One-year evaluation of inactive occlusal enamel lesions in children and adolescents.

OBJECTIVES: The aims of this study were to compare caries incidence and progression on sound occlusal surfaces and on surfaces presenting inactive enamel lesions in children and adolescents over 1 year and to estimate the risk of caries incidence and progression on these surfaces. METHODS: This prospective cohort study followed 200 7-15-year-old caries-inactive schoolchildren over 1 year. Stage of eruption, occlusal plaque, and occlusal caries were recorded on permanent molars. Statistical analysis was performed using generalized estimating equations with a logistic link function. RESULTS: Twenty-two children (11 %) presented "caries progression" (at least one active lesion on molar teeth). At site level, no difference was observed in caries incidence and progression between sites classified either sound (2.6 %) or with inactive enamel lesion (3.9 %) at the baseline examination (χ (2) test, p = 0.48). Adjusted for plaque, stage of eruption, type of molar and dental arch, inactive enamel lesions presented a similar risk for caries progression than sound occlusal surfaces (OR = 0.98, 95 % CI = 0.40-2.38). CONCLUSION: Within the limitations of this study, no difference was observed in caries incidence, progression, and risk on sound occlusal sites in comparison with sites presenting inactive enamel lesions. CLINICAL RELEVANCE: Occlusal surfaces harboring inactive caries lesions did not require additional attention than the one normally given to sound occlusal surfaces over a 1-year period.

Vital Bleaching Influences the Bond Strength of Adhesive Systems to Enamel and Dentin: A Systematic Review and Meta-Analysis of In Vitro Studies.

OBJECTIVE: This systematic review evaluates the influence of vital bleaching on the bond strength of adhesive systems to enamel and dentin. METHODS: This review was conducted according to Preferred Reporting Items for Systematic Reviews and Meta-analyses (PRISMA). In vitro studies comparing the bond strength of bleached and unbleached enamel and dentin were searched at the electronic databases-PubMed/MEDLINE, Scopus, and Web of Science-with no limit on year or language. The studies were screened and had data extracted by two reviewers independently. Bond strength data were meta-analyzed using the inverse variance method and the random effect model (p≤0.05). RESULTS: The electronic search provided 4941 eligible studies, and 52 were included in the systematic review and the meta-analysis. The global meta-analysis showed that bleaching impairs the bond strength of adhesive systems to enamel and dentin (p<0.001; mean difference [MD]: -0.96; confidence interval [CI]: -1.18 to -0.73), regardless of the bleaching agent (p<0.001; MD: -9.98; CI: -1.37 to -0.58) or substrate (p<0.001; MD: -0.89; CI: -1.12 to -0.66). The detrimental effect of bleaching on bond strength was not observed after two and three weeks after bleaching (p=0.1; MD: -0.39; CI: -0.84 to 0.65; and p=0.18; MD: -0.99; CI: -2.45 to 0.47, respectively). CONCLUSION: This systematic review and meta-analysis demonstrated that vital bleaching impairs the bonding of adhesive systems to enamel and dentin, and this adverse effect persists for two weeks.

Post-Space Treatment Influences the Bond Strength In Endodontically Treated Teeth: A Systematic Review and Meta-Analysis of In Vitro Studies.

OBJECTIVES: This systematic review of in vitro studies investigated the influence of the post-space treatment used to remove the smear layer on the bond strength of the post to root canal dentin. METHODS AND MATERIALS: In vitro studies included in this study were identified from PubMed/MEDLINE, Lilacs, and Scopus databases up until March 2019, without limits on publication year or language. Two reviewers independently selected the studies based on the inclusion and exclusion criteria, extracted the data, and evaluated the risk of bias of all studies. A random effects model was used for pairwise meta-analyses (control vs. post-space preparation groups) at a significance level of p<0.05. RESULTS: Of the 2,832 potentially eligible studies, 453 studies were selected for full-text analysis, and 75 were included in this systematic review. Only one study was considered to have a low risk of bias. Overall, post-space treatment significantly improves the bond strength to root canal dentin (p<0.00001). CONCLUSION: Post-space treatment has a positive influence on the bond strength of the post to root canal dentin. In this review, the post-space treatments that improve the adhesive resistance of the post were ethanol, sodium hypochlorite, and ethylene diamine tetra-acetic acid (NaOCl + EDTA), NaOCl + EDTA + ultrasound, erbium-doped yttrium aluminium garnet laser (Er:YAG laser), neodymium-doped yttrium aluminium garnet laser (Nd:YAG laser), and diode laser.

Zinc oxide eugenol paste jeopardises the adhesive bonding to primary dentine.

AIM: This was to evaluate the influence of root canal filling pastes on microshear bond strength (µSBS) of an adhesive system to primary dentine. METHODS: Human (32) primary molars were randomly assigned into four experimental groups (n = 8): zinc oxide eugenol paste (ZOE); iodoform paste (Guedes-Pinto paste); calcium hydroxide paste thickened with zinc oxide; and no filling paste (control). Flat dentine surfaces were covered with a 1 mm-thick layer of the pastes for 15 min at 37 °C. The pastes were mechanically removed from dentine surfaces, followed by rinsing and drying. After adhesive application (Adper Single Bond 2, 3M ESPE), starch tubes were placed over pre-treated dentine and filled with composite resin (Z250, 3M ESPE). The µSBS test was performed after 24 h of water storage at 37 °C. The failure mode was evaluated using a stereomicroscope. The µSBS values (MPa) were analysed with one-way ANOVA and Tukey post-hoc tests (α = 0.05). RESULTS: The lowest µSBS values were achieved when ZOE was used. No difference was found among other filling pastes compared with control group. All specimens showed adhesive/mixed failures. CONCLUSIONS: Zinc oxide eugenol paste negatively influenced the bond strength of adhesive systems to primary dentine. Iodoform-based Guedes-Pinto paste and calcium hydroxide paste thickened with zinc oxide did not influence the microshear bond strength values.

Degradation of Multimode Adhesive System Bond Strength to Artificial Caries-Affected Dentin Due to Water Storage.

The purpose of this study was to evaluate the influence of water storage on bond strength of multimode adhesive systems to artificially induced caries-affected dentin. One hundred twelve sound bovine incisors were randomly assigned to 16 groups (n=7) according to the dentin condition (sound; SND, artificially induced caries-affected dentin; CAD, cariogenic challenge by pH cycling for 14 days); the adhesive system (SU, Scotchbond Universal Adhesive; AB, All-Bond Universal; PB, Prime & Bond Elect; SB, Adper Single Bond 2; and CS, Clearfil SE Bond), and the etching strategy (etch-and-rinse and self-etch). All adhesive systems were applied under manufacturer's instructions to flat dentin surfaces, and a composite block was built up on each dentin surface. After 24 hours of water storage, the specimens were sectioned into stick-shaped specimens (0.8 mm2) and submitted to a microtensile test immediately (24 hours) or after six months of water storage. Bond strength data (MPa) were analyzed using three-way repeated-measures analysis of variance and post hoc Tukey test (α=5%), considering each substrate separately (SND and CAD). The etching strategy did not influence the bond strength of multimode adhesives, irrespective of the dentin condition. Water storage only reduced significantly the bond strength to CAD. The degradation of bond strength due to water storage was more pronounced in CAD, regardless of the etching strategy.

Color stability of a resin composite: Effect of the immersion method and surface treatments.

BACKGROUND: In vitro staining methods expose the entire specimen to staining solutions. In a real clinical situation, this is not observed, since one should consider that the bonded surface is not exposed to the oral environment. Theoretically, the clinical condition would be the best simulated if the specimens were exposed to staining solutions by partial immersion. AIMS: To evaluate if different immersion methods and surface treatments influence the color stability of resin-based specimens. METHODOLOGY: A stainless steel matrix was used to prepare 30 disc-shaped specimens that were randomly allocated in three groups: Without polishing, polishing with abrasive discs, and surface sealant. Half of the specimens were isolated to maintain only the upper surface exposed to staining (partial immersion) and the other half was totally immersed in coffee solution for 48 h (total immersion). The coordinates ΔE*, ΔL*, Δa*, Δb* were assessed by spectrophotometer. STATISTICAL ANALYSIS: Two-way ANOVA and Tukey's post hoc tests (α =0.05). RESULTS: Specimens submitted to partial immersion showed lower values of ΔE*, ΔL*, Δa*, Δb*, in comparison to total immersion (P = 0.000). Specimens covered by a surface sealant presented lower ΔE* values regardless of the immersion method. CONCLUSIONS: Specimens totally immersed in staining solutions could in somehow overestimate the color change, once that in most clinical conditions not all of the restoration surfaces are exposed to the oral environment. Moreover, as the surface sealant application produces color change values that are clinically acceptable, it might be used in esthetic restorations as an adjunct treatment.

Bovine tooth is a substitute for human tooth on bond strength studies: A systematic review and meta-analysis of in vitro studies.

OBJECTIVES: This study aimed to systematically review the literature to compare the bond strength values achieved from human and bovine teeth of in vitro studies. DATA AND SOURCE: The PubMed/MEDLINE, ISI Web of Science and Scopus electronic databases were searched to select laboratorial studies that evaluated adhesive systems bond strength to human and bovine teeth. No publication year or language restriction was considered. STUDY SELECTION: From 1,285 potentially eligible studies, 15 were selected for full-text analysis, 11 were included in the systematic review and 9 in the meta-analysis. Two authors independently selected the studies, extracted the data and assessed the risk of bias. Mean differences were obtained by comparing bond strength values between human and bovine teeth (overall analysis), and considering enamel and dentin separately (subgroups analysis). Statistical analysis was performed using RevMan5.1, with random effects model, at a significance level of p=0.05. RESULTS: No significant difference was found between human and bovine teeth (p=0.35), either for enamel (p=0.07) or for dentin (p=0.93) substrates. Low to moderate heterogeneity was found on the meta-analysis. All included studies in the systematic review scored between medium and high risk of bias. CONCLUSIONS: Bovine teeth can be a reliable substitute for human ones on bond strength studies of adhesive systems to both enamel and dentin substrates.

Effect of air abrasion and polishing on primary molar fissures.

AIM: To evaluate the effect of air abrasion and polishing on primary molar fissures under light microscopy. METHODS: 15 exfoliated primary second molars were longitudinally sectioned and photographed under a stereomicroscope (40×; baseline evaluation). Sections were then randomly allocated into one of the two groups (n = 15) and treated by either air abrasion (aluminium oxide jet) or air polishing (sodium bicarbonate jet) for 30 s. After treatment, sections were washed with an air/water spray, dried with absorbent paper, and photographed as previously described (final evaluation). Baseline and final morphology were compared by two blinded examiners who evaluated changes in the width and depth of fissures. STATISTICS: The percentage of changed fissures was analysed, and the two treatments were compared using the Mann-Whitney test (α = 0.01). RESULTS: Both air systems resulted in fissure changes in most (93.3 %) of the sections. No significant differences in fissure width changes were found between treatments, but when changes in fissure depth were evaluated, air polishing was found to be less damaging than air abrasion (p < 0.01). CONCLUSION: Air abrasion and polishing cause changes to the anatomical configuration of occlusal fissures of primary molars.

Erosive effects of beverages in the presence or absence of caries simulation by acidogenic challenge on human primary enamel: an in vitro study.

AIM: To evaluate in vitro the erosive effects of beverages in the presence or absence of caries simulation (acidogenic challenge) on the microhardness of primary enamel. METHODS: Forty human primary teeth were submitted to the erosive effects: 3 × 20-min-long daily immersion in fresh orange juice (orange group), strawberry yogurt drink (yog group), or cola soft drink (cola group) separately or in combination with acidogenic challenge (pH cycling for 10 days). Specimens were also submitted to acidogenic challenge alone, and in the negative control group specimens were not submitted to any treatment. Mineral loss was evaluated by cross-sectional microhardness determination. The data (Knoop hardness numbers, KHN) were subjected to 2-way analysis of variance and Tukey's post hoc test (α = 0.05%). RESULTS: All the test beverages significantly reduced the sample cross-sectional enamel hardness (KHN ± SD, 235.93 ± 18.15, 257.23 ± 21.79, and 253.23 ± 13.86 in the orange, yog, and cola groups, respectively) compared to samples in the negative control group (290.27 ± 3.92). In vitro acidogenic challenge exacerbated the mineral loss induced by all beverages (166.02 ± 4.28, 190.43 ± 17.55, and 198.39 ± 21.39 in the orange, yog, and cola groups combined to acidogenic challenge, respectively) compared to acidogenic challenge alone. CONCLUSIONS: All beverages exhibited erosive effects on primary enamel. Simulated caries challenge considerably exacerbated the enamel softening of primary teeth.

Comparison of validation methods for the diagnosis of occlusal caries in primary molars.

AIM: To evaluate the reproducibility of 7 validation methods used for caries diagnosis in primary teeth. METHODS: Seventy-two occlusal sites were selected on 40 primary molars. The sites were evaluated independently by 3 experienced examiners using validation methods that involved direct assessment, i.e. by using a (1) magnifying glass (8×) and (2) stereomicroscope (35×), or indirect assessment i.e. by using (3) photographs, (4) slide projections of photographs, (5) stereomicroscope (35×) photographs, (6) stereomicroscope (35×) slide projections, and (7) projections of polarised light microscope slides. Cohen's kappa coefficients were calculated and subjected to the Kruskal-Wallis test at a significance level of 5%. RESULTS: The mean inter-examiner kappa values for the validation methods were 0.31-0.51. There were statistically significant differences (p<0.05) between methods 1 and 3, 1 and 4, 2 and 4, 4 and 5, 4 and 6, and 4 and 7. Moderate agreement was observed for all methods except methods 1 and 4, for which the agreement was fair. CONCLUSIONS: The inter-examiner agreement for all validation methods for caries diagnosis was moderate, except for the method based on indirect assessment by slide projection, which showed low agreement.

Fluorescence of primary dentine after chemomechanical and conventional rotary excavation.

AIM: This was to compare fluorescence values of dentine remaining after caries removal using chemomechanical systems and conventional rotary methods. STUDY DESIGN: In vitro study. METHODS: 30 extracted primary teeth with proximal carious cavities were divided into three groups according to caries removal method: Carisolv, Papacarie and conventional low speed rotary burs. Carious (initial) and remaining (final) dentine evaluations were assessed by visual-tactile examination and DIAGNOdent. Transversal microhardness (TMH) of remaining dentine was evaluated. Fluorescence and TMH values were submitted to two-way ANOVA and the post hoc Tukey test (alpha = 0.05) and Pearson's linear correlation. RESULTS: Two-way ANOVA revealed that fluorescence values were similar between conventional rotary excavation, Carisolv and Papacarie groups (p = 0.0542). No statistically significant differences (p = 0.1147) were found to TMH values. No correlation was found between fluorescence and TMH values (r = -0.0273). CONCLUSION: All caries excavation methods resulted in similar remaining dentine fluorescence values. No correlation was found between fluorescence values and TMH of remaining dentine.

In vivo effectiveness of laser fluorescence compared to visual inspection and radiography for the detection of occlusal caries in primary teeth.

The purpose of this study was to evaluate the in vivo effectiveness of laser fluorescence compared to visual inspection and radiography for the detection of occlusal caries in primary teeth. Fifty sites from 30 molars in 29 patients were selected and evaluated under standardized conditions by 2 previously trained examiners according to the 3 diagnostic methods. Histological examination served as gold standard after exfoliation or extraction. Values obtained for sensitivity, specificity and accuracy were 0.60, 0.90 and 0.73 for laser fluorescence, 0.82, 0.85 and 0.84 for visual inspection and 0.62, 0.73 and 0.67 for radiography, respectively. Considering only dentinal caries, values were 0.73, 0.95 and 0.90 for laser fluorescence, 0.61, 1.00 and 0.90 for visual inspection and 0.96, 0.81 and 0.85 for radiography, respectively. We conclude that for the detection of occlusal caries in primary molars laser fluorescence presents a similar accuracy when compared to visual inspection and radiography, although visual inspection showed better values for sensitivities for both enamel and dentin lesions.

Protocol for rapid fetal sex determination in chorionic villus through polimerase chain reaction.

Determination of fetal sex is essential for prenatal diagnosis of sex-related disorders as congenital adrenal hyperplasia and androgen insensitivity syndrome. Molecular biology has provided the opportunity to analyze genes that identify the presence of Y chromosome through easier and faster methodology than conventional cytogenetics techniques. We used DNA extracted from 8 chorionic villus biopsies, performed at 10-12 weeks of gestation to amplify a 778 bp fragment that corresponds to the coding sequence of the SRY gene to determine fetal sex (primers XES10, XES11). As a internal control of the PCR we also amplified in the same reaction a 650 bp fragment from the exon 6-8 of 21-hydroxylase active gene-CYP21 (primers 5'GAGGGATCACATCGTCGTGGAGATG3' and 5'TTCGTGGTCTAGCTCCTCCTG3'). The PCR protocol was: 94 degrees C-2 min followed by 32 cycles of 94 degrees C-1 min; 63 degrees C-1 min; 72 degrees C-2 min and a extension cycle of 72 degrees C-10 min. The karyotype was performed in chorionic villus biopsies cultures confirm PCR results. In one case the material was not sufficient for karyotyping. This protocol was tested in 200 DNA blood samples from males and females and provided CYP21B amplification in all of them as well as the expected SRY amplification in the males. CYP21B was amplified in all samples. SRY gene in 8 samples of chorionic villus biopsies was positive in 3 male and negative in 5 female fetuses. The fetal sex was confirmed by karyotype or after birth. We conclude that this protocol provides an easy, fast and safe fetal sex determination method.