Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 51
Filtrar
Más filtros

País/Región como asunto
País de afiliación
Intervalo de año de publicación
1.
Cien Saude Colet ; 29(3): e01762023, 2024 Mar.
Artículo en Portugués, Inglés | MEDLINE | ID: mdl-38451637

RESUMEN

Quilombolas are ethnic-racial groups, of black ancestry, and had their territories consolidated in Brazil in regions with difficult access and far from large centers. The objective of this study is to know the therapeutic itinerary (IT) adopted by quilombola women in traditional communities located in the North of the state of Minas Gerais. This is a qualitative study with the theoretical model using the Arthur Kleinman health care system. The study scenario was 23 quilombola communities in northern Minas Gerais. Forty quilombola women aged between 25 and 89 years were interviewed. Data analysis was performed following the IT. Units of analysis emerged that were grouped into three categories: quilombola women and the meaning of health and care; the professional care system in quilombola communities; and route of care in situations experienced by women. The therapeutic itinerary of the communities is mainly related to the actions of popular medicine. It was also possible to observe that there are weaknesses in relation to health care due to factors such as difficulty of access to institutionalized services.


Os quilombolas são grupos étnico-raciais de ancestralidade negra e tiveram seus territórios consolidados no Brasil em regiões com acesso difícil e distante dos grandes centros. O objetivo desse estudo é conhecer o itinerário terapêutico (IT) adotado por mulheres quilombolas em comunidades tradicionais localizadas no norte do estado de Minas Gerais. Trata-se de um estudo com abordagem qualitativa com o modelo teórico utilizando o sistema de cuidados à saúde de Arthur Kleinman. O estudo se deu em 23 comunidades quilombolas do norte de Minas Gerais. Foram entrevistadas 40 mulheres quilombolas, com idades entre 25 e 89 anos. A análise dos dados foi realizada seguindo os IT. Emergiram unidades de análise que foram agrupadas em três categorias: as mulheres quilombolas e o significado da saúde e do cuidado; o sistema de cuidado profissional nas comunidades quilombolas; e itinerário de cuidados nas situações vivenciadas pelas mulheres. O itinerário terapêutico das comunidades se mostra relacionado principalmente às ações de medicina popular. Foi possível observar ainda que existem fragilidades em relação à atenção à saúde devido a fatores como dificuldade de acesso aos serviços institucionalizados.


Asunto(s)
Medicina , Femenino , Humanos , Adulto , Persona de Mediana Edad , Anciano , Anciano de 80 o más Años , Brasil , Análisis de Datos , Instituciones de Salud , Investigación Cualitativa
2.
Cad Saude Publica ; 38(12): e00082521, 2023.
Artículo en Portugués | MEDLINE | ID: mdl-36629610

RESUMEN

Quilombola men perform productive activities that require great physical strength in environments conducive to several risks, accidents, and health problems. This study aimed to map the work processes of quilombola men in three locations in Norte de Minas region in the State of Minas Gerais, Brazil, using the methodological framework of Cartography proposed by Gilles Deleuze & Félix Guattari. Data were produced by the observation of work processes, individual interviews, and records of the effects in a mapping diary. Discourse analysis Allowed for the elaboration of a descriptor flowchart and the definition of three thematic categories. In the mapped locations, the intersection of gender, ethnicity, and class collaborates directly for the performance of activities in charcoal furnaces, quarries, and banana plantations. These environments are highly unhealthy due to the presence of heat and smoke, methods that demand great physical effort and produce silica dust, excessive sun exposure, and the use of pesticides. The integration between the workers' health surveillance (VISAT) and the Brazilian Public Labor Prosecutor Office allows for the articulation of an intersectoral network of popular education, technical assistance, and professional training and qualification. These measures will directly affect the health-disease process, the quality of life of workers, and the environmental preservation of the mapped locations.


Os homens quilombolas exercem atividades produtivas que exigem grande força física, em ambientes propiciadores de diversos riscos, acidentes e agravos à saúde. O objetivo deste estudo foi cartografar os processos de trabalho de homens quilombolas em três territórios da região Norte de Minas, no Estado de Minas Gerais, Brasil. Para sua construção, utilizamos o referencial metodológico da Cartografia proposto pelos filósofos Gilles Deleuze & Félix Guattari. Os dados foram produzidos por meio da observação dos processos de trabalho, entrevistas individuais e registros das afetações em um diário cartográfico. A Análise de Discurso possibilitou a elaboração de um fluxograma descritor e a definição de três categorias temáticas. Nos territórios rastreados, a intersecção de gênero, raça e classe colabora diretamente para a execução de atividades na carvoaria, pedreira e bananal. Esses ambientes são altamente insalubres, com presença de calor e fumaça, métodos que geram grande esforço físico e poeira de sílica, exposição excessiva ao sol e uso de agrotóxicos. A integração entre a vigilância em saúde do trabalhador (VISAT) e o Ministério Público do Trabalho permite a articulação de uma rede intersetorial de educação popular, assistência técnica, qualificação e capacitação profissional. Essas medidas terão impacto direto no processo saúde-doença, na qualidade de vida dos trabalhadores e na preservação ambiental dos territórios cartografados.


Los hombres quilombolas realizan actividades productivas que requieren una gran fuerza física, en entornos que conllevan diversos riesgos, accidentes y peligros para la salud. El objetivo de este estudio fue cartografiar los procesos de trabajo de los hombres quilombolas en tres territorios de la región Norte de Minas en el estado de Minas Gerais, Brasil. Para su construcción, hemos utilizado el marco metodológico de la Cartografía propuesto por los filósofos Gilles Deleuze & Félix Guattari. Los datos se produjeron mediante la observación de los procesos de trabajo, las entrevistas individuales y el registro de los efectos en un diario cartográfico. El Análisis del Discurso permitió elaborar un organigrama descriptivo y definir tres categorías temáticas. En los territorios rastreados, la intersección de género, raza y clase colabora directamente con la realización de actividades de producción de carbón vegetal, canteras y plantaciones de plátanos. Estos entornos son altamente insalubres, con presencia de calor y humo, métodos que generan gran esfuerzo físico y polvo de sílice, exposición excesiva al sol y uso de agroquímicos. La integración entre la vigilancia de la salud de los trabajadores (VISAT) y la Fiscalía del Trabajo permite la articulación de una red intersectorial de educación popular, asistencia técnica, calificación profesional y formación. Estas medidas tendrán un impacto directo en el proceso salud-enfermedad, en la calidad de vida de los trabajadores y en la preservación medioambiental de los territorios cartografiados.


Asunto(s)
Salud Laboral , Calidad de Vida , Masculino , Humanos , Brasil , Conductas Relacionadas con la Salud , Etnicidad
3.
Cien Saude Colet ; 28(6): 1831-1841, 2023 Jun.
Artículo en Portugués | MEDLINE | ID: mdl-37255159

RESUMEN

The scope of this article is to assess the prevalence and factors associated with Common Mental Disorders (CMD) in "quilombolas" (Afro-Brazilian residents of quilombo settlements) in rural communities located in the North of Minas Gerais, Brazil. It is a cross-sectional study of 2019 based on structured interviews and application of a Self-Reporting Questionnaire (SRQ-20). Binary logistic regression was conducted. The prevalence of CMD was 38.7%. There was a higher preponderance of CMD among female quilombolas (OR: 2.69; 95%CI 2.00-3.62), with 1 to 8 years of schooling (OR: 1.70; 95%CI 1.15-2,51), family income of 1 to 1,5 minimum wages (OR: 2.51; 95%CI 1.60-3.94); who suffered discrimination in health services (OR: 2.44; 95%CI 1.44-4.13); with self-reported lung disease (OR: 2.10; 95%CI 1.25-3.54), heart disease (OR: 1.58; 95%CI 1.01-2.50) chronic renal failure (OR: 1.97; 95%CI 1.08-3.94), and negative self-perception of health (OR: 3.07; 95%CI 2.31-4.07). The high prevalence of CMD revealed in this study demonstrates the need for mental health care policies aimed at vulnerable populations, such as quilombola communities, in order to mitigate mental suffering and promote professional contextualized care for the idiosyncrasies of health and living conditions of this population group.


O objetivo deste artigo é avaliar a prevalência e fatores associados aos Transtornos Mentais Comuns (TMC) em quilombolas residentes em comunidades rurais localizadas no norte de Minas Gerais, Brasil. Trata-se de estudo transversal realizado em 2019 a partir de entrevistas estruturadas e aplicação do Self Reporting Questionnaire (SRQ-20). Foi conduzida regressão logística binária. A prevalência de TMC foi de 38,7%. Houve maior chance de TMC entre quilombolas do sexo feminino (OR: 2,69; IC95% 2,00-3,62), com 1 a 8 anos de estudo (OR: 1,70; IC95% 1,15-2,51), renda familiar entre 1 a 1,5 salário mínimo (OR: 2,51; IC95% 1,60-3,94); que sofreram discriminação em serviços de saúde (OR: 2,44; IC95% 1,44-4,13); com autorrelato de doença pulmonar (OR: 2,10; IC95% 1,25-3,54), doença cardíaca (OR: 1,58; IC95% 1,01-2,50) e insuficiência renal crônica (OR: 1,97; IC95% 1,08-3,94), e com autopercepção de saúde negativa (OR: 3,07; IC95% 2,31-4,07). A alta prevalência de TMC observada neste estudo demonstra a necessidade de políticas de atenção à saúde mental voltadas para as populações vulnerabilizadas, como as comunidades quilombolas, a fim de mitigar o sofrimento mental e favorecer uma atenção profissional contextualizada com as singularidades das condições de vida e saúde desse grupo populacional.


Asunto(s)
Trastornos Mentales , Población Rural , Humanos , Femenino , Brasil/epidemiología , Estudios Transversales , Trastornos Mentales/epidemiología , Trastornos Mentales/psicología , Renta , Prevalencia
4.
Support Care Cancer ; 20(11): 2679-85, 2012 Nov.
Artículo en Inglés | MEDLINE | ID: mdl-22314971

RESUMEN

PURPOSE: In the present study, we analyzed sociodemographical and clinical factors, and the Eastern Cooperative Oncology Group performance status (ECOG-PS) scale in head and neck squamous cell carcinoma (HNSCC) patients. We evaluated the impact of a range of variables on overall survival. METHODS: We investigated a sample of HNSCC patients (n = 671), using sociodemographical and clinical information, and survival data collected from a review of epidemiological, clinical, and treatment reports. Statistical associations were analyzed by bivariate and multivariate statistical tests. Statistical significance was set at p < 0.05. RESULTS: Of patients 85.4% recorded good ECOG-PS scores. Poor ECOG-PS scores were associated with the covariates indicative of dysphagia [odd ratios (OR) = 2.660, CI 95% = 1.661­4.260, p = 0.000] and large-size malignant disease (T3­T4; OR = 5.337, CI 95% = 2.251­12.652, p = 0.000). Overall survival analysis revealed that ECOG-PS scores (OR = 1.879, CI 95% = 1.162­3.038, p = 0.010), tumor size (OR = 1.665, CI 95% = 1.035­2.680, p = 0.036), and the presence of cervical metastasis (OR = 3.145, CI 95% = 2.008­4.926, p = 0.000) were independent predictors. CONCLUSION: Evaluation of physical consumption in head and neck cancer patients at diagnosis may indicate a more aggressive type of malignant disease. Thus, the ECOG-PS scale may help to identify HNSCC patients in need of rapid referral, who may benefit from specific therapeutic and rehabilitative interventions.


Asunto(s)
Carcinoma de Células Escamosas/patología , Trastornos de Deglución/etiología , Neoplasias de Cabeza y Cuello/patología , Índice de Severidad de la Enfermedad , Adulto , Anciano , Anciano de 80 o más Años , Femenino , Humanos , Masculino , Persona de Mediana Edad , Análisis Multivariante , Metástasis de la Neoplasia , Estudios Retrospectivos , Análisis de Supervivencia , Adulto Joven
5.
Gene ; 800: 145839, 2021 Oct 20.
Artículo en Inglés | MEDLINE | ID: mdl-34274470

RESUMEN

COVID-19 was first reported in Wuhan, China, in December 2019. It is widely accepted that the world will not return to its prepandemic normality until safe and effective vaccines are available and a global vaccination program has been successfully implemented. Antisense RNAs are single-stranded RNAs that occur naturally or are synthetic and enable hybridizing and protein-blocking translation. Therefore, the main objective of this study was to identify target markers in the RNA of the severe acute respiratory syndrome coronavirus, or SARS-CoV-2, with a length between 21 and 28 bases that could enable the development of vaccines and therapies based on antisense RNA. We used a search algorithm in C language to compare 3159 complete nucleotide sequences from SARS-CoV-2 downloaded from the repository of the National Center for Biotechnology Information. The objective was to verify whether any common sequences were present in all 3159 strains of SARS-CoV-2. In the first of three datasets (SARS-CoV-2), the algorithm found two sequences each of 21 nucleotides (Sequence 1: CTACTGAAGCCTTTGAAAAAA; Sequence 2: TGTGGTTATACCTACTAAAAA). In the second dataset (SARS-CoV) and third dataset (MERS-CoV), no sequences of size N between 21 and 28 were found. Sequence 1 and Sequence 2 were input into BLAST® ≫ blastn and recognized by the platform. The gene identified by the sequences found by the algorithm was the ORF1ab region of SARS-CoV-2. Considerable progress in antisense RNA research has been made in recent years, and great achievements in the application of antisense RNA have been observed. However, many mechanisms of antisense RNA are not yet understood. Thus, more time and money must be invested into the development of therapies for gene regulation mediated by antisense RNA to treat COVID-19 as no effective therapy for this disease has yet been found.


Asunto(s)
COVID-19/genética , ARN sin Sentido/genética , SARS-CoV-2/genética , Algoritmos , COVID-19/virología , Simulación por Computador , Regulación Viral de la Expresión Génica , Humanos
6.
Epidemiol Serv Saude ; 30(3): e2020833, 2021.
Artículo en Inglés, Portugués | MEDLINE | ID: mdl-34431957

RESUMEN

OBJECTIVE: To analyze the prevalence of abdominal obesity and associated factors in quilombola communities in Northern Minas Gerais, Brazil. METHODS: This was a cross-sectional study conducted in 2019 through structured interviews and waist circumference measurement; Poisson regression was used, separated by gender, to calculate prevalence ratios (PR) of abdominal obesity adjusted by independent variables and 95% confidence interval (95%CI). RESULTS: 56.6% (95% CI 50.9;62.0) of the observed quilombolas presented abdominal obesity; in the adjusted analysis, among men, there was an association of the outcome with age ≥60 years old (60-69 years old: PR=2.52 - CI95% 1.33; 4.75), not being a smoker (PR=1.73 - 95%CI 1.17;2.55) and reported arterial hypertension (PR=1.42 - 95%CI 1.11;1.80), while in women, it was associated with age ≥50 years old (50-59 years old: PR=1.25 - 95% CI 1.01;1.54), smoking cessation (PR=1.26 - 95% CI 1.00; 1.58), consumption of chicken with skin (PR=1.09 - 95% CI 1.00;1.19) and hypertension (PR=1.22 - 95% CI 1.11;1.36). CONCLUSION: There was high prevalence of abdominal obesity among quilombolas. It was higher in the elderly, smokers, former smokers and those with hypertension.


Asunto(s)
Obesidad Abdominal , Anciano , Índice de Masa Corporal , Brasil/epidemiología , Estudios Transversales , Femenino , Humanos , Masculino , Persona de Mediana Edad , Obesidad/epidemiología , Obesidad Abdominal/epidemiología
7.
Rev Bras Enferm ; 63(1): 117-21, 2010.
Artículo en Portugués | MEDLINE | ID: mdl-20339765

RESUMEN

This study aimed at determining which educational models have been applied to the activities health education. This is a review of literature on the topic Models of Education and Health Education, using as reference contemporary books of specialists in the field of education and journals on such topics available in major databases. The results showed that the Traditional Model of health education aims to transfer the knowledge and experience of the educator, giving a paramount importance to the content taught, hoping that the students absorb unchanged and faithfully reproduce. The model based on dialogue understands the in health education as a process of awareness, change and transformation, characterized by a philosophy of emancipatory subject.


Asunto(s)
Educación en Salud , Modelos Educacionales
8.
Cien Saude Colet ; 25(10): 3847-3855, 2020 Oct.
Artículo en Portugués, Inglés | MEDLINE | ID: mdl-32997017

RESUMEN

Physical activity is a complex behavior influenced by sociodemographic and clinical factors. A better understanding of the relationships between these factors is essential to better understanding their influence on physical activity. The objective of this study was to examine the association between socioeconomic status, age, body fat, and depressive symptoms and level of physical activity among adults. We conducted a cross-sectional population-based study with 808 individuals to examine the interrelations between the above factors and their influence on level of physical activity using path analysis. Age had a significant direct negative effect on level of physical activity (ß = -0.113, p < 0.004) and a significant positive effect on body fat (ß = 0.376, p < 0.001). Depressive symptoms were negatively influenced by socioeconomic status (ß = -0.126, p < 0.001) and positively influenced by age (ß = 0.244, p < 0.001) and body fat (ß = 0.169; p < 0.004). Socioeconomic status, body fat and depressive symptoms did not directly influence level of physical activity. This study concludes that level of physical activity declines with advancing age.


A atividade física é um comportamento complexo e influenciado por variáveis sociodemográficas e clínicas. A melhor compreensão desses fatores possibilita considerar a associação deles com a atividade física. O objetivo deste estudo foi estimar os efeitos do nível socioeconômico, idade, gordura corporal e sintomas depressivos na frequência de atividade física entre adultos. Trata-se de um estudo transversal de base populacional conduzido com 808 indivíduos. Foram avaliadas as inter-relações entre as variáveis nível socioeconômico, idade, gordura corporal e sintomas depressivos no nível de atividade física total, por meio da técnica "path analysis". Observou-se efeito direto negativo e significativo da idade (ß = -0,113; p < 0,004) nos níveis de atividade física. A idade (ß = 0,376; p < 0,001) influenciou a gordura corporal, com efeito positivo e significativo. Os sintomas de depressão foram influenciados negativamente pelo nível socioeconômico (ß = -0,126; p < 0,001) e positivamente pela idade (ß = 0,244; p < 0,001) e gordura corporal (ß = 0,169; p < 0,004). O nível socioeconômico, a gordura corporal e os sintomas depressivos não influenciaram diretamente os níveis de atividade física. Concluindo, os resultados mostraram que o avançar da idade contribui para a redução da prática de atividade física.


Asunto(s)
Depresión , Ejercicio Físico , Tejido Adiposo , Adulto , Estudios Transversales , Depresión/epidemiología , Humanos , Clase Social , Factores Socioeconómicos
9.
Rev Bras Enferm ; 73(1): e20180513, 2020.
Artículo en Inglés, Portugués | MEDLINE | ID: mdl-32049248

RESUMEN

OBJECTIVE: To verify the prevalence of common mental disorders and associated factors in nursing technicians. METHOD: Cross-sectional analytical study conducted at a university hospital. A questionnaire with sociodemographic, educational and work-related variables and the Self Reporting Questionnaire-20 were used to verify the presence of common mental disorders. Association analysis was performed using the chi-squared test, with a significance level of 5%. RESULTS: 280 nursing technicians participated in the study. The prevalence of common mental disorders was 46.9%. The variables family income (p=0.021) and working exclusively in health area (p<0.001) were associated with the outcome. There was a higher prevalence of CMD among individuals with a family income below four minimum wages (PR=1.41) and among professionals who worked exclusively in the health area (PR=1.95). CONCLUSION: Approximately half of the nursing technicians of the university hospital presented common mental disorders, which were associated with economic and work-related variables.


Asunto(s)
Auxiliares de Urgencia/psicología , Trastornos Mentales/diagnóstico , Adulto , Brasil , Estudios Transversales , Auxiliares de Urgencia/estadística & datos numéricos , Femenino , Hospitales Universitarios/organización & administración , Hospitales Universitarios/estadística & datos numéricos , Humanos , Masculino , Trastornos Mentales/epidemiología , Trastornos Mentales/psicología , Persona de Mediana Edad , Prevalencia , Encuestas y Cuestionarios
10.
Ciênc. Saúde Colet. (Impr.) ; 29(3): e01762023, 2024.
Artículo en Portugués | LILACS-Express | LILACS | ID: biblio-1534177

RESUMEN

Resumo Os quilombolas são grupos étnico-raciais de ancestralidade negra e tiveram seus territórios consolidados no Brasil em regiões com acesso difícil e distante dos grandes centros. O objetivo desse estudo é conhecer o itinerário terapêutico (IT) adotado por mulheres quilombolas em comunidades tradicionais localizadas no norte do estado de Minas Gerais. Trata-se de um estudo com abordagem qualitativa com o modelo teórico utilizando o sistema de cuidados à saúde de Arthur Kleinman. O estudo se deu em 23 comunidades quilombolas do norte de Minas Gerais. Foram entrevistadas 40 mulheres quilombolas, com idades entre 25 e 89 anos. A análise dos dados foi realizada seguindo os IT. Emergiram unidades de análise que foram agrupadas em três categorias: as mulheres quilombolas e o significado da saúde e do cuidado; o sistema de cuidado profissional nas comunidades quilombolas; e itinerário de cuidados nas situações vivenciadas pelas mulheres. O itinerário terapêutico das comunidades se mostra relacionado principalmente às ações de medicina popular. Foi possível observar ainda que existem fragilidades em relação à atenção à saúde devido a fatores como dificuldade de acesso aos serviços institucionalizados.


Abstract Quilombolas are ethnic-racial groups, of black ancestry, and had their territories consolidated in Brazil in regions with difficult access and far from large centers. The objective of this study is to know the therapeutic itinerary (IT) adopted by quilombola women in traditional communities located in the North of the state of Minas Gerais. This is a qualitative study with the theoretical model using the Arthur Kleinman health care system. The study scenario was 23 quilombola communities in northern Minas Gerais. Forty quilombola women aged between 25 and 89 years were interviewed. Data analysis was performed following the IT. Units of analysis emerged that were grouped into three categories: quilombola women and the meaning of health and care; the professional care system in quilombola communities; and route of care in situations experienced by women. The therapeutic itinerary of the communities is mainly related to the actions of popular medicine. It was also possible to observe that there are weaknesses in relation to health care due to factors such as difficulty of access to institutionalized services.

11.
Rev. bras. geriatr. gerontol. (Online) ; 26: e220191, 2023. tab, graf
Artículo en Portugués | LILACS | ID: biblio-1441282

RESUMEN

Resumo Objetivo investigar a autopercepção das condições bucais e fatores associados em idosos quilombolas rurais do norte de Minas Gerais, Brasil. Método Trata-se de um estudo analítico e transversal de base populacional, no qual utilizou-se uma amostragem por conglomerados com probabilidade proporcional ao tamanho (n=406). A coleta de dados envolveu a realização de entrevistas e exames clínicos odontológicos. A autopercepção das condições bucais foi avaliada por meio do GOHAI (Índice de Determinação da Saúde Bucal Geriátrica). Resultados A maioria dos idosos autopercebeu a saúde bucal como ótima (46,3%) ou regular (30,2%). Os pesquisados revelaram ainda precária saúde bucal e acesso restrito aos serviços odontológicos. Verificaram-se, na análise múltipla, associações significantes (p˂0,05) entre GOHAI regular e variáveis relativas ao local da última consulta e uso de prótese, bem como entre GOHAI ruim e variáveis atinentes ao estado conjugal, religião, motivo da última consulta, índice CPO-D e uso de prótese. Conclusão Parcela expressiva dos idosos quilombolas manifestou uma autoavaliação mais positiva da saúde bucal, divergente do quadro odontológico constatado profissionalmente. Constatou-se ainda que o relato de percepção ruim das condições bucais esteve fortemente associado a uma saúde bucal mais precária entre os investigados.


Abstract Objective to investigate self-perception of oral conditions and associated factors in rural quilombola older people in northern Minas Gerais, Brazil. Method This is an analytical and cross-sectional population-based study, in which cluster sampling with probability proportional to size (n=406) was used. Data collection involved conducting interviews and clinical dental examinations. Self-perception of oral conditions was assessed using the GOHAI (Geriatric Oral Health Determination Index). Results Most older people self-perceived oral health as excellent (46.3%) or regular (30.2%). Those surveyed also revealed precarious oral health and restricted access to dental services. In the multiple analysis, significant associations (p˂0.05) were found between regular GOHAI and variables related to the location of the last consultation and use of prosthesis, as well as between poor GOHAI and variables related to marital status, religion, reason for last consultation, CPO-D index and use of prosthesis. Conclusion A significant portion of the quilombola older people showed a more positive self-assessment of oral health, which differs from the professionally verified dental condition. It was also found that the report of poor perception of oral conditions was strongly associated with poorer oral health among those investigated.


Asunto(s)
Humanos , Masculino , Femenino , Persona de Mediana Edad , Anciano , Anciano de 80 o más Años , Autoimagen , Servicios de Salud Dental , Odontología Geriátrica , Brasil , Salud Bucal/etnología , Cuidado Dental para Ancianos , Diagnóstico Bucal , Autoevaluación Diagnóstica , Accesibilidad a los Servicios de Salud/organización & administración
12.
Ciênc. Saúde Colet. (Impr.) ; 28(6): 1831-1841, jun. 2023. tab
Artículo en Portugués | LILACS-Express | LILACS | ID: biblio-1439847

RESUMEN

Resumo O objetivo deste artigo é avaliar a prevalência e fatores associados aos Transtornos Mentais Comuns (TMC) em quilombolas residentes em comunidades rurais localizadas no norte de Minas Gerais, Brasil. Trata-se de estudo transversal realizado em 2019 a partir de entrevistas estruturadas e aplicação do Self Reporting Questionnaire (SRQ-20). Foi conduzida regressão logística binária. A prevalência de TMC foi de 38,7%. Houve maior chance de TMC entre quilombolas do sexo feminino (OR: 2,69; IC95% 2,00-3,62), com 1 a 8 anos de estudo (OR: 1,70; IC95% 1,15-2,51), renda familiar entre 1 a 1,5 salário mínimo (OR: 2,51; IC95% 1,60-3,94); que sofreram discriminação em serviços de saúde (OR: 2,44; IC95% 1,44-4,13); com autorrelato de doença pulmonar (OR: 2,10; IC95% 1,25-3,54), doença cardíaca (OR: 1,58; IC95% 1,01-2,50) e insuficiência renal crônica (OR: 1,97; IC95% 1,08-3,94), e com autopercepção de saúde negativa (OR: 3,07; IC95% 2,31-4,07). A alta prevalência de TMC observada neste estudo demonstra a necessidade de políticas de atenção à saúde mental voltadas para as populações vulnerabilizadas, como as comunidades quilombolas, a fim de mitigar o sofrimento mental e favorecer uma atenção profissional contextualizada com as singularidades das condições de vida e saúde desse grupo populacional.


Abstract The scope of this article is to assess the prevalence and factors associated with Common Mental Disorders (CMD) in "quilombolas" (Afro-Brazilian residents of quilombo settlements) in rural communities located in the North of Minas Gerais, Brazil. It is a cross-sectional study of 2019 based on structured interviews and application of a Self-Reporting Questionnaire (SRQ-20). Binary logistic regression was conducted. The prevalence of CMD was 38.7%. There was a higher preponderance of CMD among female quilombolas (OR: 2.69; 95%CI 2.00-3.62), with 1 to 8 years of schooling (OR: 1.70; 95%CI 1.15-2,51), family income of 1 to 1,5 minimum wages (OR: 2.51; 95%CI 1.60-3.94); who suffered discrimination in health services (OR: 2.44; 95%CI 1.44-4.13); with self-reported lung disease (OR: 2.10; 95%CI 1.25-3.54), heart disease (OR: 1.58; 95%CI 1.01-2.50) chronic renal failure (OR: 1.97; 95%CI 1.08-3.94), and negative self-perception of health (OR: 3.07; 95%CI 2.31-4.07). The high prevalence of CMD revealed in this study demonstrates the need for mental health care policies aimed at vulnerable populations, such as quilombola communities, in order to mitigate mental suffering and promote professional contextualized care for the idiosyncrasies of health and living conditions of this population group.

13.
Rev. bras. educ. méd ; 45(4): e200, 2021. tab
Artículo en Inglés | LILACS-Express | LILACS | ID: biblio-1347178

RESUMEN

Abstract: Introduction: Patient-centered care has been associated with positive results in medical practice. Objective: The aim of this study was to evaluate the attitudes of students and teachers from a Brazilian medical school regarding the physician-patient relationship and verify associated factors. Methods: This was an analytical cross-sectional study carried out in a public university, using the PPOS "Patient-Practitioner Orientation Scale" as well as a sociodemographic questionnaire. The subjects were regularly enrolled students attending the second semester of 2015 and their teachers. Mann-Whitney and Kruskal-Wallis tests were used to examine the effect of sociodemographic variables and the interaction with the scores found for students and teachers. Results: A total of 212 students were surveyed, corresponding to 57.1% of the enrolled students in the medical course. The value of the total PPOS score found for the students was 4.35 (± 0.5 SD), and the mean total score of PPOS among female students (4.43) was significantly higher than that in males (4.23) (p < 0.001), indicating more patient-centered attitudes in that group. Regarding medical teachers, 77 (56%) participated. The total score of PPOS was 4.52 (± 0.5 SD), with a more patient-centered attitude among teachers in comparison to students (4.35) (p = 0.001). However, there is a clear need for progress in both groups. Conclusion: The analysis of the students' and teachers' attitudes about the physician-patient relationship disclosed an unknown scenario, with more patient-centered attitudes verified among teachers despite the need for improvements by both. Further research is needed to evaluate not only the attitude but the behavior of these subjects.


Resumo: Introdução: O cuidado centrado no paciente tem sido associado a resultados positivos. Objetivo: o objetivo deste estudo foi avaliar atitudes de estudantes e professores de uma faculdade de medicina brasileira quanto à relação médico-paciente e verificar fatores associados. Métodos: Trata-se de um estudo transversal analítico realizado em uma universidade pública, utilizando a PPOS - "Patient-Practitioner Orientation Scale" e um questionário sociodemográfico. Os sujeitos eram estudantes do curso de medicina e professores da instituição em questão no segundo semestre de 2015. Os testes de Mann-Whitney e Kruskal-Wallis foram utilizados para examinar o efeito das variáveis sociodemográficas e a interação com os escores encontrados para estudantes e professores. Resultados: Foram pesquisados 212 estudantes, correspondendo a 57,1% dos acadêmicos matriculados no curso de medicina. O valor do escore total da PPOS encontrado para os estudantes foi de 4,35 (± 0,5 DP), e o escore total médio da PPOS entre estudantes do sexo feminino (4,43) foi significativamente maior do que o masculino (4,23) (p <0,001), indicando mais atitudes centradas no paciente naquele grupo. No que se refere aos professores de medicina, 77 (56%) participaram. O escore total do PPOS foi de 4,52 (± 0,5 DP), com atitude mais focada no paciente entre os professores do que entre estudantes (4,35) (p = 0,001), mas há uma clara necessidade de progresso para ambos os grupos. Conclusão: A análise das atitudes de estudantes e professores sobre a relação médico-paciente permitiu desvendar um cenário desconhecido com atitudes mais centradas no paciente observadas entre os professores, apesar da necessidade de melhorias em ambos os grupos. Mais pesquisas são necessárias para avaliar não apenas a atitude, mas o comportamento desses sujeitos.

14.
Interface (Botucatu, Online) ; 25: e200478, 2021. ilus
Artículo en Portugués | LILACS | ID: biblio-1286884

RESUMEN

O estudo mapeou as condições de trabalho de homens quilombolas residentes no norte do estado de Minas Gerais, Brasil. Utilizou-se o método cartográfico proposto por Gilles Deleuze e Félix Guattari. Os dados foram produzidos em 23 comunidades, por meio de entrevistas individuais, observação de campo e registro das afetações em um diário. A análise de discurso possibilitou a construção de três categorias temáticas e a elaboração de um fluxograma descritor das linhas de força do trabalho. A intersecção de raça/etnia, gênero, região, classe e escolaridade colabora para a precariedade e informalidade ocupacional. No trabalho, as linhas flexíveis permitem vivências de prazer e as linhas duras, o desenvolvimento de adoecimento mental. Nesse sentido, as políticas públicas focadas nos quilombolas necessitam de articulação e fortalecimento pelo Estado, além do esforço para a participação de todos os atores envolvidos, principalmente os homens quilombolas. (AU)


This study mapped the working conditions of Quilombola men living in the north of the State of Minas Gerais, Brazil using the cartographic method proposed by Gilles Deleuze and Félix Guattari. The data were produced in 23 communities using individual interviews, field observations and documentation of affectations in a diary. Discourse analysis enabled the construction of three thematic categories and a flow diagram depicting the lines of work force. The intersection between race/ethnicity, gender, region, class, and level of education contributes to employment precariousness and informality. With regard to work, the flexible lines allow experiences of pleasure and the hard lines lead to the development of mental illness. Policies directed at Quilombolas therefore need to be articulated and strengthened by the government and efforts are needed to promote the participation of all actors involved, especially Quilombola men. (AU)


El estudio mapeó las condiciones de trabajo de hombres quilombolas residentes en el norte del Estado de Minas Gerais, Brasil. Se utilizó el método cartográfico propuesto por Gilles Deleuze y Félix Guattari. Los datos se obtuvieron en 23 comunidades, por medio de entrevistas individuales, observación de campo y registro de las afectaciones en un diario. El Análisis de Discurso posibilitó la construcción de tres categorías temáticas y la elaboración de un diagrama de flujo descriptor de las líneas de fuerza del trabajo. La intersección de raza/etnia, género, región, clase y escolaridad colabora para la precariedad e informalidad ocupacional. En el trabajo, las líneas flexibles permiten vivencias de placer y las líneas duras el desarrollo de la enfermedad mental. En ese sentido, las políticas públicas enfocadas en los quilombolas necesitan articulación y fortalecimiento por parte del estado, además del esfuerzo para la participación de todos los actores envueltos, principalmente los hombres quilombolas. (AU)


Asunto(s)
Humanos , Masculino , Salud Mental , Quilombola , Política Pública , Trabajo , Brasil , Factores Sociológicos
15.
Epidemiol. serv. saúde ; 30(3): e2020833, 2021. tab
Artículo en Inglés, Portugués | LILACS | ID: biblio-1286359

RESUMEN

Objetivo: Analisar a prevalência de obesidade abdominal e fatores associados em comunidades quilombolas do norte de Minas Gerais, Brasil. Métodos: Estudo transversal realizado em 2019, a partir de entrevistas estruturadas e mensuração do perímetro da cintura; empregou-se regressão de Poisson, separada por sexo, para calcular razões de prevalência (RP) da obesidade abdominal ajustadas pelas variáveis independentes e intervalo de confiança de 95% (IC95%). Resultados: 56,6% (IC95% 50,9;62,0) dos quilombolas observados apresentaram obesidade abdominal; na análise ajustada, entre homens, verificou-se associação do desfecho com idade de ≥;60 anos (60-69 anos: RP=2,52 - IC95% 1,33;4,75), não ser tabagista (RP=1,73 - IC95% 1,17;2,55) e referir hipertensão arterial (RP=1,42 - IC95% 1,11;1,80), enquanto, nas mulheres, associou-se com idade ≥50 anos (50-59 anos: RP=1,25 - IC95% 1,01;1,54), ex-tabagismo (RP=1,26 - IC95% 1,00;1,58), consumo de frango com pele (RP=1,09 - IC95% 1,00;1,19) e hipertensão (RP=1,22 - IC95% 1,11;1,36). Conclusão: Encontrou-se prevalência de obesidade abdominal alta entre os quilombolas, maior nos idosos, hipertensos, fumantes e ex-fumantes.


Objetivo: Analizar la prevalencia de obesidad abdominal y factores asociados en comunidades quilombolas del norte de Minas Gerais, Brasil. Métodos: Estudio transversal realizado en 2019 a partir de entrevistas y medición de la circunferencia de la cintura; se utilizó la regresión de Poisson para calcular las razones de prevalencia (RP) de la obesidad abdominal ajustadas por variables independientes y un intervalo de confianza del 95% (IC95%). Resultados: 56,6% (IC95% 50,9;62,0) tenía obesidad abdominal; entre los hombres hubo una asociación del resultado con la edad ≥60 años (60-69 años: RP=2,52 - IC95% 1,33;4,75), no fumadores (RP=1,73 - IC95% 1,17;2,55) e hipertensión (RP=1,42; IC95% 1,11;1,80); en las mujeres, se asoció con la edad ≥50 años (50-59 años: RP=1,25 - IC95% 1,01;1,54), exfumadoras (RP=1,26 - IC95% 1,00;1,58), consumo de pollo con piel (RP=1,09 - IC95% 1,00;1,19) e hipertensión (RP=1,22 - IC95% 1,11;1,36). Conclusión: La prevalencia de obesidad abdominal fue alta entre quilombolas, y fue mayor en ancianos, hipertensos, fumadores y exfumadores.


Objective: To analyze the prevalence of abdominal obesity and associated factors in quilombola communities in Northern Minas Gerais, Brazil. Methods: This was a cross-sectional study conducted in 2019 through structured interviews and waist circumference measurement; Poisson regression was used, separated by gender, to calculate prevalence ratios (PR) of abdominal obesity adjusted by independent variables and 95% confidence interval (95%CI). Results: 56.6% (95% CI 50.9;62.0) of the observed quilombolas presented abdominal obesity; in the adjusted analysis, among men, there was an association of the outcome with age ≥60 years old (60-69 years old: PR=2.52 - CI95% 1.33; 4.75), not being a smoker (PR=1.73 - 95%CI 1.17;2.55) and reported arterial hypertension (PR=1.42 - 95%CI 1.11;1.80), while in women, it was associated with age ≥50 years old (50-59 years old: PR=1.25 - 95% CI 1.01;1.54), smoking cessation (PR=1.26 - 95% CI 1.00; 1.58), consumption of chicken with skin (PR=1.09 - 95% CI 1.00;1.19) and hypertension (PR=1.22 - 95% CI 1.11;1.36). Conclusion: There was high prevalence of abdominal obesity among quilombolas. It was higher in the elderly, smokers, former smokers and those with hypertension.


Asunto(s)
Humanos , Masculino , Femenino , Persona de Mediana Edad , Anciano , Índice de Masa Corporal , Obesidad Abdominal , Obesidad/epidemiología , Brasil/epidemiología , Estudios Transversales , Población Negra , Quilombola
16.
Rev. bras. geriatr. gerontol. (Online) ; 23(2): e200146, 2020000. tab
Artículo en Portugués | LILACS-Express | LILACS | ID: biblio-1137801

RESUMEN

Resumo Objetivo: investigar a condição de saúde bucal, o acesso a serviços odontológicos e fatores sociodemográficos associados a essa acessibilidade em idosos quilombolas rurais do norte do estado de Minas Gerais, Brasil. Método: trata-se de um estudo analítico e transversal de base populacional, no qual foi utilizada uma amostragem por conglomerados com probabilidade proporcional ao tamanho (n=406). A coleta de dados envolveu a realização de entrevistas estruturadas e exames clínicos odontológicos. Resultados: verificou-se que a maioria dos idosos possuía baixa renda e baixa escolaridade. Observou-se que parcela expressiva dos indivíduos relatou acesso a um cirurgião-dentista (97,5%) e que havia realizado a última consulta odontológica há três anos ou mais (60,4%). Foi verificado ainda que a maior parte dos idosos era edêntula (52,0%) e que a maioria dos pesquisados necessitava de próteses (88%). Um alto índice CPO-D foi constatado nos indivíduos estudados (valor médio de 27,25). Idade avançada, ausência de companheiro e aposentadoria se mostraram associadas ao acesso irregular aos serviços odontológicos. Conclusão: os idosos quilombolas locais possuíam uma condição precária de saúde bucal e tinham acesso restrito aos serviços odontológicos. Idade, estado conjugal e situação laboral demonstraram associação com baixa acessibilidade aos serviços de saúde bucal nos idosos investigados.


Abstract Objective:: to investigate the oral health conditions, access to dental services and sociodemographic factors associated with this acessibility in rural quilombolas elderly in the north of the state of Minas Gerais, Brazil. Method: this is an analytical and cross-sectional population-based study, in which cluster sampling was used with probability proportional to size (n=406). Data collection involved structured interviews and clinical dental examinations. Result: it was found that the majority of the elderly had low income and low level education. It was observed that a significant portion of individuals reported access to a dental surgeon (97.5%) and that they had had their last dental appointment three years or more ago (60.4%). It was also found that the majority of the elderly were edentulous (52.0%) and that the majority of respondents needen prostheses (88%). A high DMFT index was found in the individuals studied (mean value of 27.25). Advanced age, absence of partner e retirement were associated with irregular access to dental services. Conclusion: the local quilombolas elderly had poor oral health and restricted access to dental services. Age, marital status and employment status demonstrated association with low accessibility to oral health services in the elderly investigated.

17.
Rev. bras. enferm ; 73(1): e20180513, 2020. tab, graf
Artículo en Inglés | LILACS-Express | LILACS, BDENF | ID: biblio-1057750

RESUMEN

ABSTRACT Objective: To verify the prevalence of common mental disorders and associated factors in nursing technicians. Method: Cross-sectional analytical study conducted at a university hospital. A questionnaire with sociodemographic, educational and work-related variables and the Self Reporting Questionnaire-20 were used to verify the presence of common mental disorders. Association analysis was performed using the chi-squared test, with a significance level of 5%. Results: 280 nursing technicians participated in the study. The prevalence of common mental disorders was 46.9%. The variables family income (p=0.021) and working exclusively in health area (p<0.001) were associated with the outcome. There was a higher prevalence of CMD among individuals with a family income below four minimum wages (PR=1.41) and among professionals who worked exclusively in the health area (PR=1.95). Conclusion: Approximately half of the nursing technicians of the university hospital presented common mental disorders, which were associated with economic and work-related variables.


RESUMEN Objetivo: Comprobar la prevalencia de trastornos mentales comunes en técnicos de enfermería y los factores asociados. Método: Se trata de un estudio transversal, analítico, realizado en un hospital universitario. Se utilizó un cuestionario compuesto por variables sociodemográficas, de formación y ocupacionales y el Cuestionario de Autorreporte de Síntomas-20 para comprobar la presencia de trastornos mentales comunes. Se llevó a cabo el análisis de asociación mediante la prueba chi-cuadrado, con nivel de significación del 5%. Resultados: Participaron 280 técnicos de enfermería. La prevalencia de trastornos mentales comunes alcanzó el 46,9%. Las variables ingreso familiar (p=0,021) y trabajo exclusivo en el área de la salud (p<0,001) estaban asociadas al desenlace. Fue posible observar una mayor prevalencia de TMC entre los individuos con ingresos familiares inferiores a cuatro sueldos mínimos (RP=1,41) y entre los profesionales que trabajaban exclusivamente en el área de la salud (RP=1,95). Conclusión: Aproximadamente la mitad de los técnicos de enfermería del hospital universitario presentó trastornos mentales comunes, asociados a aspectos económico y ocupacional.


RESUMO Objetivo: Verificar a prevalência de transtornos mentais comuns em técnicos de enfermagem e fatores associados. Método: Estudo transversal, analítico, realizado em um hospital universitário. Utilizaram-se um questionário composto por variáveis sociodemográficas, de formação e ocupacionais e o Self Reporting Questionnaire-20 para verificar a presença de transtornos mentais comuns. Realizou-se a análise de associação por meio do teste de qui-quadrado, com nível de significância de 5%. Resultados: Participaram 280 técnicos de enfermagem. A prevalência de transtornos mentais comuns foi de 46,9%. As variáveis renda familiar (p=0,021) e trabalho exclusivo na área da saúde (p<0,001) apresentaram-se associadas ao desfecho. Observou-se maior prevalência de TMC entre os indivíduos com renda familiar inferior a quatro salários mínimos (RP=1,41) e entre os profissionais que trabalhavam exclusivamente na área de saúde (RP=1,95). Conclusão: Aproximadamente metade dos técnicos de enfermagem de hospital universitário apresentou transtornos mentais comuns, que foram associados a aspectos econômico e ocupacional.

18.
Ciênc. Saúde Colet. (Impr.) ; 25(10): 3847-3855, Out. 2020. tab, graf
Artículo en Inglés, Portugués | LILACS, ColecionaSUS, SES-SP | ID: biblio-1133014

RESUMEN

Resumo A atividade física é um comportamento complexo e influenciado por variáveis sociodemográficas e clínicas. A melhor compreensão desses fatores possibilita considerar a associação deles com a atividade física. O objetivo deste estudo foi estimar os efeitos do nível socioeconômico, idade, gordura corporal e sintomas depressivos na frequência de atividade física entre adultos. Trata-se de um estudo transversal de base populacional conduzido com 808 indivíduos. Foram avaliadas as inter-relações entre as variáveis nível socioeconômico, idade, gordura corporal e sintomas depressivos no nível de atividade física total, por meio da técnica "path analysis". Observou-se efeito direto negativo e significativo da idade (β = -0,113; p < 0,004) nos níveis de atividade física. A idade (β = 0,376; p < 0,001) influenciou a gordura corporal, com efeito positivo e significativo. Os sintomas de depressão foram influenciados negativamente pelo nível socioeconômico (β = -0,126; p < 0,001) e positivamente pela idade (β = 0,244; p < 0,001) e gordura corporal (β = 0,169; p < 0,004). O nível socioeconômico, a gordura corporal e os sintomas depressivos não influenciaram diretamente os níveis de atividade física. Concluindo, os resultados mostraram que o avançar da idade contribui para a redução da prática de atividade física.


Abstract Physical activity is a complex behavior influenced by sociodemographic and clinical factors. A better understanding of the relationships between these factors is essential to better understanding their influence on physical activity. The objective of this study was to examine the association between socioeconomic status, age, body fat, and depressive symptoms and level of physical activity among adults. We conducted a cross-sectional population-based study with 808 individuals to examine the interrelations between the above factors and their influence on level of physical activity using path analysis. Age had a significant direct negative effect on level of physical activity (β = -0.113, p < 0.004) and a significant positive effect on body fat (β = 0.376, p < 0.001). Depressive symptoms were negatively influenced by socioeconomic status (β = -0.126, p < 0.001) and positively influenced by age (β = 0.244, p < 0.001) and body fat (β = 0.169; p < 0.004). Socioeconomic status, body fat and depressive symptoms did not directly influence level of physical activity. This study concludes that level of physical activity declines with advancing age.


Asunto(s)
Humanos , Adulto , Ejercicio Físico , Depresión/epidemiología , Clase Social , Factores Socioeconómicos , Tejido Adiposo , Estudios Transversales
19.
J Clin Exp Dent ; 7(2): e208-11, 2015 Apr.
Artículo en Inglés | MEDLINE | ID: mdl-26155334

RESUMEN

BACKGROUND: Data obtained from oral health surveys are very important for identifying disease-susceptible groups and for developing dental care and prevention programs. So, the purpose of the current article was to investigate the prevalence of oral mucosa lesions (OMLs) in a population of Brazilian police. MATERIAL AND METHODS: Interviews and oral cavity examinations were performed on a sample of 395 police officers who were randomly selected by the calibrated researcher. The number of individuals was obtained by a sample calculation using the finite population correction. The diagnostic criteria were based on the WHO (1997) criteria and adapted to Brazilian surveys. RESULTS: In total, 8.61% of the population presented some OML. Traumatic injuries and benign migratory glossitis (BMG) were the most prevalent lesions. CONCLUSIONS: The prevalence of potentially malignant disorders was lower than among the Brazilian population.The most prevalent lesion among the police officers was related to trauma. Patients dissatisfied with oral health had a higher risk of presenting OMLs. Key words:Mouth disease, mouth mucosa, military personnel, public health, oral pathology, oral leukoplakia.

20.
Rev. bras. educ. méd ; 43(2): 176-186, abr.-jun. 2019. tab, graf
Artículo en Inglés | LILACS | ID: biblio-990619

RESUMEN

ABSTRACT Faculty Development seeks to support educators in a range of functions in the areas of teaching, research, extension, management and evaluation. The aim of this study was to evaluate faculty development based on the social representations constructed by the teachers of a medical course. A qualitative survey was carried out, using the analytical method of discourse analysis and social representation as a theoretical contribution. Twelve teachers were randomly selected, and a semi-structured interview was conducted for the data collection. The responses, recorded in audio, were transcribed and discourse analysis was performed with the aim of mapping the social representations constructed by the subjects. The social representations were grouped into two categories: institutional development and personal development. Within the category institutional development, three subcategories were identified: Guiding principles of Faculty Development Programs, Teaching-learning strategies used in Faculty Development Programs, and Skills to be developed by faculty. Within the category Personal development, two subcategories were identified: Development as a person and as a social being, and Professional development. Over the years, a variety of social representations have been constructed in relation to the nature of teaching in medical education, but it is only in recent decades that managers and teachers of educational institutions have begun to focus more closely on this topic. In the present study, it was observed that for faculty development to be effective, the educator must have a desire to learn; however, institutional support and recognition are also essential. Faculty Development Programs must be flexible and adaptable, to meet the needs of the institution and its professors, and encourage reflection on their practices, though the exchange of experiences, the development of interpersonal relationships, and collaboration. However, it is vital to identify and facilitate the development of leadership skills, and to systematically evaluate the process and the results achieved. This will encourage teachers to develop in their academic careers and thereby increase the professionalization of teaching. Managers and teachers can sustain a shared mission to win resources, adapt to change, strive for excellence in the leadership of the organization in a national and international context, and consequently, provide a quality medical education.


RESUMO O desenvolvimento docente visa apoiar educadores em diversas funções nas áreas de ensino, pesquisa, extensão, gestão e avaliação. O objetivo deste estudo foi avaliar o desenvolvimento docente a partir das representações sociais construídas pelos professores de um curso de medicina. Realizou-se uma pesquisa qualitativa, na qual o método de análise utilizado foi análise do discurso e, como aporte teórico, as representações sociais. Foram selecionados doze professores aleatórios e uma entrevista semiestruturada foi conduzida para a coleta de dados. As respostas, gravadas em áudio, foram transcritas e a análise do discurso foi realizada com o objetivo de mapear as representações sociais construídas pelos sujeitos. As representações sociais foram agrupadas em duas categorias: Desenvolvimento Institucional e Desenvolvimento Pessoal. Na categoria Desenvolvimento Institucional, três subcategorias foram identificadas: Princípios orientadores dos Programas de Desenvolvimento docente, Estratégias de Ensino-aprendizagem utilizadas em Programas de Desenvolvimento docente, e Competências a serem desenvolvidas pelos docentes, e em Desenvolvimento Pessoal, identificaram-se duas subcategorias: Desenvolvimento como pessoa e como ser social e Desenvolvimento profissional. Muito embora uma variedade de representações sociais tenha sido construída em relação à docência em educação médica ao longo dos anos, somente nas últimas décadas o desenvolvimento docente se tornou um maior foco nas reflexões dos gestores de instituições educacionais e dos professores. No presente estudo, observou-se que para o desenvolvimento docente ser efetivo, é necessário que o educador queira aprender; no entanto, é essencial ter o reconhecimento e apoio institucional. Os Programas de Desenvolvimento Docente devem ser flexíveis e adaptáveis para atender às necessidades da instituição e dos professores e encorajar a reflexão sobre a própria prática, o intercâmbio de experiências, o desenvolvimento de relações interpessoais e a colaboração. No entanto, é vital identificar e facilitar o desenvolvimento de lideranças e avaliar sistematicamente o processo e os resultados alcançados, a fim de incentivar o desenvolvimento das carreiras acadêmicas dos professores, pois esta pode ser uma forma de profissionalizar o ensino. Portanto, é necessário que os gestores e professores possam sustentar uma missão compartilhada para alcançar recursos, se adaptar às mudanças, buscar a excelência na liderança da organização em um contexto nacional e internacional e, consequentemente, favorecer uma educação médica de qualidade.

SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA