Decoding cell signalling and regulation of oligodendrocyte differentiation.

Oligodendrocytes are fundamental for the functioning of the nervous system; they participate in several cellular processes, including axonal myelination and metabolic maintenance for astrocytes and neurons. In the mammalian nervous system, they are produced through waves of proliferation and differentiation, which occur during embryogenesis. However, oligodendrocytes and their precursors continue to be generated during adulthood from specific niches of stem cells that were not recruited during development. Deficiencies in the formation and maturation of these cells can generate pathologies mainly related to myelination. Understanding the mechanisms involved in oligodendrocyte development, from the precursor to mature cell level, will allow inferring therapies and treatments for associated pathologies and disorders. Such mechanisms include cell signalling pathways that involve many growth factors, small metabolic molecules, non-coding RNAs, and transcription factors, as well as specific elements of the extracellular matrix, which act in a coordinated temporal and spatial manner according to a given stimulus. Deciphering those aspects will allow researchers to replicate them in vitro in a controlled environment and thus mimic oligodendrocyte maturation to understand the role of oligodendrocytes in myelination in pathologies and normal conditions. In this study, we review these aspects, based on the most recent in vivo and in vitro data on oligodendrocyte generation and differentiation.

Melanoma Awareness Among Medical Students.

Melanoma is the most aggressive skin cancer. Since diagnosis is visual, it is critical to evaluate if students acquire enough knowledge for early detection during medical school. To assess the melanoma knowledge of first-year (freshman) and sixth-year (senior) medical students, in a Brazilian Institution. It was a transversal and quantitative study. A questionnaire with sociodemographic data, knowledge about melanoma, and the habit of skin self-exam was filled out by medical students. A total of 128 first-year and 122 seniors students were included. All the sixth-year students knew melanoma as a skin cancer compared with 46.09% of the first-year students. Melanoma clinical characteristics were known by 30.51% of the freshman and 97.54% of seniors. However, they did not know the most usual site of melanoma occurrence (79.66% of first-year students and 24.59% of senior). About the skin self-exam, only 50% of first-year students and 53.28% of senior had the habit of doing it sometimes. Medical school was effective in providing knowledge about melanoma and its features. However, this was not reflected in an increase in the number of students that did the skin self-exam, which indicates the need for new approaches in teaching.

Genome sequences of chikungunya virus isolates circulating in midwestern Brazil.

Chikungunya virus (CHIKV) is a reemerging arbovirus of the family Togaviridae that causes CHIKV fever, a disease that can extend from weeks to years depending on whether clinical signs of arthralgia persist. CHIKV is mainly transmitted by Aedes aegypti mosquitoes and possibly reached the Americas in 2013, causing an outbreak in Brazil in 2015. So far, two evolutionary lineages of CHIKV have been reported in Brazil: the Asian and the East-Central-South African (ECSA) lineages. In this study, six CHIKV isolates circulating in midwestern Brazil (Mato Grosso state) were isolated from patient sera, and their complete genomes were sequenced using a high-throughput sequencing platform. All of these isolates shared high nucleotide sequence similarity with CHIKV isolates from northeastern Brazil and were found to belong to the ECSA lineage. These CHIKV isolates did not contain the A226V or L210Q mutations that are associated with increased transmissibility by A. albopictus, suggesting that the CHIKV isolates circulating in midwestern Brazil are predominantly transmitted by A. aegypti.

Transgenerational epigenetic variance for body weight in meat quails.

We aimed to estimate transgenerational epigenetic variance for body weight using genealogical and phenotypic information in meat quails. Animals were individually weighted from 1 week after hatching, with weight records at 7, 14, 21, 28, 35 and 42 days of age (BW7, BW14, BW21, BW28, BW35 and BW42, respectively). Single-trait genetic analyses were performed using mixed models with random epigenetic effects. Variance components were estimated by the restricted maximum likelihood method. A grid search for values of autorecursive parameter (λ) ranging from 0 to 0.5 was used in the variance component estimation. This parameter is directly related to the reset coefficient (ν) and the epigenetic coefficient of transmissibility (1-ν). The epigenetic effect was only significant for BW7. Direct heritability estimates for body weight ranged in magnitude (from 0.15 to 0.26), with the highest estimate for BW7. Epigenetic heritability was 0.10 for BW7, and close to zero for the other body weights. The inclusion of the epigenetic effect in the model helped to explain the residual and non-Mendelian variability of initial body weight in meat quails.

A note on transgenerational epigenetics affecting egg quality traits in meat-type quail.

1. The aim of the following experiment was to estimate transgenerational epigenetic variance for egg quality traits using genealogical and phenotypic information in meat-type quail. Measured traits included egg length (EL) and width (EWD), albumen weight (AW), shell weight (SW), yolk weight (YW) and egg weight (EW). 2. A total of 391 birds were evaluated for egg quality by collecting a sample of one egg per bird, during three consecutive days, starting on the 14th d of production. Analyses were performed using mixed models including the random epigenetic effect. Variance components were estimated by the restricted maximum likelihood method. A grid-search for values for the auto-recursive parameter (λ) was used in the variance components estimation. This parameter is directly related to the reset (v) and epigenetic transmissibility (1 - v) coefficients. 3. The epigenetic effect was not significant for any of the egg quality traits evaluated. Direct heritability estimates for egg quality traits ranged in magnitude from 0.06 to 0.33, whereby the higher estimates were found for AW and SW. Epigenetic heritability estimates were low and close to zero (ranging from 0.00 to 0.07) for all evaluated traits. 4. The current breeding strategies accounting for additive genetic effect seem to be suitable for egg quality traits in meat-type quail.

Assessing the expected response to genomic selection of individuals and families in Eucalyptus breeding with an additive-dominant model.

We report a genomic selection (GS) study of growth and wood quality traits in an outbred F2 hybrid Eucalyptus population (n=768) using high-density single-nucleotide polymorphism (SNP) genotyping. Going beyond previous reports in forest trees, models were developed for different selection targets, namely, families, individuals within families and individuals across the entire population using a genomic model including dominance. To provide a more breeder-intelligible assessment of the performance of GS we calculated the expected response as the percentage gain over the population average expected genetic value (EGV) for different proportions of genomically selected individuals, using a rigorous cross-validation (CV) scheme that removed relatedness between training and validation sets. Predictive abilities (PAs) were 0.40-0.57 for individual selection and 0.56-0.75 for family selection. PAs under an additive+dominance model improved predictions by 5 to 14% for growth depending on the selection target, but no improvement was seen for wood traits. The good performance of GS with no relatedness in CV suggested that our average SNP density (~25 kb) captured some short-range linkage disequilibrium. Truncation GS successfully selected individuals with an average EGV significantly higher than the population average. Response to GS on a per year basis was ~100% more efficient than by phenotypic selection and more so with higher selection intensities. These results contribute further experimental data supporting the positive prospects of GS in forest trees. Because generation times are long, traits are complex and costs of DNA genotyping are plummeting, genomic prediction has good perspectives of adoption in tree breeding practice.

The complete genome of the tospovirus Zucchini lethal chlorosis virus.

BACKGROUND: Zucchini lethal chlorosis virus (ZLCV) causes significant losses in the production of cucurbits in Brazil. This virus belongs to the genus Tospovirus (family Bunyaviridae) and seems to be exclusively transmitted by Frankliniella zucchini (Thysanoptera). Tospoviruses have a tripartite and single-stranded RNA genome classified as S (Small), M (Medium) and L (Large) RNAS. Although ZLCV was identified as a member of the genus Tospovirus in 1999, its complete genome had not been sequenced until now. FINDINGS: We sequenced the full-length genome of two ZLCV isolates named ZLCV-SP and ZLCV-DF. The phylogenetic analysis showed that ZLCV-SP and ZLCV-DF clustered with the previously reported isolate ZLCV-BR09. Their proteins were closely related, except the non-structural protein (NSm), which was highly divergent (approximately 90 % identity). All viral proteins clustered similarly in our phylogenetic analysis, excluding that these ZLCV isolates have originated from reassortment events of different tospovirus species. CONCLUSION: Here we report for the first time the complete genome of two ZLCV isolates that were found in the field infecting zucchini and cucumber.

Selection index using the graphical area applied to sugarcane breeding.

This study aimed to develop a multivariate selection index based on the graphical area of a polygon formed by standardized values, also known as radar chart. This methodology may be used to assist selection of superior genotypes in sugarcane breeding programs. Seven technological traits in 37 sugarcane genotypes were evaluated. An area index (AI) was constructed and the resulting polygon areas were used to rank genotypes under selection. In this study, we propose the use of restricted maximum likelihood to estimate genetic parameters and mixed model equations to predict genotypic and breeding values. The area of each polygon was calculated for phenotypic, genotypic, and estimated breeding values. Thereby, the genotypes with larger area can be selected based on a detailed a posteriori evaluation of the radar charts. The proposed AI can be adjusted based on the breeders' specific interests, it is perfectly useful in other crops, and may also be applied to studies on genotype-environment interactions. Moreover, AI is a powerful tool that can evaluate trait stability of genotypes based on slight differences in the area formed by each genotype. Hence, this method is easy to apply and shows great potential for use in sugarcane breeding programs as well as in other breeding programs.

Photosynthetic and antioxidative alterations in coffee leaves caused by epoxiconazole and pyraclostrobin sprays and Hemileia vastatrix infection.

Coffee leaf rust (CLR), caused by Hemileia vastatrix, is a major disease affecting coffee production worldwide. In this study, an in-depth analysis of the photosynthetic performance of coffee leaves challenged or not with H. vastatrix and sprayed with either epoxiconazole (EPO) or pyraclostrobin (PYR) was performed by combining chlorophyll a fluorescence images, photosynthetic pigment pools and the activities of chitinase (CHI), ß-1,3-glucanase (GLU), peroxidase (POX) and catalase (CAT). The CLR severity was higher in the control plants, but reduced in plants sprayed with both PYR and EPO. Also, the CLR severity was reduced in plants sprayed with PYR compared with plants sprayed with EPO. Plants sprayed with either EPO or PYR showed maximal photosystem II quantum efficiency (Fv/Fm) values ranging from 0.78 to 0.80, which were quite similar to those obtained with inoculated plants (values ranging from 0.74 to 0.77). The decreases in the Fv/Fm ratio values and parallel increases in the F0 values in the inoculated plants, which were not observed in the control plants (sprayed with water) and were confirmed by images of the initial fluorescence (F0) and Fv/Fm parameters in the regions of the leaf tissue containing pustules and in the asymptomatic leaf tissue, indicated that photosynthesis was negatively impacted. When effective photosystem II quantum yield (Y(II)) values approached zero with a high photosynthetic photon flux density, high values of quantum yield of regulated energy dissipation (Y(NPQ)) in association with a high carotenoid concentration were noted in the inoculated plants sprayed either with PYR or EPO. The increased CLR severity in inoculated plants in contrast to inoculated plants sprayed with either PYR or EPO was associated with greater POX activity and a reduced photosynthetic pigment concentration. POX and CAT activities were increased in inoculated plants sprayed with either EPO or PYR when compared with control plants. CHI and GLU activities were maintained at high levels in the leaves of inoculated plants, regardless of the fungicide sprayed, indicating that CHI and GLU are less important for coffee resistance against CLR. The results of the present study clearly demonstrated that plants sprayed with either EPO or PYR showed milder CLR symptoms with adequate photosynthetic performance and optimal conditioning of their antioxidant systems.

The First Report of Tomato chlorotic spot virus (TCSV) Infecting Long Beans and Chili Peppers in the Dominican Republic.

The Dominican Republic has a significant area of the country cultivated with vegetables. In July 2013, in the provinces of Moca and La Vega, horticultural crops showed typical tospovirus symptoms (>30% incidence), including bronzing, chlorosis, necrosis, and ring spots on leaves and fruits. Samples were collected from potatoes (Solanum tuberosum), long beans (Vignaun guiculata), chili peppers (Capsicum frutescens), sweet peppers (C. annuum), and tomatoes (S. lycopersicum). Serological tests were clearly positive for infection by Tomato spotted wilt virus (TSWV) and/or related tospoviruses when tested with AgDia immunostrips. The viral RNA extracted from five plants per host was pooled to construct a cDNA library that was sequenced using an Illumina HiSeq 2000 platform. The paired-end reads were assembled using CLC Genomic Workbench version 6.0.3. The assembled contigs were submitted to BLASTx against a viral genome database. The results confirmed the presence of Tomato chlorotic spot virus (TCSV) and TSWV. Then, PCR tests were performed with primers pairs TSWV-LF 5' CTGTTGTCTATTGAGGATTGTG 3' AND TSWV-LR 5' CAGAGAGCTTGTTAATGCAGGAC 3' to amplify part of the TSWV L RNA, the pairs TCSV-SF 5' AACTGGGAAAGCAGAAAACC 3' and TCSV-SR 5' CCTTACTCCGAACATTGCA 3', and GRSV-SF 5' CTGTCAGGAAAATCTTGACCTG 3' and GRSV-SR 5' CTTGACTCCAAACATCTCGT 3' to detect part of the TCSV and Groundnut ringspot virus (GRSV) S segments. In the long bean and chili pepper samples from La Vega, only TCSV was detected (40% of the all samples) based on amplification of the expected size fragment with the S RNA specific primer pair. All the other samples were positive for TSWV and no GRSV was detected. The complete N gene of TCSV and TSWV were amplified using the primer pairs TCSV-NR2 5' CACACTGAACTGAACTATAACACAC 3' and TCSV-NF 5' ACCTTGAATCATATCTCTCG 3' and primers N-TSWV_FW 5' TACGGATCCGATGTCTAAGGTTAAGCTCAC 3' and N-TSWV_RV 5' TTATCTCGAGTCAAGCAAGTTCTGCGAG 3'. The TCSV N protein sequences (KJ399303 and KJ399304) were 99% identical with the TCSV found in processing tomatoes in the Dominican Republic (1) and the United States (2). The TSWV N protein sequences (KJ399313, KJ399314 and KJ399315) shared 96 to 98% identity with the TSWV N sequences available. Dot blot hybridization tests (1) using DIG-labeled specific TCSV N gene probe confirmed TCSV infection in PCR-positive long bean and chili pepper samples, whereas no hybridization signal was detected for TSWV-infected tomatoes, potatoes, sweet peppers, or healthy samples. In addition, no reassortants were detected based on amplification of the expected size RNA fragments (3). These other amplicons (KJ399301, KJ399299, KJ399302, and KJ399300) showed 98% identity with the L and M segments of TCSV. Thrips collected from symptomatic plants were identified mainly as Frankliniella schultzei, consistent with the main thrips species transmitting TCSV. In the last two years, TCSV was reported in North and Central America and in the Caribbean Basin (1,2,4). These findings have an important epidemiological impact since TCSV represents a new threat to other horticultural crops affected by this tospovirus. References: (1) O. Batuman et al. Plant Dis. 98:286, 2014. (2) A. Londono et al. Trop. Plant Pathol. 37:333, 2012. (3) C. G. Webster et al. Virology 413:216, 2011. (4) C. G. Webster et al. Plant Health Progress. Online publication. doi:10.1094/PHP-2013-0812-01-BR, 2013.

First Report of Johnsongrass mosaic virus (JGMV) Infecting Pennisetum purpureum in Brazil.

Tropical grass and legume species used as pasture grasses for cattle feeding cover over 25% of the agricultural area in Brazil. In recent years, plants showing virus-like symptoms have been observed in the main pasture grass growing areas. Plants of Pennisetum purpureum line CNPGL 00211 showing typical virus mosaic symptoms on leaves and growth reduction were collected in Bahia State, Brazil. Flexuous elongated potyvirus-like particles were observed in the leaf-dip preparation of diseased plants by electron microscopy. In addition, the virus was mechanically transmitted using a standard procedure for potyviruses (4) and produced similar symptoms in inoculated P. purpureum plants. For further molecular identification, total RNA was extracted from frozen symptomatic leaves following the guanidine thiocyanate method (3). cDNA synthesis was performed using oligonucleotide, OligodT50M10 and PCR was carried out using Potyvirus degenerate primers PY11 (5'-GGNAAYAAYAGYGGNCARCC-3') (2) and M10 (5'-AAGCAGTGTTATCAACGCAGA-3'). The amplified fragments of the expected size (approximately 2 kb comprising part of the NIb protein gene, the entire coat protein [CP] gene, and the 3' nontranslated region) were separated using agarose gel electrophoresis, excised, and cloned into plasmid vector pGEMT-Easy (Promega) according to the manufacturer's instructions. Four selected clones were sequenced (Macrogen, South Korea). The sequenced 2.0-kb fragment (GenBank Accession No. KC333416) was compared with sequences available in GenBank and the highest nucleotide identity of 79% was observed with Johnsongrass mosaic virus (JGMV) isolated in Australia (4). According to the Potyvirus species demarcation convention based on CP identity (1), the virus isolate from P. purpureum belongs to the JGMV species. However, the amino acid sequence of the N-terminus of the CP of the Bahia isolate is distinct from JGMV sequences reported in GenBank. The phylogenetic analysis of the CP confirmed the difference since this Bahia isolate was located in a clearly distinct branch separate from all JGMV isolates. To our knowledge, this is the first report of a JGMV in Brazil infecting tropical grass in the main pasture areas. References: (1) M. J. Adams et al. Arch. Virol. 150: 459, 2005. (2) J. Chen et al. Arch. Virol. 146:757. 2001. (3) P. Chomczynski and N. Sacchi. Nature Protocols 1:581, 2006. (4) H. K. Laidlaw et al. Arch. Virol. 149:1633, 2004.

Identification of carboxymethyl (CM)-binding proteins derived from Lolium multiflorum pollen extract and antibody reactivity in Brazilian allergic patients.

Lolium multiflorum grass is the major pollen allergen source in the southern region of Brazil, but most of its allergens remain poorly characterized. The aim of this study was to investigate antibody reactivity to L. multiflorum crude and carboxymethyl-ligand extracts in allergic patients and healthy individuals. Ion exchange carboxymethyl (CM) chromatography (CM-Sepharose) was used to isolate proteins (S2) from L. multiflorum crude extract (S1), which were assessed by SDS-PAGE. S1- and S2-specific IgE and IgG4 levels were measured by ELISA using sera from 55 atopic and 16 non-atopic subjects. Reactive polypeptide bands in S1 and S2 were detected by immunoblotting, and the most prominent bands in S2 were analyzed by mass spectrometry (MS-MS). Similar IgE and IgG4 levels were observed to both S1 (IgE median absorbance: 1.22; IgG4 median absorbance: 0.68) and S2 (IgE median absorbance: 1.26; IgG4 median absorbance: 0.85) in atopic subjects. S1 and S2 had positive correlations for IgE and IgG4 (IgE: r=0.9567; IgG4: r=0.9229; P<0.0001) levels. Homology between S1 and S2 was confirmed by IgE (84%) and IgG4 (83%) inhibition. Immunoblotting revealed that the 29-32 kDa band was recognized by 100% of atopic subjects in both S1 and S2. MS-MS analysis identified similarity profile to groups 1 and 5 grass allergens. This study revealed that carboxymethyl-ligand fraction played an important role for pollen allergy diagnosis by containing clinically relevant allergens and constituted a promising candidate for allergen-specific immunotherapy.

A distinct tymovirus infecting Cassia hoffmannseggii in Brazil.

Leaves of Cassia hoffmannseggii, a wild fabaceous species found in the Atlantic Forest, with a severe mosaic symptom were collected in Pernambuco State, Brazil. By transmission electron microscopy, two types of virus particles were found: the first was recognized as particles of a potyvirus, which was later identified as Cowpea aphid-borne mosaic virus; and the second was isometric and present in high concentration. The observation of vesicles at the periphery of chloroplasts suggested a tymovirus infection, which was confirmed by subsequent assays. A serological assay against several tymovirus antisera resulted in positive reaction of this tymo-like virus with an antiserum of Passion fruit yellow mosaic virus. By means of RT-PCR and using degenerated primers for the conserved region of RNA-dependent RNA polymerase (RdRp) gene of tymoviruses, a specific DNA fragment was amplified and sequenced. Based on this sequence, a specific forward primer was synthesized and successfully used to amplify the 3' terminal genome region, containing the partial RdRp gene and the complete coat protein (CP) sequences. The CP was 188 amino acids (aa) long, and the highest CP aa identity was observed with Kennedya yellow mosaic virus (61 %). Based on the current ICTV demarcation criterion, this isolate was considered as a distinct tymovirus and tentatively named as Cassia yellow mosaic-associated virus.

Saliva and blood interferon gamma levels and IFNG genotypes in acute graft-versus-host disease.

OBJECTIVE: Graft-versus-host disease is a major complication after allogenic hematopoietic stem cell transplantation. Interferon gamma is an important pro-inflammatory cytokine involved in this disease. Cytokine gene polymorphisms are associated with functional differences in cytokine expression and can alter the clinical course of graft-versus-host disease. This study aimed to investigate the association between IFN-γ levels in saliva, blood, and IFNG polymorphisms, as well as the occurrence of acute graft-versus-host disease in allogenic HSCT. SUBJECTS AND METHODS: Fifty-eight consecutive allogenic hematopoietic stem cell transplantation recipients and their donors were prospectively studied. IFN-g levels in saliva and blood were assessed by ELISA. Samples were collected weekly from 7 days before transplantation (day -7) to 100 days after allogenic HSCT (day +100) or until death. Saliva and/or blood samples were obtained from the recipients and donors to determine IFNG gene polymorphisms. RESULTS: Increased saliva and blood IFN-g levels were observed in patients that had developed aGVHD. In the saliva, the peak levels of IFN-g could be found one week before aGVHD diagnosis, while in the blood, peak levels of IFN-g could be only observed upon diagnosis. A significant association could be identified between the recipients'IFNG genotypes and the IFN-g levels in their blood, at +14 days after HSCT. No association could be observed between IFNG gene polymorphisms and the aGVHD. CONCLUSION: The present study shows that the genetic background of recipients can influence the production of IFN-g. Moreover, as IFN-g levels in the saliva and blood were found to be associated with aGVHD development, this cytokine may be a useful predictor of acute graft-versus-host disease.

Influence of spontaneous calcium events on cell-cycle progression in embryonal carcinoma and adult stem cells.

Spontaneous Ca(2+) events have been observed in diverse stem cell lines, including carcinoma and mesenchymal stem cells. Interestingly, during cell cycle progression, cells exhibit Ca(2+) transients during the G(1) to S transition, suggesting that these oscillations may play a role in cell cycle progression. We aimed to study the influence of promoting and blocking calcium oscillations in cell proliferation and cell cycle progression, both in neural progenitor and undifferentiated cells. We also identified which calcium stores are required for maintaining these oscillations. Both in neural progenitor and undifferentiated cells calcium oscillations were restricted to the G1/S transition, suggesting a role for these events in progression of the cell cycle. Maintenance of the oscillations required calcium influx only through inositol 1,4,5-triphosphate receptors (IP(3)Rs) and L-type channels in undifferentiated cells, while neural progenitor cells also utilized ryanodine-sensitive stores. Interestingly, promoting calcium oscillations through IP(3)R agonists increased both proliferation and levels of cell cycle regulators such as cyclins A and E. Conversely, blocking calcium events with IP(3)R antagonists had the opposite effect in both undifferentiated and neural progenitor cells. This suggests that calcium events created by IP(3)Rs may be involved in cell cycle progression and proliferation, possibly due to regulation of cyclin levels, both in undifferentiated cells and in neural progenitor cells.

Molecular characterization of the RNA-dependent RNA polymerase from groundnut ringspot virus (genus Tospovirus, family Bunyaviridae).

Groundnut ringspot virus is a negative-sense single-stranded RNA virus that belongs to the genus Tospovirus and is the prevalent member of this genus in Brazil. This work presents the nucleotide sequence of the L RNA, with a single open reading frame of 2873 amino acids in the complementary strand corresponding to the RNA-dependent RNA polymerase (L protein), as well as the characterization of conserved domains of the L protein by in silico analysis. Phylogenetic analysis of different L protein domains confirmed that GRSV is a member of the American clade, and comparison with a N-protein indicates that phylogeny based on L protein sequences may be more reliable than that based on the N protein.

HCMV gB genotype and its association with cytokine levels in hematopoietic stem cell transplantation.

BACKGROUND: Glycoprotein B (gB) has been implicated in determining the pathogenicity and clinical outcomes of human cytomegalovirus (HCMV) disease. OBJECTIVE: The purpose of this study was to assess the prevalence of gB genotypes in allogeneic hematopoietic stem cell transplantation (allo-HSCT) and the relationship between it and cytokine levels in saliva and blood samples. The impact of these parameters on patients' survival was also investigated. METHODS: Samples were obtained from 63 patients receiving an allo-HSCT. HCMV gB genotyping was carried out by multiplex nested PCR. The cytokine levels were assessed using ELISA assay. RESULTS: A single or mixed genotype infection was detected in the saliva and blood of 36/63 and 52/63 subjects, respectively. Patients with gB2 in their saliva showed lower IL-10 levels in comparison with patients without gB2. Reduced blood levels of IFN-γ and IL-1ß were also found in recipients with the HCMV gB4 genotype compared with patients without it. Decreased IL-1ß and increased IL-10 blood levels were associated with lower survival. However, HCMV gB genotypes have no impact on patient outcome. CONCLUSION: Decreased IL-1ß and increased IL-10 levels in the blood are associated with lower survival. HCMV genotypes are associated with different cytokine levels in saliva and blood.

Genetic diversity and population structure analysis of the tropical pasture grass Brachiaria humidicola based on microsatellites, cytogenetics, morphological traits, and geographical origin.

Brachiaria humidicola (Rendle) Schweick. is a warm-season grass commonly used as forage in the tropics. Accessions of this species were collected in eastern Africa and massively introduced into South America in the 1980s. Several of these accessions form a germplasm collection at the Brazilian Agricultural Research Corporation. However, apomixis, ploidy, and limited knowledge of the genetic basis of this germplasm collection have constrained breeding activities. The objectives of this work were to identify genetic variability in the Brazilian B. humidicola germplasm collection using microsatellite markers and to compare the results with information on the following: (1) collection sites of the accessions; (2) reproductive mode and ploidy levels; and (3) genetic diversity revealed by morphological traits. The evaluated germplasm population is highly structured into four major groups. The sole sexual accession did not group with any of the clusters. Genetic dissimilarities did not correlate with either geographic distances or genetic distances inferred from morphological descriptors. Additionally, the genetic structure identified in this collection did not correspond to differences in ploidy level. Alleles exclusive to either sexual or apomictic accessions were identified, suggesting that further evaluation of the association of these loci with apospory should be carried out.

Highly efficient siRNA delivery system into human and murine cells using single-wall carbon nanotubes.

Development of RNA interference (RNAi) technology utilizing short interfering RNA sequences (siRNA) has focused on creating methods for delivering siRNAs to cells and for enhancing siRNA stability in vitro and in vivo. Here, we describe a novel approach for siRNA cellular delivery using siRNA coiling into carboxyl-functionalized single-wall carbon nanotubes (SWCNTs). The CNT-siRNA delivery system successfully demonstrates nonspecific toxicity and transfection efficiency greater than 95%. This approach offers the potential for siRNA delivery into different types of cells, including hard-to-transfect cells, such as neuronal cells and cardiomyocytes. We also tested the CNT-siRNA system in a non-metastatic human hepatocellular carcinoma cell line (SKHep1). In all types of cells used in this work the CNT-siRNA delivery system showed high efficiency and apparent no side effects for various in vitro applications.

Saliva as a source of HCMV DNA in allogeneic stem cell transplantation patients.

OBJECTIVE: The purpose of this study was to investigate the use of saliva for the identification of human cytomegalovirus (HCMV) in allogeneic hematopoietic stem cell transplant patients by real time PCR compared with blood. MATERIALS AND METHODS: Saliva and blood samples were sampled weekly in 30 allogeneic hematopoietic stem cell transplant patients until 100 days after transplant. Total genomic DNA, extracted from saliva and whole-blood samples, was used for HCMV real time PCR. Nonparametric tests were performed, and P value