Inactivation of SARS-CoV-2 and influenza A virus by dry fogging hypochlorous acid solution and hydrogen peroxide solution.

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), the causative agent of coronavirus disease 2019 (COVID-19), is transmitted mainly by droplet or aerosol infection; however, it may also be transmitted by contact infection. SARS-CoV-2 that adheres to environmental surfaces remains infectious for several days. We herein attempted to inactivate SARS-CoV-2 and influenza A virus adhering to an environmental surface by dry fogging hypochlorous acid solution and hydrogen peroxide solution. SARS-CoV-2 and influenza virus were air-dried on plastic plates and placed into a test chamber for inactivation by the dry fogging of these disinfectants. The results obtained showed that the dry fogging of hypochlorous acid solution and hydrogen peroxide solution inactivated SARS-CoV-2 and influenza A virus in CT value (the product of the disinfectant concentration and contact time)-dependent manners. SARS-CoV-2 was more resistant to the virucidal effects of aerosolized hypochlorous acid solution and hydrogen peroxide solution than influenza A virus; therefore, higher concentrations of disinfectants or longer contact times were required to inactivate SARS-CoV-2 than influenza A virus. The present results provide important information for the development of a strategy that inactivates SARS-CoV-2 and influenza A virus on environmental surfaces by spatial fogging.

Detection of proteolytic cleavages of diabetes-associated protein IA-2 beta in the pancreas and the brain using novel anti-IA-2 beta monoclonal antibodies.

Insulinoma-associated protein (IA)-2 beta, an inactive member of the protein-tyrosine phosphatase (PTP) family, is a major autoantigen in type-1 diabetes mellitus. IA-2 beta exists mainly in a 60-kDa form, and is frequently located in the dense-core secretory vesicles of pancreatic beta cells. As IA-2 beta gene-deficient mice exhibit impaired insulin secretions, IA-2 beta is probably involved in insulin secretions. In the present study, we characterized the major forms of IA-2 beta in the brain and pancreas of normal and non-obese diabetic (NOD) mice. Novel monoclonal antibodies (mAbs) against IA-2 beta revealed that this brain protein was of multiple compositions incorporating the 60-, 64-, 67- and 71-kDa forms, which were designated as IA-2 beta 60, IA-2 beta 64, IA-2 beta 67 and IA-2 beta 71, respectively. On the contrary, only the 60-kDa isoform of IA-2 beta was expressed in the mouse pancreas and in the mouse pancreatic beta cell line, MIN6. Sequence analyses revealed that IA-2 beta 60, IA-2 beta 64 and IA-2 beta 71 (brain-derived immunoprecipitated IA-2 beta isoforms) contained alternative NH2- termini starting from Glu489, Ala464, and Ser414, respectively, while IA-2 beta 60 (an MIN6-derived immunoprecipitated IA-2 beta isoform) contained those from Glu489. Consistent with the lack of an NH2-terminal region of IA-2 beta, the isoforms were recognized by their respective mAbs characterized with different epitope regions. Furthermore, Western blotting and immunohistochemistry demonstrated that NOD mice expressed similar isoforms present in the brains and pancreatic islets of C57BL/6J, BALC/CA and ICR mice, accordingly. Taken together, these results suggest that IA-2 beta undergoes at least three distinct proteolytic cleavages.

Late-onset olfactory deficits and mitral cell loss in mice lacking prion protein with ectopic expression of Doppel.

Several lines of prion protein gene (Prnp)-knockout mice such as ZrchI, ZrchII, Npu, Ngsk and Rcm0 have been generated. Of these, ZrchII, Ngsk and Rcm0 exhibit late-onset ataxia due to ectopic expression of Doppel (Dpl); a result of damage to the splicing acceptor of Prnp exon 3. Recently, we developed another line of Prnp-/- mice (Rikn), which was generated by gene targeting with more nucleotides by replacing intron 2 with the pgk-neo gene (cf. Ngsk Prnp-/- mice) and showed not only ataxia but also a lower olfactory sensitivity than the other Prnp-/- mouse line ZrchI at over 60 weeks of age. The histopathology of the elderly Rikn Prnp-/- mice showed mitral cell loss concomitantly observed with gliosis of astrocytes. Western blot analysis showed that Dpl was detected in the cerebrum, cerebellum and olfactory bulb of Rikn Prnp-/- mice, where aberrant histopathology was observed. Thus, mitral cell loss and gliosis induced by ectopic Dpl expression were probably associated with the late-onset olfactory deficits in Rikn Prnp-/- mice.

Neurotoxic prion protein (PrP) fragment 106-126 requires the N-terminal half of the hydrophobic region of PrP in the PrP-deficient neuronal cell line.

The cytotoxicity of aged PrP(106-126) was examined using an immortalized prion protein (PrP) gene-deficient neuronal cell line. The N-terminal half of the hydrophobic region (HR) but not the octapeptide repeat (OR) of PrP was required for aged PrP(106-126) neurotoxicity, suggesting that neurotoxic signals of aged PrP(106-126) are mediated by this region.

Accumulation of macrophages expressing MRP8 and MRP14 in skin lesions during Leishmania major infection in BALB/c and RAG-2 knockout mice.

Migration inhibitory factor-related protein 8 (MRP8) and MRP14 are expressed by myeloid cells and especially known as marker proteins of an immature and inflammatory subtype of macrophages. In this study, we immunohistochemically examined an accumulation of MRP8+ and MRP14+ macrophages in skin lesions during Leishmania major infection in susceptible BALB/c and RAG-2-/- mice. L. major infection caused the development of a nodular type of skin lesion at the infection site in mice and a massive accumulation of macrophages was observed in the lesions at four weeks after the infection. Immunohistochemical analyses showed MRP8+ and MRP14+ macrophages are predominant cell types in the skin lesions in both mouse strains. In contrast, F4/80+ cells, which correspond to mature macrophages, were rarely found in the skin lesions. These data suggest that the accumulation of inflammatory subtype of macrophages in BALB/c mice during L. major infection can be induced without acquired immune responses.

Increased expression of prion protein gene is accompanied by demethylation of CpG sites in a mouse embryonal carcinoma cell line, P19C6.

Elucidation of the processes regulating the prion protein gene (Prnp) is an important key to understanding the development of prion disorders. In this study, we explored the involvement of DNA methylation in Prnp transcriptional regulation during neuronal differentiation of embryonic carcinoma P19C6 cells. When P19C6 cells were differentiated into neuronal cells, the expression of Prnp was markedly increased, while CpG methylation was significantly demethylated at the nucleotide region between -599 and -238 from the transcription start site. In addition, when P19C6 cells were applied in a DNA methyltransferase inhibitor, RG108, Prnp transcripts were also significantly increased in relation to the decreased methylation statuses. These findings helped to elucidate the DNA methylation-mediated regulation of Prnp expression during neuronal differentiation.

CpG site DNA methylation patterns reveal a novel regulatory element in the mouse prion protein gene.

The cellular isoform of the prion protein (PrPC) plays critical roles in the development of prion disorders. Although PrP mRNA is ubiquitously present in a tissue-specific manner, the DNA methylation of PrP gene (Prnp) is still unknown. In this study, we demonstrated that the CpG island (CGI, positioned at -218 to +152 bp from the transcriptional start site) including the Prnp core promoter region was completely unmethylated in all tested tissues. On the other hand, CpG methylation in the CGI shore region (positioned at -599 to -238 bp) occurred in various tissue- and site-specific proportions. Interestingly, the correlation analysis between CpG methylation status and PrP mRNA levels showed that one CpG site methylation at -576 was negatively correlated with the PrP mRNA level (Pearson's r = -0.374, P=0.035). Taken together, our results suggest that Prnp is a typical housekeeping gene and various methylation frequencies of the CGI shore region are likely to affect Prnp expression in a tissue-specific manner.

Recent advances in clarifying prion protein functions using knockout mice and derived cell lines.

Considerable information on the functions of prion protein (PrP) has been accumulated. One experimental approach is the use of PrP gene-knockout mice and derived cell lines. This approach has contributed to elucidating the functions of cellular prion protein (PrP(C)), such as its anti-oxidative and anti-apoptotic roles. This review will introduce the recent advances in prion biology made possible by the availability of these tools.

Targeted disruption of the protein tyrosine phosphatase-like molecule IA-2 results in alterations in glucose tolerance tests and insulin secretion.

IA-2 is a major autoantigen in type 1 diabetes. Autoantibodies to IA-2 appear years before the development of clinical disease and are being widely used as predictive markers to identify individuals at risk for developing type 1 diabetes. IA-2 is an enzymatically inactive member of the transmembrane protein tyrosine phosphatase family and is an integral component of secretory granules in neuroendocrine cells. To study its function, we generated IA-2-deficient mice. Northern and Western blot analysis showed that neither IA-2 mRNA nor protein was expressed. Physical examination of the IA-2(- /-) animals and histological examination of tissues failed to reveal any abnormalities. Nonfasting blood glucose levels, measured over 6 months, were slightly elevated in male IA-2(-/-) as compared to IA-2(+ /+) littermates, but remained within the nondiabetic range. Glucose tolerance tests, however, revealed statistically significant elevation of glucose in both male and female IA-2(-/-) mice and depressed insulin release. In vitro glucose stimulation of isolated islets showed that male and female mice carrying the disrupted gene released 48% (P < 0.001) and 42% (P < 0.01) less insulin, respectively, than mice carrying the wild-type gene. We concluded that IA-2 is involved in glucose-stimulated insulin secretion.

Targeted disruption of the IA-2beta gene causes glucose intolerance and impairs insulin secretion but does not prevent the development of diabetes in NOD mice.

Insulinoma-associated protein (IA)-2beta, also known as phogrin, is an enzymatically inactive member of the transmembrane protein tyrosine phosphatase family and is located in dense-core secretory vesicles. In patients with type 1 diabetes, autoantibodies to IA-2beta appear years before the development of clinical disease. The genomic structure and function of IA-2beta, however, is not known. In the present study, we determined the genomic structure of IA-2beta and found that both human and mouse IA-2beta consist of 23 exons and span approximately 1,000 and 800 kb, respectively. With this information, we prepared a targeting construct and inactivated the mouse IA-2beta gene as demonstrated by lack of IA-2beta mRNA and protein expression. The IA-2beta(-/-) mice, in contrast to wild-type controls, showed mild glucose intolerance and impaired glucose-stimulated insulin secretion. Knockout of the IA-2beta gene in NOD mice, the most widely studied animal model for human type 1 diabetes, failed to prevent the development of cyclophosphamide-induced diabetes. We conclude that IA-2beta is involved in insulin secretion, but despite its importance as a major autoantigen in human type 1 diabetes, it is not required for the development of diabetes in NOD mice.

Infection route-independent accumulation of splenic abnormal prion protein.

The accumulation kinetics of the abnormal form of prion protein (PrP(Sc)) in spleens and brains of scrapie (Obihiro-1)-infected mice at various times after intracerebral (i.c.), intraperitoneal (i.p.), or oral inoculation were studied. PrP(Sc) was first detected by Western blotting with anti-prion protein antibodies on days 70 and 116 after i.c. (3 microg) in spleens and brains, respectively. Although the amount of cerebral PrP(Sc) gradually increased to the maximum level on day 152 after i.c. inoculation, splenic PrP(Sc) established the maximum level on day 116 after i.c. inoculation then registered slight decreases up to day 152 with further incubation. The detectable levels of cerebral PrP(Sc) by Western blotting were established on day 231 or 259, whereas those of splenic PrP(Sc) were detected on day 94 or 93, after i.p. and oral infection, respectively. The splenic PrP(Sc) decreased slightly thereafter. These results indicate that splenic PrP(Sc) increased before cerebral PrP(Sc) established a detectable level in a manner independent of the inoculation route.

Development of reverse genetics for Ibaraki virus to produce viable VP6-tagged IBAV.

Ibaraki virus (IBAV) is a member of the epizootic hemorrhagic disease virus (EHDV) serogroup, which belongs to the Orbivirus genus of the Reoviridae family. Although EHDV, including IBAV, represents an ongoing threat to livestock in the world, molecular mechanisms of EHDV replication and pathogenesis have been unclear. The reverse genetics (RG) system is one of the strong tools to understand molecular mechanisms of virus replication. Here, we developed a RG system for IBAV to identify the nonessential region of a minor structural protein, VP6, by generating VP6-truncated IBAV. Moreover, several tags were inserted into the truncated region to produce VP6-tagged IBAV. We demonstrated that all VP6-tagged IBAV could replicate in BHK cells in the absence of any helper VP6 protein. Further, tagged-VP6 proteins were first assembled into puncta in cells infected with VP6-tagged IBAV. Our data suggests that, in order to initiate primary replication, IBAV VP6 is likely to accumulate in some parts of infected cells to assemble efficiently into the primary replication complex (subcore).

Molecular modulation of expression of prion protein by heat shock.

Prion diseases (also known as transmissible spongiform encephalopathies) are associated with the conversion of the normal cellular form of the prion protein (PrPC) to an abnormal scrapie-isoform (PrP(Sc). The conversion of PrP(C) to PrP(Sc) is post-translational and is owing to protein conformational change. This has led to the hypothesis that molecular chaperones may be involved in the folding of prion proteins, and hence the disease process. By treating human NT-2 cells with heat-shock stress, we found that both the mRNA levels for prion protein (PrP) and heat shock protein 70 (HSP70) increased simultaneously after heat treatment. Western-blot analysis of PrP also showed a two-fold increase in PrP protein level 3 after heat treatment. Furthermore, two heat-shock elements (HSEs) were located at the positions of -680 bp (HSE1; GGAACTATTCTTGACATTGCT), and -1653 bp (HSE2; TGAGAACTCAGGAAG) of the rat PrP (RaPrP) gene promoter. Luciferase reporter constructs of the RaPrP promoter with HSE expressed higher luciferase activity (10- to 15-fold) than those constructs without HSE. Electrophoretic gel mobility shift assay (EMSA) and super-shift assay confirmed the interaction of HSE1 and HSE2 with the heat-shock transcription factor-1 (HSTF-1). These results suggest that cellular stress up-regulates both the transcription and translation of PrP through interaction with the HSEs on the PrP gene promoter, resulting in an increase in protein synthesis.

Development of a new selective medium for isolation of methicillin-resistant Staphylococcus aureus.

A new selective medium containing cephem antibiotics was developed for isolation of methicillin-resistant Staphylococcus aureus (MRSA). MRSA colonies on a medium containing ceftazidime (CAZ) were most easily identifiable and a medium containing cefoperazone (CPZ) was superior in suppressing the growth of other bacteria. With the medium containing a couple of CAZ and CPZ, MRSA and methicillin-resistant coagulase-negative staphylococci (MRCNS) were detected from 2 and 1 of 15 chicken meat samples respectively. The MRSA and MRCNS recovery test showed that the medium was effective for MRSA isolation, suppressing the growth of other bacteria efficiently. These results suggested that the medium containing a couple of CAZ and CPZ was useful for MRSA detection from foods and animals.

Localization of insulinoma associated protein 2, IA-2 in mouse neuroendocrine tissues using two novel monoclonal antibodies.

AIMS: Insulinoma-associated protein 2 (IA-2) is a member of the protein tyrosine phosphatase family that is localized on the insulin granule membrane. IA-2 is also well known as one of the major autoantigens in Type 1 diabetes mellitus. IA-2 gene deficient mice were recently established and showed abnormalities in insulin secretion. Thus, detailed localization of IA-2 was studied using wild-type and IA-2 gene deficient mice. MAIN METHODS: To localize IA-2 expression in mouse neuroendocrine tissues, monoclonal antibodies were generated against IA-2 and western blot and immunohistochemical analyses were carried out in IA-2(+/+) mice. IA-2(-/-) mice served as a negative control. KEY FINDINGS: Western blot analysis revealed that the 65 kDa form of IA-2 was observed in the cerebrum, cerebellum, medulla oblongata, pancreas, adrenal gland, pituitary gland, muscular layers of the stomach, small intestine, and colon. By immunohistochemical analysis, IA-2 was produced in endocrine cells in pancreatic islets, adrenal medullary cells, thyroid C-cells, Kulchitsky cells, and anterior, intermediate, and posterior pituitary cells. In addition, IA-2 was found in somatostatin-producing D-cells and other small populations of cells were scattered in the gastric corpus. IA-2 expression in neurites was confirmed by the immunostaining of IA-2 using primary cultured neurons from the small intestine and nerve growth factor (NGF)-differentiated PC12 cells. SIGNIFICANCE: The IA-2 distribution in peripheral neurons appeared more intensely in neurites rather than in the cell bodies.

Adhesion of MRP8/14 to amastigotes in skin lesions of Leishmania major-infected mice.

In murine experimental cutaneous leishmaniasis, parasite infection induces an accumulation of macrophages expressing migration inhibitory factor-related protein 8 (MRP8) and MRP14, two members of the S100 calcium-binding protein family. Although MRP8 and MRP14 are cytoplasmic proteins expressed by myeloid cells, recent studies have demonstrated that MRP8 and MRP14 have extracellular functions such as chemotactic activities. In this study, we examined whether extracellular MRP8 and MRP14 interact with Leishmania parasites during infection. By immunohistochemistry, positive staining by MRP8 and MRP14 was detected on amastigotes in skin lesions of Leishmania major-infected mice. Western blot analysis with amastigotes purified from the skin lesions demonstrated that both of these proteins adhered to amastigotes. The adhesion of MRP14 to amastigotes was reproduced in vitro and enhanced in the presence of Ca2+ and Zn2+. MRP14 adhered to not only amastigotes, but also promastigotes, suggesting receptor molecules for MRP14 are expressed commonly in both developmental stages.

Novel single nucleotide polymorphisms in the specific protein 1 binding site of the bovine PRNP promoter in Japanese Black cattle: impairment of its promoter activity.

Susceptibility to transmissible spongiform encephalopathy and different alleles of the prion protein gene (PRNP) of humans and sheep are associated. A tentative association between PRNP promoter polymorphisms and bovine spongiform encephalopathy (BSE) susceptibility has been reported in German cattle, whereas none of the known polymorphisms within the bovine PRNP-coding sequence affect BSE susceptibility. In the present study, novel single nucleotide polymorphisms located in the 5'-flanking region of bovine PRNP affecting its expression were demonstrated in Japanese Black cattle. We sequenced exon 1, and the approximately 200-bp 5'-flanking region of the PRNP translation initiation site containing the proximal promoter of PRNP was harvested. We identified 7 single nucleotide polymorphisms: -184A-->G, -141T-->C, -85T-->G, -47C-->A, -6C-->T, +17C-->T and +43C-->T. Six segregated haplotypes in the population were cloned into luciferase-expressing plasmids, transfected into N2a cells, and their reporter activities were measured 48 h after transfection. Six haplotypes showed a decreased expression level including -6C-->T in specific protein 1 binding site (p < 0.05) or -141T-->C (p < 0.01) at 48 h compared with the wild-type haplotype. These results advocate that certain polymorphisms such as specific protein 1 binding site polymorphisms in the bovine PRNP promoter region in Japanese Black cattle could influence promoter activity, suggesting that breeding cattle with such substitutions may be a useful approach in reducing BSE risk.

Serum withdrawal-induced apoptosis in ZrchI prion protein (PrP) gene-deficient neuronal cell line is suppressed by PrP, independent of Doppel.

Previous studies have shown that cellular prion protein (PrP(C)) plays anti-apoptotic and antioxidative role against cell death induced by serum-deprivation (SDP) in an immortalized prion protein gene-deficient neuronal cell line derived from Rikn prion protein (PrP) gene-deficient (Prnp(-/-)) mice, which ectopically produce excess Doppel (Dpl) (PrP-like glycoprotein). To investigate whether PrP(C) inhibits apoptotic neuronal cell death without Dpl, an immortalized cell line was established from the brain of ZrchI Prnp(-/-) mice, which do not show ectopic expression of Dpl. The results using a ZrchI neuronal Prnp(-/-) cell line (NpL2) showed that PrP(C) potently inhibited SDP-induced apoptotic cell death. Furthermore, PrP(C) expression enhanced the superoxide dismutase (SOD) activity in NpL2 cells. These results indicate that Dpl production did not affect anti-apoptotic and anti-oxidative functions of PrP, suggesting that PrP(C) may be directly correlated with protection against oxidative stress.

Bovine spongiform encephalopathy in Japan: history and recent studies on oxidative stress in prion diseases.

With the respect to BSE and vCJD, compliance with the following three rules should strictly be observed: (i) Identification and destruction of all clinically affected cattle; (ii) destruction of all mammalian proteins used in feeding ruminant livestock; and (iii) destruction of all high-risk tissues for use in human consumption. Scrapie in sheep has been documented in the 18th century in the United Kingdom. Through studies of brain-to-brain transmission in the same species in 1935, Cuille et al. successfully isolated the culprit protein from the sheep brain. To transmit said protein from an animal to another, intracerebral inoculation was much more efficient than intraperitoneal or oral route in certain species; i.e. the hamster and mouse. Since discovery of the more efficacious infection route, studies and development of prion research have undergone 4 developmental phases. Phase I depicted discoveries of the pathological features of Creutzfeldt-Jakob disease (CJD) and scrapie with typical lesions of spongiform encephalopathy, while Phase II revealed individual-to-individual (or cross-species) transmissions of CJD, kuru and scrapie in animals. Phases I and II suggested the possible participation of a slow virus in the infection process. In Phase III, Prusiner et al. proposed the 'prion' theory in 1982, followed by the milestone development of the transgenic or gene-targeted mouse in prion research in Phase IV. By strain-typing of prions, CJD has been classified as type 2 or 4 by Parchi et al. and Wadsworth as type-2 or -4 and type-1 or -2, respectively. Wadsworth type 1 is detected in the cerebellum, while Wadsworth type 2 was detected in the prefrontal cortex of 10% of sporadic CJD patients. In 1999, Puoti et al. have reported the co-existence of two types of PrP(res) in a same patient. These reports indicated that PrP(res)-typing is a quantitative rather than a qualitative process, and the relationship between the molecular type and the prion strain is rather complex. In fact, previous findings of Truchot have correlated type-1 distribution with synaptic deposits, and type-2 with arrangement of diffuse deposits in neurons. Although the normal function of PrP(C) has not been fully understood, recent studies have shown that PrP(C) plays a role in copper metabolism, signal transduction, neuroprotection and cell maturation. Further search of PrP(C)-interacting molecules and detailed studies using Prnp(-/-) mice and various type of Prnp(-/-) cell lines under various conditions are the prerequisites in elucidating PrP functions. In the pathogenesis of prion diseases, present results support the hypothesis that 'loss-of-function' of PrP(C) decreases resistance to oxidative stress, and 'gain-of-function' of PrP(Sc) increases oxidative stress. The mechanisms of (i) the 'loss-of-function' of PrP(C) in enhanced susceptibility to oxidative stress and (ii) the 'gain-of-function' of PrP(Sc) in generation of oxidative stress remain to be elucidated, although their mechanisms of action, at least in part, involve the decrease and increase in SOD activity, respectively.

Fusion of Doppel to octapeptide repeat and N-terminal half of hydrophobic region of prion protein confers resistance to serum deprivation.

Our previous studies have shown an essential role played by the octapeptide repeat region (OR) and the N-terminal half of hydrophobic region (HR) in the anti-apoptotic activity of prion protein (PrP). As PrP-like protein Doppel (Dpl), which structurally resembles an N-terminally truncated PrP, did not show any anti-apoptotic activity, we examined apoptosis of HpL3-4 cells expressing Dpl fused to various lengths of the N-terminal region of PrP to investigate whether the PrP/Dpl fusion proteins retain anti-apoptotic function. HpL3-4 cells expressing Dpl fused to PrP(1-124) with the OR and N-terminal half of HR of PrP showed anti-apoptotic function, whereas Dpl fused to PrP(1-95) with OR did not rescue cells from apoptotic cell death induced by serum deprivation. These results indicate that the OR and N-terminal half of HR of PrP retains anti-apoptotic activity similar to full-length PrP.