Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 74
Filtrar
Más filtros

Bases de datos
País/Región como asunto
Tipo del documento
Intervalo de año de publicación
1.
EMBO Rep ; 24(10): e56098, 2023 10 09.
Artículo en Inglés | MEDLINE | ID: mdl-37522391

RESUMEN

A11 dopaminergic neurons regulate somatosensory transduction by projecting from the diencephalon to the spinal cord, but the function of this descending projection in itch remained elusive. Here, we report that dopaminergic projection neurons from the A11 nucleus to the spinal dorsal horn (dopaminergicA11-SDH ) are activated by pruritogens. Inhibition of these neurons alleviates itch-induced scratching behaviors. Furthermore, chemogenetic inhibition of spinal dopamine receptor D1-expressing (DRD1+ ) neurons decreases acute or chronic itch-induced scratching. Mechanistically, spinal DRD1+ neurons are excitatory and mostly co-localize with gastrin-releasing peptide (GRP), an endogenous neuropeptide for itch. In addition, DRD1+ neurons form synapses with GRP receptor-expressing (GRPR+ ) neurons and activate these neurons via AMPA receptor (AMPAR). Finally, spontaneous itch and enhanced acute itch induced by activating spinal DRD1+ neurons are relieved by antagonists against AMPAR and GRPR. Thus, the descending dopaminergic pathway facilitates spinal itch transmission via activating DRD1+ neurons and releasing glutamate and GRP, which directly augments GRPR signaling. Interruption of this descending pathway may be used to treat chronic itch.


Asunto(s)
Receptores de Bombesina , Médula Espinal , Humanos , Receptores de Bombesina/genética , Receptores de Bombesina/metabolismo , Péptido Liberador de Gastrina/genética , Péptido Liberador de Gastrina/metabolismo , Médula Espinal/metabolismo , Ácido Glutámico/metabolismo , Dopamina/metabolismo , Prurito/genética , Prurito/metabolismo , Neuronas Dopaminérgicas/metabolismo , Receptores AMPA/genética , Receptores AMPA/metabolismo
2.
Nanotechnology ; 35(28)2024 Apr 24.
Artículo en Inglés | MEDLINE | ID: mdl-38522104

RESUMEN

Surface enhanced Raman spectroscopy (SERS) is a powerful analytical technique that has found application in the trace detection of a wide range of contaminants. In this paper, we report on the fabrication of 2D silver nanodendrites, on silicon chips, synthesized by electrochemical reduction of AgNO3at microelectrodes. The formation of nanodendrites is tentatively explained in terms of electromigration and diffusion of silver ions. Electrochemical characterization suggests that the nanodendrites do not stay electrically connected to the microelectrode. The substrates show SERS activity with an enhancement factor on the order of 106. Density functional theory simulations were carried out to investigate the suitability of the fabricated substrate for pesticide monitoring. These substrates can be functionalized with cyclodextrin macro molecules to help with the detection of molecules with low affinity with silver surfaces. A proof of concept is demonstrated with the detection of the herbicide 2-methyl-4-chlorophenoxyacetic acid (MCPA).

3.
Zhongguo Dang Dai Er Ke Za Zhi ; 26(3): 297-301, 2024 Mar 15.
Artículo en Zh | MEDLINE | ID: mdl-38557383

RESUMEN

Neurodevelopmental disorders in children have become a significant global public health concern, impacting child health worldwide. In China, the current intervention model for high-risk infants involves early diagnosis and early treatment. However, in recent years, overseas studies have explored novel preventive early intervention strategies for neurodevelopmental disorders in high-risk infants, achieving promising results. This article provides a comprehensive review of the optimal timing, methods, and intervention models of the preventive early intervention strategies for neurodevelopmental disorders in high-risk infants. The aim is to enhance the awareness and knowledge of healthcare professionals regarding preventive early intervention strategies for neurodevelopmental disorders in high-risk infants, facilitate clinical research and application of such interventions in China, and ultimately reduce the incidence of neurodevelopmental disorders in this high-risk population.


Asunto(s)
Trastornos del Neurodesarrollo , Lactante , Niño , Humanos , Trastornos del Neurodesarrollo/prevención & control , Trastornos del Neurodesarrollo/epidemiología , Intervención Educativa Precoz , Factores de Riesgo , China
4.
Acta Pharmacol Sin ; 44(11): 2307-2321, 2023 Nov.
Artículo en Inglés | MEDLINE | ID: mdl-37402999

RESUMEN

Breast cancer is one of the most common malignant tumors with high mortality due to metastases. SCRIB, a scaffold protein mainly distributed in the cell membrane, is a potential tumor suppressor. Mislocalization and aberrant expression of SCRIB stimulate the EMT pathway and promote tumor cell metastasis. SCRIB has two isoforms (with or without exon 16) produced by alternative splicing. In this study we investigated the function of SCRIB isoforms in breast cancer metastasis and their regulatory mechanisms. We showed that in contrast to the full-length isoform (SCRIB-L), the truncated SCRIB isoform (SCRIB-S) was overexpressed in highly metastatic MDA-MB-231 cells that promoted breast cancer metastasis through activation of the ERK pathway. The affinity of SCRIB-S for the catalytic phosphatase subunit PPP1CA was lower than that of SCRIB-L and such difference might contribute to the different function of the two isoforms in cancer metastasis. By conducting CLIP, RIP and MS2-GFP-based experiments, we revealed that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) promoted SCRIB exon 16 skipping by binding to the "AG"-rich sequence "caggauggaggccccccgugccgag" on intron 15 of SCRIB. Transfection of MDA-MB-231 cells with a SCRIB antisense oligodeoxynucleotide (ASO-SCRIB) designed on the basis of this binding sequence, not only effectively inhibited the binding of hnRNP A1 to SCRIB pre-mRNA and suppressed the production of SCRIB-S, but also reversed the activation of the ERK pathway by hnRNP A1 and inhibited the metastasis of breast cancer. This study provides a new potential target and a candidate drug for treating breast cancer.


Asunto(s)
Neoplasias de la Mama , Ribonucleoproteína Heterogénea-Nuclear Grupo A-B , Humanos , Femenino , Ribonucleoproteína Nuclear Heterogénea A1/genética , Ribonucleoproteína Nuclear Heterogénea A1/metabolismo , Ribonucleoproteína Heterogénea-Nuclear Grupo A-B/genética , Ribonucleoproteína Heterogénea-Nuclear Grupo A-B/metabolismo , Neoplasias de la Mama/genética , Isoformas de Proteínas/genética , Isoformas de Proteínas/metabolismo , Empalme Alternativo , Exones/genética , Proteínas de la Membrana/genética , Proteínas de la Membrana/metabolismo , Proteínas Supresoras de Tumor/metabolismo
5.
Zhongguo Dang Dai Er Ke Za Zhi ; 25(6): 606-611, 2023 Jun 15.
Artículo en Zh | MEDLINE | ID: mdl-37382130

RESUMEN

OBJECTIVES: To study the efficacy and safety of repeated application of rituximab (RTX) at a low dose (200 mg/m2) versus the recommended dose (375 mg/m2) for remission maintenance in frequently relapsing nephrotic syndrome (FRNS) or steroid-dependent nephrotic syndrome (SDNS). METHODS: A randomized controlled trial was conducted for 29 children with FRNS/SDNS who received systemic treatment in the Department of Nephrology, Anhui Provincial Children's Hospital, from September 2020 to December 2021. These children were divided into a recommended dose group (n=14) and a low dose group (n=15) using a random number table. The two groups were compared in terms of general characteristics, changes in CD19 expression after RTX treatment, number of relapses, glucocorticoid dose, adverse reactions of RTX, and hospital costs. RESULTS: After RTX treatment, both the low dose group and the recommended dose group achieved B-lymphocyte depletion and had significant reductions in the number of relapses and glucocorticoid dose (P<0.05). The low dose group had a comparable clinical effect to the recommended dose group after RTX treatment (P>0.05), and the low dose group had a significant reduction in hospital costs for the second, third, and fourth times of hospitalization (P<0.05). There were no serious adverse reactions in either group during RTX treatment and late follow-up, and there was no significant difference in adverse reactions between the two groups (P>0.05). CONCLUSIONS: Repeated RTX treatment at a low dose has comparable clinical efficacy and safety to that at the recommended dose and can significantly reduce the number of FRNS/SDNS relapses and the amount of glucocorticoids used, with little adverse effect throughout the treatment cycle. Therefore, it holds promise for clinical application.


Asunto(s)
Síndrome Nefrótico , Humanos , Niño , Síndrome Nefrótico/tratamiento farmacológico , Rituximab/efectos adversos , Glucocorticoides/efectos adversos , Estudios Prospectivos , Proteínas Adaptadoras Transductoras de Señales
6.
J Org Chem ; 87(21): 14241-14249, 2022 Nov 04.
Artículo en Inglés | MEDLINE | ID: mdl-36219805

RESUMEN

By complementing traditional transition metal catalysis, photoinduced catalysis has emerged as a versatile and sustainable way to achieve carbon-heteroatom bond formation. This work discloses a visible-light-induced reaction for the formation of a C-S bond from aryl halides and inorganic sulfuration agents via electron donor-acceptor (EDA) complex photocatalysis. Divergent formations of organic sulfide and disulfide have been demonstrated under mild conditions. Preliminary mechanistic studies suggest that visible-light-induced intracomplex charge transfer within the monosulfide-anion-containing EDA complex permits the C-S bond construction reactivity.

7.
Immunol Invest ; 51(7): 2086-2096, 2022 Oct.
Artículo en Inglés | MEDLINE | ID: mdl-35921152

RESUMEN

BACKGROUND: Cardiac dysfunction is the most common clinical complication of sepsis. Herein, the study explored the clinical importance of long non-coding RNA (lncRNA) HOXA terminal transcript antisense RNA (HOTTIP) in the onset of sepsis and the development of cardiac dysfunction. METHODS: 120 patients with sepsis were recruited and divided into cardiac dysfunction group and non-cardiac dysfunction group. Serum HOTTIP levels were measured via RT-qPCR. AC16 cells were treated with lipopolysaccharide (LPS) for cell experiments and detected for cell viability and apoptosis. RESULTS: High serum HOTTIP levels were tested in sepsis patients, which was associated with procalcitonin (PCT) level. Serum HOTTIP can identify sepsis cases from healthy people with the AUC of 0.927. 72 cases developed into cardiac dysfunction, accompanied by elevated levels of HOTTIP. ROC curve displayed the predictive ability of serum HOTTIP in the development of cardiac dysfunction in patients with sepsis. After adjusting for other clinical parameters, HOTTIP can independently affect the development of cardiac dysfunction. In vitro, HOTTIP knockdown promoted the recovery of cell viability and reversed LPS-induced cell apoptosis and excessive interleukin-6 (IL-6) release. CONCLUSION: LncRNA HOTTIP is closely related to the condition of patients with sepsis and the development of cardiac dysfunction, possibly owing to its function in LPS-induced myocardial apoptosis and inflammation.


Asunto(s)
MicroARNs , ARN Largo no Codificante , Sepsis , Humanos , Interleucina-6 , Lipopolisacáridos , MicroARNs/genética , Polipéptido alfa Relacionado con Calcitonina , ARN sin Sentido , ARN Largo no Codificante/genética , Sepsis/genética
8.
J Stroke Cerebrovasc Dis ; 31(7): 106515, 2022 Jul.
Artículo en Inglés | MEDLINE | ID: mdl-35490470

RESUMEN

BACKGROUND: Cognitive impairment is a common symptom after ischemic stroke. Such symptom can cause effect on rehabilitation of patients and their quality of life and. As stroke rapidly growth on nowadays, a reliable scoring tool to detect the risk of cognitive impairment after stroke is now being put on the first place. METHODS: We enrolled patients with acute ischemic stroke (AIS) as samples and hospitalized all at the First Affiliated Hospital of Soochow University between October 2018 and June 2020. All patients were assessed by the Montreal Cognitive Assessment (MoCA) scales and MoCA score < 26 was defined as standard to have having cognitive impairment. All patients were randomly (7:3) divided into two cohorts: the primary ones and the validated ones. Based on multivariate logistic model, the independent predictors of cognitive impairment in the acute phase were identified. The predictive nomogram was generated and evaluated by Harrell's concordance index (C-index) and calibration plot both in two cohorts, respectively. RESULTS: A total of 191 patients were enrolled, of whom 135 comprised the primary cohort and 56 comprised the validated cohort. Gender, age, baseline NIHSS score, hyperhomocysteinemia (HHcy) and multiple lesions were independently associated with acute cognitive impairment after stroke and included to construct the nomogram. The nomogram derived from the primary cohort had an Area Under Curve (AUC) of 0.773 and the validated ones had an AUC of 0.859. Calibration plot revealed adequate fit of the nomogram in predictive value. CONCLUSION: The new nomogram based on gender, age, baseline NIHSS score, HHcy and multiple lesions gave rise to an accurate and comprehensive prediction for cognitive impairment in AIS patients. After further validation, it could potentially be a reliable forecasting tool.


Asunto(s)
Disfunción Cognitiva , Accidente Cerebrovascular Isquémico , Accidente Cerebrovascular , Disfunción Cognitiva/complicaciones , Disfunción Cognitiva/etiología , Humanos , Nomogramas , Calidad de Vida , Accidente Cerebrovascular/complicaciones , Accidente Cerebrovascular/diagnóstico
9.
J Environ Manage ; 317: 115337, 2022 Sep 01.
Artículo en Inglés | MEDLINE | ID: mdl-35642812

RESUMEN

Microalgae-based nutrients recovery from liquid anaerobic digestate of swine manure has been a hotspot in recent decades. Nevertheless, in consideration of the high NH4+-N content and poor light penetrability exhibited by the original liquid digestate, uneconomical pretreatment on liquid digestate including centrifugation and dilution are indispensable before microalgae cells inoculation. Herein, aiming at eliminating the energy-intensive and freshwater-consuming pretreatment on liquid digestate and enhancing microalgae growth, the dialysis bag which permits nutrients transferring across its wall surface whereas retains almost all matters characterized by impeding light transmission within the raw liquid digestate was integrated into a column photobioreactor (DB-PBR). Consequently, light availability of microalgae cells in DB-PBR was elevated remarkably and thus contributed to a 357.58% improvement on microalgae biomass concentration in DB-PBR than the conventional PBR under 80 µmol m-2 s-1. Likewise, superior nutrients removal efficiencies from liquid digestate were obtained in DB-PBR (NH4+-N: 74.84%, TP: 63.75%) over the conventional PBR (NH4+-N: 30.27%, TP: 16.86%). Furthermore, higher microalgae biomass concentration (1.87 g L-1) and nutrients removal efficiencies (NH4+-N: 95.12%, TP: 76.87%) were achieved in the DB-PBR by increasing the light intensity to 140 µmol m-2 s-1. More importantly, the DB-PBR may provide a simple and greener solution to purify other kinds of wastewater.


Asunto(s)
Microalgas , Purificación del Agua , Animales , Biomasa , Nutrientes , Fotobiorreactores , Diálisis Renal , Porcinos , Aguas Residuales
10.
Analyst ; 146(18): 5550-5557, 2021 Sep 13.
Artículo en Inglés | MEDLINE | ID: mdl-34515702

RESUMEN

We have prepared a type of magnetic mesoporous nanomaterial with aggregation-induced emission properties (Fe3O4@mSiO2@TPA@BA, hence abbr. FSTB) to detect and remove cyanide ions (CN-) under magnetic conditions. FSTB has a large specific surface area and improved fluorescence performance to identify CN-, and its superparamagnetic behavior plays an important role in removing CN-. The magnetic sensor FSTB shows excellent selectivity and anti-interference for the detection of CN- in aqueous solutions. It is obvious from the equation LOD = 3δ/S that the limit of detection (LOD) of FSTB for CN- is significantly lower than the permissible level of CN- in drinkable water recommended by the World Health Organization. Therefore, the magnetic sensor FSTB has a wide range of applications for detecting and removing harmful CN-.


Asunto(s)
Nanoestructuras , Agua , Cianuros , Fenómenos Magnéticos , Magnetismo
11.
Arch Virol ; 166(7): 1877-1883, 2021 Jul.
Artículo en Inglés | MEDLINE | ID: mdl-33884475

RESUMEN

Here, we report the development of an indirect enzyme-linked immunosorbent assay (ELISA) method that involves using multiepitope recombinant S protein (rSP) as the coating antigen to detect antibodies against canine coronavirus (CCoV). rSP was designed by arranging its four S fragments (91-135 aa, S1 gene; 377-434 aa, S2 gene; 647-671 aa, S3 gene; 951-971 aa, S4 gene; 207-227 aa) and two T-cell epitopes in tandem: T-E1-E2-E3-E4-T. This multiepitope antigen, which has a molecular weight of approximately 25 kDa and contains a His-tag, was recognized by a CCoV-positive serum in a Western blot assay. The optimal concentration of rSP as a coating antigen in the ELISA was 2 µg/mL, and the optimal dilution of enzyme-labeled secondary antibody was 1:10,000. The cutoff OD450 value was established at 0.2395. No reactivity was observed with antisera against canine distemper virus, canine parvovirus, or feline calicivirus, indicating that this assay is highly specific. We also tested 64 clinical serum samples using our newly established method, and the positive rate was found to be 82.8%. In conclusion, our assay was found to be highly sensitive and specific for the detection of antibodies against CCoV, and it can therefore serve as a new, efficient diagnostic method.


Asunto(s)
Anticuerpos Antivirales/inmunología , Prueba Serológica para COVID-19/métodos , Coronavirus Canino/inmunología , Ensayo de Inmunoadsorción Enzimática/métodos , Glicoproteína de la Espiga del Coronavirus/inmunología , Animales , Virus del Moquillo Canino/inmunología , Perros , Proteínas Recombinantes/inmunología , Sensibilidad y Especificidad
12.
Sensors (Basel) ; 21(10)2021 May 19.
Artículo en Inglés | MEDLINE | ID: mdl-34069670

RESUMEN

Water is a precious resource that is under threat from a number of pressures, including, for example, release of toxic compounds, that can have damaging effect on ecology and human health. The current methods of water quality monitoring are based on sample collection and analysis at dedicated laboratories. Recently, electrochemical-based methods have attracted a lot of attention for environmental sensing owing to their versatility, sensitivity and their ease of integration with cost effective, smart and portable readout systems. In the present work, we report on the fabrication and characterization of platinum-based interdigitated microband electrodes arrays, and their application for trace detection of copper. Using square wave voltammetry after acidification with mineral acids, a limit of detection of 0.8 µg/L was achieved. Copper detection was also undertaken on river water samples and compared with standard analytical techniques. The possibility of controlling the pH at the surface of the sensors-thereby avoiding the necessity to add mineral acids-was investigated. By applying potentials to drive the water splitting reaction at one comb of the sensor's electrode (the protonator), it was possible to lower the pH in the vicinity of the sensing electrode. Detection of standard copper solutions down to 5 µg/L (ppb) using this technique is reported. This reagent free method of detection opens the way for autonomous, in situ monitoring of pollutants in water bodies.

13.
Zhongguo Dang Dai Er Ke Za Zhi ; 22(10): 1056-1060, 2020 Oct.
Artículo en Zh | MEDLINE | ID: mdl-33059800

RESUMEN

Neonatal capillary leak syndrome is a clinical syndrome with definite etiology or predisposing factors and has the manifestations of hypotension, hemoconcentration, hypoproteinemia, and systemic edema. This disease often has critical conditions and may lead to multiple organ failure and even death. There are still controversies over the diagnosis and treatment of this disease. This article summarizes the recent advances in the diagnosis and treatment of neonatal capillary leak syndrome, in order to improve the diagnosis and treatment of this disease among clinicians.


Asunto(s)
Síndrome de Fuga Capilar , Síndrome de Fuga Capilar/diagnóstico , Síndrome de Fuga Capilar/etiología , Síndrome de Fuga Capilar/terapia , Edema , Humanos , Hipoproteinemia , Insuficiencia Multiorgánica
14.
NMR Biomed ; 32(3): e4064, 2019 03.
Artículo en Inglés | MEDLINE | ID: mdl-30693582

RESUMEN

Cerebrovascular reactivity (CVR) is a dynamic measure of the cerebral blood vessel response to vasoactive stimulus. Conventional CVR measures amplitude changes in the blood-oxygenation-level-dependent (BOLD) signal per unit change in end-tidal CO2 (PET CO2 ), effectively discarding potential timing information. This study proposes a deconvolution procedure to characterize CVR responses based on a vascular transfer function (VTF) that separates amplitude and timing CVR effects. We implemented the CVR-VTF to primarily evaluate normal-appearing white matter (WM) responses in those with a range of small vessel disease. Comparisons between simulations of PET CO2 input models revealed that boxcar and ramp hypercapnia paradigms had the lowest relative deconvolution error. We used a T2 * BOLD-MRI sequence on a 3 T MRI scanner, with a boxcar delivery model of CO2 , to test the CVR-VTF approach in 18 healthy adults and three white matter hyperintensity (WMH) groups: 20 adults with moderate WMH, 12 adults with severe WMH, and 10 adults with genetic WMH (CADASIL). A subset of participants performed a second CVR session at a one-year follow-up. Conventional CVR, area under the curve of VTF (VTF-AUC), and VTF time-to-peak (VTF-TTP) were assessed in WM and grey matter (GM) at baseline and one-year follow-up. WMH groups had lower WM VTF-AUC compared with the healthy group (p < 0.0001), whereas GM CVR did not differ between groups (p > 0.1). WM VTF-TTP of the healthy group was less than that in the moderate WMH group (p = 0.016). Baseline VTF-AUC was lower than follow-up VTF-AUC in WM (p = 0.013) and GM (p = 0.026). The intraclass correlation for VTF-AUC in WM was 0.39 and coefficient of repeatability was 0.08 [%BOLD/mm Hg]. This study assessed CVR timing and amplitude information without applying model assumptions to the CVR response; this approach may be useful in the development of robust clinical biomarkers of CSVD.


Asunto(s)
Encéfalo/irrigación sanguínea , Enfermedades de los Pequeños Vasos Cerebrales/sangre , Enfermedades de los Pequeños Vasos Cerebrales/patología , Oxígeno/sangre , Adulto , Anciano , Dióxido de Carbono/metabolismo , Simulación por Computador , Femenino , Humanos , Hipercapnia/patología , Masculino , Persona de Mediana Edad , Factores de Tiempo , Sustancia Blanca/irrigación sanguínea , Sustancia Blanca/patología
15.
BMC Cancer ; 19(1): 470, 2019 May 17.
Artículo en Inglés | MEDLINE | ID: mdl-31101029

RESUMEN

BACKGROUND: To explore prognostic value of the pre-treatment primary lesion apparent diffusion coefficient (ADC) in locoregionally advanced nasopharyngeal carcinoma (LA-NPC). METHODS: A total of 843 patients with newly diagnosed LA-NPC were enrolled from January 2011 to April 2014 and divided into two groups based on ADC values: the low-ADC group and high-ADC group. The 3-year local relapse-free survival (LRFS), distant metastasis free survival (DMFS), disease-free survival (DFS) and overall survival (OS) rates between two groups were compared using Kaplan-Meier curve, and Cox regression analyses were performed to test prognostic value of the pretreatment ADC in LA-NPC. RESULTS: The cut-off value of the pretreatment ADC for predicting local relapse was 784.5 × 10- 6 mm2/s (AUC [area under curve] = 0.604; sensitivity = 0.640; specificity = 0.574), thus patients were divided into low-ADC (< 784.5 × 10- 6; n = 473) group and high-ADC (≥784.5 × 10- 6; n = 370) group. The low-ADC group had significantly higher 3-year LRFS rate and DFS rate than the high-ADC group (LRFS: 96.2% vs. 91.4%, P = 0.003; DFS: 81.4% vs. 73.0%, P = 0.0056). Multivariate analysis showed that the pretreatment ADC is an independent prognostic factor for LRFS (HR, 2.04; 95% CI, 1.13-3.66; P = 0.017) and DFS (HR, 1.41; 95% CI, 1.04-1.89; P = 0.024). CONCLUSIONS: The pretreatment ADC of the primary lesion is an independent prognostic factor for LRFS and DFS in LA-NPC patients.


Asunto(s)
Imagen de Difusión por Resonancia Magnética , Carcinoma Nasofaríngeo/diagnóstico , Neoplasias Nasofaríngeas/diagnóstico , Adolescente , Adulto , Anciano , Niño , Supervivencia sin Enfermedad , Femenino , Humanos , Masculino , Persona de Mediana Edad , Pronóstico , Estudios Retrospectivos , Adulto Joven
16.
Zhongguo Dang Dai Er Ke Za Zhi ; 20(5): 378-382, 2018 May.
Artículo en Zh | MEDLINE | ID: mdl-29764574

RESUMEN

OBJECTIVE: To study the clinical effect and mechanism of hemoperfusion (HP) in the treatment of children with severe abdominal Henoch-Schönlein purpura (HSP). METHODS: A total of 24 children with severe abdominal HSP were divided into two groups: conventional treatment and HP (n=12 each). Ten healthy children who underwent physical examination were enrolled as the control group. Before and after treatment, chemiluminescence was used to measure the serum levels of interleukin-6 (IL-6) and tumor necrosis factor-α (TNF-α); thiobarbituric acid colorimetry was used to measure the plasma level of malondialdehyde (MDA); the hydroxylamine method was used to measure the plasma level of superoxide dismutase (SOD); chemical colorimetry was used to measure the plasma level of total anti-oxidant capability (T-AOC). RESULTS: Compared with the control group, the conventional treatment and HP groups had significantly higher IL-6, TNF-α, and MDA levels and significantly lower SOD and T-AOC levels before treatment (P<0.05), but there were no significant differences between the conventional treatment and HP groups (P>0.05). After treatment, the conventional treatment and HP groups had significant reductions in IL-6, TNF-α, and MDA levels and significant increases in SOD and T-AOC levels (P<0.05). The HP group had significantly greater changes than the conventional treatment group; however, there were still significant differences in these indices between the HP and control groups (P<0.05). Compared with the HP group, the conventional treatment group had a significantly lower percentage of children with disappearance of digestive tract symptoms at 4 days after treatment and significantly longer time to disappearance of rash and digestive tract symptoms (P<0.05). Compared with the conventional treatment group, the HP group had a significantly lower amount of glucocorticoid used during treatment and a significantly lower percentage of children who experienced hematuria and/or proteinuria within 6 months of the disease course (P<0.05). There were no significant differences between the two groups in length of hospital stay and recurrence rates of rash and abdominal pain within 6 months of the disease course. CONCLUSIONS: HP can reduce the amount of glucocorticoid used during treatment and the incidence rate of kidney injury in children with severe abdominal HSP, possibly by eliminating IL-6, TNF-α, and MDA.


Asunto(s)
Hemoperfusión , Vasculitis por IgA/terapia , Adolescente , Niño , Preescolar , Femenino , Humanos , Vasculitis por IgA/metabolismo , Interleucina-6/sangre , Masculino , Malondialdehído/sangre , Superóxido Dismutasa/sangre , Factor de Necrosis Tumoral alfa/sangre
18.
Front Cardiovasc Med ; 11: 1431137, 2024.
Artículo en Inglés | MEDLINE | ID: mdl-39193497

RESUMEN

Background: Although percutaneous coronary intervention (PCI) is recommended by guidelines, data from the real world suggest that elderly non-ST-segment elevation myocardial infarction (NSTEMI) patients have a low rate of PCI and a high death rate. Lymphocyte to C-reactive protein ratio (LCR), a novel inflammatory marker, has been shown to be associated with prognosis in a variety of diseases. However, the relationship between LCR and in-hospital cardiac death in elderly NSTEMI patients is unclear. The aim of this study was to investigate the effect of LCR on in-hospital cardiac death in elderly NSTEMI patients without PCI therapy. Methods: This was a single-center retrospective observational study, consecutively enrolled elderly (≥75 years) patients diagnosed with NSTEMI and without PCI from February 2019 to February 2024. LCR was defined as lymphocyte count to C-reactive protein ratio. The endpoint of observation was in-hospital cardiac death. The predictive efficacy of the old and new models was evaluated by the net reclassification index (NRI) and the integrated discriminant improvement index (IDI). Results: A total of 506 patients were enrolled in this study, and in-hospital cardiac death occurred in 54 patients (10.7%). Univariate logistic regression analysis showed that left ventricular ejection fraction, LCR, Killip ≥2, and N-terminal B-type natriuretic peptide proteins (NT-proBNP) were associated with the occurrence of in-hospital cardiac death. After adjusting for potential confounders, the results showed that NT-proBNP (OR = 1.695, 95% CI: 1.238-2.322) and LCR (OR = 0.262, 95% CI: 0.072-0.959) were independent risk factors for in-hospital cardiac death. After the addition of LCR to NT-proBNP, the predictive ability of the new model for in-hospital cardiac death was significantly improved (NRI = 0.278, P = 0.030; IDI = 0.017, P < 0.001). Conclusion: Lower LCR is an independent risk factor for in-hospital cardiac death in elderly NSTEMI patients without PCI, and integrating LCR improves the prediction of in-hospital cardiac death occurrence.

19.
Int J Radiat Oncol Biol Phys ; 118(3): 770-780, 2024 Mar 01.
Artículo en Inglés | MEDLINE | ID: mdl-37939733

RESUMEN

PURPOSE: The aim of this study was to investigate the treatment results and long-term quality of life in patients with early-stage extranodal natural killer/T-cell lymphoma who were prospectively treated with simultaneous boost intensity modulated radiation therapy (SIB-IMRT) with 3 dose gradients. METHODS AND MATERIALS: Sixty patients with stage I-II nasal cavity natural killer/T-cell lymphoma (NKTCL) and Waldeyer's ring NKTCL were enrolled in a single-arm, prospective, phase 2 clinical trial from August 2011 to April 2015. All patients were treated with definitive radiation therapy combined with short-course induction chemotherapy. A newly designed SIB-IMRT scheme was uniformly adopted, with 54.6 Gy for the gross tumor volume (GTV) of the primary tumor and GTV of the positive lymph nodes, 50.7 Gy for the high-risk clinical target volume (CTV), and 45.5 Gy for the low-risk CTV, all delivered in 26 daily fractions. Before SIB-IMRT, L-asparaginase-based induction chemotherapy was used in 95.0% (57/60) of patients. RESULTS: With a median follow-up time of 95.8 months, the 5-year locoregional recurrence-free survival, progression-free survival, and overall survival rates were 83.3%, 81.7%, and 88.3%, respectively. Dosimetric analysis in the first 21 patients showed satisfying conformality for planning target volume of GTV, high-risk CTV, and low-risk CTV, while the organs at risk were well protected. The results of long-term quality-of-life investigations in patients without progression were favorable, and nasal discomfort was the most common symptom. No grade 3 or 4 acute or late toxicities were observed. CONCLUSIONS: The scheme of target volume delineation and dose setting that we designed has favorable clinical effects with mild side effects in treating patients with stage I-II nasal cavity NKTCL and Waldeyer's ring NKTCL.


Asunto(s)
Linfoma Extranodal de Células NK-T , Radioterapia de Intensidad Modulada , Humanos , Radioterapia de Intensidad Modulada/métodos , Calidad de Vida , Estudios Prospectivos , Dosificación Radioterapéutica , Linfoma Extranodal de Células NK-T/radioterapia , Linfoma Extranodal de Células NK-T/tratamiento farmacológico , Células Asesinas Naturales
20.
Sci Rep ; 14(1): 11955, 2024 May 25.
Artículo en Inglés | MEDLINE | ID: mdl-38796636

RESUMEN

To investigate the flow characteristics in front chamber and rear chamber in pump mode and pump as turbine mode, a 3D computational model of a centrifugal pump was established, including the front and rear chamber. Based on Realizable k-ε turbulence model, numerical calculations of incompressible flow were carried out for internal viscous flow in two operating modes. Further analysis was conducted on the flow stability and hydraulic losses under two modes using energy gradient theory and entropy production theory. The numerical simulation results are within reasonable error compared to the experimental results in pump operation mode, which ensures the reliability of the numerical calculation method. The results indicate that the volumetric efficiency in both two modes is on an upward trend with increasing flow, but the volumetric efficiency of the pump mode is more significantly affected by changes in flow; the distribution patterns of dimensionless circumferential velocity and dimensionless radial velocity in the front and rear chambers under two operating modes are similar, but the distribution pattern of dimensionless radial velocity in the front chamber in turbine mode is significantly different from other operating conditions; flow instability is most likely to occur at the outlet of impeller, and the energy loss in clearance of wear-rings is greater than that in the pump chamber.

SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA