on long-term neuroinflammation, disruption of the BBB and mental health warrants further analysis.

GAL3 receptor KO mice exhibit an anxiety-like phenotype.

The neuropeptide galanin (GAL) is widely distributed in the central and peripheral nervous systems. It is a modulator of various physiological and pathological processes, and it mediates its effects via three G protein-coupled receptors (GAL1-3 receptors). A role for GAL as a modulator of mood and anxiety was suggested, because GAL and its receptors are highly expressed in limbic brain structures of rodents. In recent years, numerous studies of animal models have suggested an involvement of GAL and GAL1 and GAL2 receptors in anxiety- and depression-related behavior. However, to date, there is sparse literature implicating GAL3 receptors in behavioral functions. Therefore, we studied the behavior of GAL3 receptor-deficient (GAL3-KO) mice to elucidate whether GAL3 receptors are involved in mediating behavior-associated actions of GAL. The GAL3-KO mouse line exhibited normal breeding and physical development. In addition to behavioral tests, phenotypic characterization included analysis of hematology, amino acid profiles, metabolism, and sudomotor function. In contrast to WT littermates, male GAL3-KO mice exhibited an anxiety-like phenotype in the elevated plus maze, open field, and light/dark box tests, and they were less socially affiliated than WT animals to a stranger mouse in a social interaction test. In conclusion, our data suggest involvement of GAL3 receptors in GAL-mediated effects on mood, anxiety, and behavior, making it a possible target for alternative treatment strategies for mood disorders.

Cognitive impairment by antibiotic-induced gut dysbiosis: Analysis of gut microbiota-brain communication.

Emerging evidence indicates that disruption of the gut microbial community (dysbiosis) impairs mental health. Germ-free mice and antibiotic-induced gut dysbiosis are two approaches to establish causality in gut microbiota-brain relationships. However, both models have limitations, as germ-free mice display alterations in blood-brain barrier and brain ultrastructure and antibiotics may act directly on the brain. We hypothesized that the concerns related to antibiotic-induced gut dysbiosis can only adequately be addressed if the effect of intragastric treatment of adult mice with multiple antibiotics on (i) gut microbial community, (ii) metabolite profile in the colon, (iii) circulating metabolites, (iv) expression of neuronal signaling molecules in distinct brain areas and (v) cognitive behavior is systematically investigated. Of the antibiotics used (ampicillin, bacitracin, meropenem, neomycin, vancomycin), ampicillin had some oral bioavailability but did not enter the brain. 16S rDNA sequencing confirmed antibiotic-induced microbial community disruption, and metabolomics revealed that gut dysbiosis was associated with depletion of bacteria-derived metabolites in the colon and alterations of lipid species and converted microbe-derived molecules in the plasma. Importantly, novel object recognition, but not spatial, memory was impaired in antibiotic-treated mice. This cognitive deficit was associated with brain region-specific changes in the expression of cognition-relevant signaling molecules, notably brain-derived neurotrophic factor, N-methyl-d-aspartate receptor subunit 2B, serotonin transporter and neuropeptide Y system. We conclude that circulating metabolites and the cerebral neuropeptide Y system play an important role in the cognitive impairment and dysregulation of cerebral signaling molecules due to antibiotic-induced gut dysbiosis.

Synergistic effects of NOD1 or NOD2 and TLR4 activation on mouse sickness behavior in relation to immune and brain activity markers.

Toll-like receptors (TLRs) and nuclear-binding domain (NOD)-like receptors (NLRs) are sensors of bacterial cell wall components to trigger an immune response. The TLR4 agonist lipopolysaccharide (LPS) is a strong immune activator leading to sickness and depressed mood. NOD agonists are less active but can prime immune cells to augment LPS-induced cytokine production. Since the impact of NOD and TLR co-activation in vivo has been little studied, the effects of the NOD1 agonist FK565 and the NOD2 agonist muramyl dipeptide (MDP), alone and in combination with LPS, on immune activation, brain function and sickness behavior were investigated in male C57BL/6N mice. Intraperitoneal injection of FK565 (0.001 or 0.003mg/kg) or MDP (1 or 3mg/kg) 4h before LPS (0.1 or 0.83mg/kg) significantly aggravated and prolonged the LPS-evoked sickness behavior as deduced from a decrease in locomotion, exploration, food intake and temperature. When given alone, FK565 and MDP had only minor effects. The exacerbation of sickness behavior induced by FK565 or MDP in combination with LPS was paralleled by enhanced plasma protein and cerebral mRNA levels of proinflammatory cytokines (IFN-γ, IL-1ß, IL-6, TNF-α) as well as enhanced plasma levels of kynurenine. Immunohistochemical visualization of c-Fos in the brain revealed that NOD2 synergism with TLR4 resulted in increased activation of cerebral nuclei relevant to sickness. These data show that NOD1 or NOD2 synergizes with TLR4 in exacerbating the immune, sickness and brain responses to peripheral immune stimulation. Our findings demonstrate that the known interactions of NLRs and TLRs at the immune cell level extend to interactions affecting brain function and behavior.

adgrl3.1-deficient zebrafish show noradrenaline-mediated externalizing behaviors, and altered expression of externalizing disorder-candidate genes, suggesting functional targets for treatment.

Externalizing disorders (ED) are a cause of concern for public health, and their high heritability makes genetic risk factors a priority for research. Adhesion G-Protein-Coupled Receptor L3 (ADGRL3) is strongly linked to several EDs, and loss-of-function models have shown the impacts of this gene on several core ED-related behaviors. For example, adgrl3.1-/- zebrafish show high levels of hyperactivity. However, our understanding of the mechanisms by which this gene influences behavior is incomplete. Here we characterized, for the first time, externalizing behavioral phenotypes of adgrl3.1-/- zebrafish and found them to be highly impulsive, show risk-taking in a novel environment, have attentional deficits, and show high levels of hyperactivity. All of these phenotypes were rescued by atomoxetine, demonstrating noradrenergic mediation of the externalizing effects of adgrl3.1. Transcriptomic analyses of the brains of adgrl3.1-/- vs. wild-type fish revealed several differentially expressed genes and enriched gene clusters that were independent of noradrenergic manipulation. This suggests new putative functional pathways underlying ED-related behaviors, and potential targets for the treatment of ED.

Association of cardiorespiratory fitness and morphological brain changes in the elderly: results of the Austrian Stroke Prevention Study.

BACKGROUND: Physical activity and cardiorespiratory fitness relate to better cognitive performance. Little is known about the effects of fitness on structural brain abnormalities in the elderly. OBJECTIVE: Assess the association between maximal oxygen consumption (VO(2)max), white matter lesion (WML) volume and brain parenchymal fraction (BPF) in a large cohort of community-dwelling elderly individuals. METHODS: The study population consisted of 715 participants of the Austrian Stroke Prevention Study who underwent brain MRI with semi-automated measurement of WML volume (cm(3)) and automated assessment of BPF (%) by the use of SIENAX. A maximal exercise stress test was done on a bicycle ergometer. VO(2)max was calculated based on maximum and resting heart rate. RESULTS: After adjustment for possible confounders, VO(2)max was independently associated with WML volume (ß = -0.10; p = 0.02); no significant relationship existed with silent cerebral infarcts and BPF. Associations between VO(2)max and WML load were only significant in men, but not in women. CONCLUSION: Our findings may have important preventive implications because WMLs are known to be a major determinant of cognitive decline and disability in old age.

Galanin receptor 3 attenuates inflammation and influences the gut microbiota in an experimental murine colitis model.

The regulatory (neuro)peptide galanin and its three receptors (GAL1-3R) are involved in immunity and inflammation. Galanin alleviated inflammatory bowel disease (IBD) in rats. However, studies on the galanin receptors involved are lacking. We aimed to determine galanin receptor expression in IBD patients and to evaluate if GAL2R and GAL3R contribute to murine colitis. Immunohistochemical analysis revealed that granulocytes in colon specimens of IBD patients (Crohn's disease and ulcerative colitis) expressed GAL2R and GAL3R but not GAL1R. After colitis induction with 2% dextran sulfate sodium (DSS) for 7 days, mice lacking GAL3R (GAL3R-KO) lost more body weight, exhibited more severe colonic inflammation and aggravated histologic damage, with increased infiltration of neutrophils compared to wild-type animals. Loss of GAL3R resulted in higher local and systemic inflammatory cytokine/chemokine levels. Remarkably, colitis-associated changes to the intestinal microbiota, as assessed by quantitative culture-independent techniques, were most pronounced in GAL3R-KO mice, characterized by elevated numbers of enterobacteria and bifidobacteria. In contrast, GAL2R deletion did not influence the course of colitis. In conclusion, granulocyte GAL2R and GAL3R expression is related to IBD activity in humans, and DSS-induced colitis in mice is strongly affected by GAL3R loss. Consequently, GAL3R poses a novel therapeutic target for IBD.

Skin swabbing is a refined technique to collect DNA from model fish species.

Model fish species such as sticklebacks and zebrafish are frequently used in studies that require DNA to be collected from live animals. This is typically achieved by fin clipping, a procedure that is simple and reliable to perform but that can harm fish. An alternative procedure to sample DNA involves swabbing the skin to collect mucus and epithelial cells. Although swabbing appears to be less invasive than fin clipping, it still requires fish to be netted, held in air and handled-procedures that can cause stress. In this study we combine behavioural and physiological analyses to investigate changes in gene expression, behaviour and welfare after fin clipping and swabbing. Swabbing led to a smaller change in cortisol release and behaviour on the first day of analysis compared to fin clipping. It also led to less variability in data suggesting that fewer animals need to be measured after using this technique. However, swabbing triggered some longer term changes in zebrafish behaviour suggesting a delayed response to sample collection. Skin swabbing does not require the use of anaesthetics and triggers fewer changes in behaviour and physiology than fin clipping. It is therefore a more refined technique for DNA collection with the potential to improve fish health and welfare.

The zebrafish histamine H3 receptor modulates aggression, neural activity and forebrain functional connectivity.

AIM: Aggression is a behavioural trait characterized by the intention to harm others for offensive or defensive purposes. Neurotransmitters such as serotonin and dopamine are important mediators of aggression. However, the physiological role of the histaminergic system during this behaviour is currently unclear. Here, we aimed to better understand histaminergic signalling during aggression by characterizing the involvement of the histamine H3 receptor (Hrh3). METHODS: We have generated a novel zebrafish Hrh3 null mutant line using CRISPR-Cas9 genome engineering and investigated behavioural changes and alterations to neural activity using whole brain Ca2+ imaging in zebrafish larvae and ribosomal protein S6 (rpS6) immunohistochemistry in adults. RESULTS: We show that genetic inactivation of the histamine H3 receptor (Hrh3) reduces aggression in zebrafish, an effect that can be reproduced by pharmacological inhibition. In addition, hrh3-/- zebrafish show behavioural impairments consistent with heightened anxiety. Larval in vivo whole brain Ca2+ imaging reveals higher neuronal activity in the forebrain of mutants, but lower activity in specific hindbrain areas and changes in measures of functional connectivity between subregions. Adult hrh3-/- zebrafish display brain region-specific neural activity changes in response to aggression of both key regions of the social decision-making network, and the areas containing histaminergic neurons in the zebrafish brain. CONCLUSION: These results highlight the importance of zebrafish Hrh3 signalling for aggression and anxiety and uncover the brain areas involved. Targeting this receptor might be a potential novel therapeutic route for human conditions characterized by heightened aggression.

The Visually Mediated Social Preference Test: A Novel Technique to Measure Social Behavior and Behavioral Disturbances in Zebrafish.

Zebrafish are an emerging model in behavioral neuroscience. They display a wide range of measurable behaviors such as locomotion, aggression, anxiety, learning and memory, and social behavior. In addition, the relative ease of genetic manipulation and the increasing availability of disease models mean that zebrafish have gained in popularity as an animal model for various neurological and psychiatric diseases including autism spectrum disorder (ASD). In order to better characterize social behavior and behavioral abnormalities in zebrafish, we have developed the visually mediated social preference (VMSP) test, a novel assay to measure social preference and social novelty in two consecutive 5-min sessions. Using recording and video tracking, the time spent in different areas of the tank, the time spent immobile, swimming speed, and distance moved can be easily measured and analyzed. Untreated experimentally naive AB WT zebrafish typically show a strong preference for spending time near and interacting with a compartment containing unfamiliar conspecifics over the empty compartments during session 1 and a stronger preference for a group of unfamiliar zebrafish over familiar conspecifics from session 1, during session 2 of the test. Research in our lab has shown that the VMSP is suitable to measure the social behavior of individual zebrafish, to uncover social phenotypes of mutant strains, and to better understand animal models of disease that include impaired sociability such as ASD. The current paper provides a step-by-step guide on how to implement and perform this test and highlights important considerations for data acquisition, analysis, and interpretation.

Intermittent Fasting Exacerbates the Acute Immune and Behavioral Sickness Response to the Viral Mimic Poly(I:C) in Mice.

Intermitted fasting and other forms of calorie restriction are increasingly demonstrated to exert potential health benefits. Interestingly, restricted feeding is also able to mitigate sickness in response to bacterial factors stimulating Toll-like receptor 4 (TLR4). However, little is known about how fasting modifies the activity of virus-associated molecular patterns. We therefore analyzed the impact of an intermittent fasting (IF) regimen on the immune and behavioral response to the TLR3 agonist and viral mimic polyinosinic:polycytidylic acid [Poly(I:C)] in mice. The effects of intraperitoneally injected Poly(I:C) (12 mg/kg) on plasma and cerebral cytokine expression and behavior (locomotion, exploration, and ingestion) were examined in male C57BL/6N mice under control conditions and following a 9 days period of intermittent (alternate day) fasting (IF). Poly(I:C) increased the circulating levels of cytokines (TNF-α, MCP-1, IL-6, IL-10, IFN-α, IFN-γ), an effect amplified by IF. In addition, IF aggravated sickness behavior in response to Poly(I:C), while cerebral cytokine expression was enhanced by application of Poly(I:C) in the absence of a significant effect of IF. Furthermore, IF augmented the expression of neuropeptide Y (NPY) mRNA in the hypothalamus and increased the plasma levels of corticosterone, while Poly(I:C) had little effect on these readouts. Our data show that IF does not abate, but exaggerates the immune and sickness response to the viral mimic Poly(I:C). This adverse effect of IF occurs despite increased hypothalamic NPY expression and enhanced plasma corticosterone. We therefore propose that the effects of IF on the immune and behavioral responses to viral and bacterial factors are subject to different neuronal and neuroendocrine control mechanisms.

Intranasal Neuropeptide Y Blunts Lipopolysaccharide-Evoked Sickness Behavior but Not the Immune Response in Mice.

Neuropeptide Y (NPY) has been demonstrated to exert stress buffering effects and promote resilience. Non-invasive intranasal (IN) application of NPY to rodents is able to mitigate traumatic stress-induced behavioral changes as well as dysfunction of the hypothalamic-pituitary-adrenal (HPA) axis. However, it is unknown whether IN NPY could prevent the behavioral, pro-inflammatory and neurochemical responses to peripheral immune activation by the Toll-like receptor 4 (TLR4) stimulant lipopolysaccharide (LPS). Therefore, we analyzed the effects of IN NPY (100 µg) on the behavioral sickness response (reduced locomotion and exploration) and the underlying molecular mechanisms, 3 h and 21 h after intraperitoneal injections of LPS (0.03 mg/kg) in male C57BL/6N mice. The acute behavioral sickness response was significantly dampened by pretreatment with IN NPY 3 h after LPS injection. This effect was accompanied by diminished weight loss and lowered plasma corticosterone (CORT) levels 21 h after LPS injection. In contrast, acute circulating cytokine levels and hypothalamic cytokine mRNA expression remained unaltered by IN NPY, which indicates that the peripheral and cerebral immune response to LPS was left undisturbed. Our findings are in agreement with the reported activity of NPY to dampen the response of the HPA axis to stress. We propose that IN NPY ablates sickness behavior at a site beyond the peripheral and cerebral cytokine response, an action that is associated with reduced activity of the HPA axis as determined by decreased plasma CORT.These results indicate that IN NPY administration may be relevant to the management of neuropsychiatric disorders arising from immune-induced neuroendocrine dysfunction.

Endothelin neurotransmitter signalling controls zebrafish social behaviour.

The formation of social groups is an adaptive behaviour that can provide protection from predators, improve foraging and facilitate social learning. However, the costs of proximity can include competition for resources, aggression and kleptoparasitism meaning that the decision whether to interact represents a trade-off. Here we show that zebrafish harbouring a mutation in endothelin receptor aa (ednraa) form less cohesive shoals than wild-types. ednraa-/- mutants exhibit heightened aggression and decreased whole-body cortisol levels suggesting that they are dominant. These behavioural changes correlate with a reduction of parvocellular arginine vasopressin (AVP)-positive neurons in the preoptic area, an increase in the size of magnocellular AVP neurons and a higher concentration of 5-HT and dopamine in the brain. Manipulation of AVP or 5-HT signalling can rescue the shoaling phenotype of ednraa-/- providing an insight into how the brain controls social interactions.

Experimental colitis reduces microglial cell activation in the mouse brain without affecting microglial cell numbers.

Inflammatory bowel disease (IBD) patients frequently suffer from anxiety disorders and depression, indicating that altered gut-brain axis signalling during gastrointestinal inflammation is a risk factor for psychiatric disease. Microglia, immune cells of the brain, is thought to be involved in a number of mental disorders, but their role in IBD is largely unknown. In the current work, we investigated whether colitis induced by dextran sulphate sodium (DSS), a murine model of IBD, alters microglial phenotypes in the brain. We found that colitis caused a reduction of Iba-1 and CD68 immunoreactivity, microglial activation markers, in specific brain regions of the limbic system such as the medial prefrontal cortex (mPFC), while other areas remained unaffected. Flow cytometry showed an increase of monocyte-derived macrophages during colitis and gene expression analysis in the mPFC showed pronounced changes of microglial markers including cluster of differentiation 86 (CD86), tumour necrosis factor-α, nitric oxide synthase 2, CD206 and chitinase-like protein 3 consistent with both M1 and M2 activation. Taken together, these findings suggest that experimental colitis-induced inflammation is propagated to the brain altering microglial function.

An Unbiased Approach of Sampling TEM Sections in Neuroscience.

Investigations of the ultrastructural features of neurons and their synapses are only possible with electron microscopy. Especially for comparative studies of the changes in densities and distributions of such features, an unbiased sampling protocol is vital for reliable results. Here, we present a workflow for the image acquisition of brain samples. The workflow allows systematic uniform random sampling within a defined brain region, and the images can be analyzed using a disector. This technique is much faster than extensive examination of serial sections but still presents a feasible approach to estimate the densities and distributions of ultrastructure features. Before embedding, stained vibratome sections were used as a reference to identify the brain region under investigation, which helped speed up the overall specimen preparation process. This approach was used for comparative studies investigating the effect of an enriched-housing environment on several ultrastructural parameters in the mouse brain. Based on the successful use of the workflow, we adapted it for the purpose of elemental analysis of brain samples. We optimized the protocol in terms of the time of user-interaction. Automating all the time-consuming steps by compiling a script for the open source software SerialEM helps the user to focus on the main work of acquiring the elemental maps. As in the original workflow, we paid attention to the unbiased sampling approach to guarantee reliable results.