Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 494
Filtrar
Más filtros

Bases de datos
Tipo del documento
Intervalo de año de publicación
1.
BMC Genomics ; 25(1): 682, 2024 Jul 09.
Artículo en Inglés | MEDLINE | ID: mdl-38982341

RESUMEN

BACKGROUND: Green foxtail [Setaria viridis (L.)] is one of the most abundant and troublesome annual grass weeds in alfalfa fields in Northeast China. Synthetic auxin herbicide is widely used in agriculture, while how auxin herbicide affects tillering on perennial grass weeds is still unclear. A greenhouse experiment was conducted to examine the effects of auxin herbicide 2,4-D on green foxtail growth, especially on tillers. RESULTS: In the study, 2,4-D isooctyl ester was used. There was an inhibition of plant height and fresh weight on green foxtail after application. The photosynthetic rate of the leaves was dramatically reduced and there was an accumulation of malondialdehyde (MDA) content. Moreover, applying 2,4-D isooctyl ester significantly reduced the tillering buds at rates between 2100 and 8400 ga. i. /ha. Transcriptome results showed that applying 2,4-D isooctyl ester on leaves affected the phytohormone signal transduction pathways in plant tillers. Among them, there were significant effects on auxin, cytokinin, abscisic acid (ABA), gibberellin (GA), and brassinosteroid signaling. Indeed, external ABA and GA on leaves also limited tillering in green foxtail. CONCLUSIONS: These data will be helpful to further understand the responses of green foxtail to 2, 4-D isooctyl ester, which may provide a unique perspective for the development and identification of new target compounds that are effective against this weed species.


Asunto(s)
Ácido 2,4-Diclorofenoxiacético , Herbicidas , Reguladores del Crecimiento de las Plantas , Setaria (Planta) , Ácido 2,4-Diclorofenoxiacético/farmacología , Setaria (Planta)/efectos de los fármacos , Setaria (Planta)/genética , Setaria (Planta)/metabolismo , Setaria (Planta)/crecimiento & desarrollo , Reguladores del Crecimiento de las Plantas/farmacología , Reguladores del Crecimiento de las Plantas/metabolismo , Herbicidas/farmacología , Hojas de la Planta/efectos de los fármacos , Hojas de la Planta/metabolismo , Ácidos Indolacéticos/metabolismo , Ácidos Indolacéticos/farmacología , Regulación de la Expresión Génica de las Plantas/efectos de los fármacos , Fotosíntesis/efectos de los fármacos , Giberelinas/farmacología , Giberelinas/metabolismo , Transducción de Señal/efectos de los fármacos , Transcriptoma/efectos de los fármacos , Ésteres
2.
Appl Environ Microbiol ; 90(4): e0204323, 2024 04 17.
Artículo en Inglés | MEDLINE | ID: mdl-38547470

RESUMEN

Pasteurella multocida is a zoonotic conditional pathogen that infects multiple livestock species, causing substantial economic losses in the animal husbandry industry. An efficient markerless method for gene manipulation may facilitate the investigations of P. multocida gene function and pathogenesis of P. multocida. Herein, a temperature-sensitive shuttle vector was constructed using lacZ as a selection marker, and markerless glgB, opa, and hyaE mutants of P. multocida were subsequently constructed through blue-white colony screening. The screening efficiency of markerless deletion strains was improved by the lacZ system, and the method could be used for multiple gene deletions. However, the fur mutant was unavailable via this method. Therefore, we constructed a pheSm screening system based on mutated phenylalanine tRNA synthetase as a counterselection marker to achieve fur deletion mutant. The transformed strain was sensitive to 20 mM p-chloro-phenylalanine, demonstrating the feasibility of pheSm as a counter-selective marker. The pheSm system was used for markerless deletions of glgB, opa, and hyaE as well as fur that could not be screened by the lacZ system. A comparison of screening efficiencies of the system showed that the pheSm counterselection system was more efficient than the lacZ system and broadly applicable for mutant screening. The methods developed herein may provide valuable tools for genetic manipulation of P. multocida.IMPORTANCEPasteurella multocida is a highly contagious zoonotic pathogen. An understanding of its underlying pathogenic mechanisms is of considerable importance and requires efficient species-specific genetic tools. Herein, we propose a screening system for P. multocida mutants using lacZ or pheSm screening markers. We evaluated the efficiencies of both systems, which were used to achieve markerless deletion of multiple genes. The results of this study support the use of lacZ or pheSm as counterselection markers to improve counterselection efficiency in P. multocida. This study provides an effective genetic tool for investigations of the virulence gene functions and pathogenic mechanisms of P. multocida.


Asunto(s)
Pasteurella multocida , Animales , Pasteurella multocida/genética , Operón Lac , Vectores Genéticos , Fenilalanina
3.
Plant Cell Environ ; 47(3): 913-927, 2024 Mar.
Artículo en Inglés | MEDLINE | ID: mdl-38168880

RESUMEN

Insect-induced plant volatile organic compounds (VOCs) may function as either direct defence molecules to deter insects or indirect defence signals to attract the natural enemies of the invading insects. Tea (Camellia sinensis L.), an important leaf-based beverage crop, is mainly infested by Ectropis obliqua which causes the most serious damage. Here, we report a mechanistic investigation of tea plant-derived VOCs in an indirect defence mechanism against E. obliqua. Parasitoid wasp Parapanteles hyposidrae, a natural enemy of E. obliqua, showed strong electrophysiological response and selection behaviour towards S-linalool and ß-ocimene, two monoterpenes with elevated emission from E. obliqua-damaged tea plants. Larvae frass of E. obliqua, which also released S-linalool and ß-ocimene, was found to attract both mated female or male Pa. hyposidrae according to gas chromatography-electroantennogram detection and Y-tube olfactometer assays. In a field setting, both S-linalool and ß-ocimene were effective in recruiting both female and male Pa. hyposidrae wasps. To understand the molecular mechanism of monoterpenes-mediated indirect defence in tea plants, two novel monoterpene synthase genes, CsLIS and CsOCS-SCZ, involved in the biosynthesis of S-linalool or ß-ocimene, respectively, were identified and biochemically characterised. When the expression of these two genes in tea plants was inhibited by antisense oligodeoxynucleotide, both volatile emission and attraction of wasps were reduced. Furthermore, gene expression analysis suggested that the expression of CsLIS and CsOCS-SCZ is regulated by the jasmonic acid signalling pathway in the tea plant.


Asunto(s)
Monoterpenos Acíclicos , Alquenos , Camellia sinensis , Mariposas Nocturnas , Avispas , Animales , Monoterpenos , Camellia sinensis/genética , Señales (Psicología) , Mariposas Nocturnas/fisiología , Insectos ,
4.
Cancer Cell Int ; 24(1): 77, 2024 Feb 18.
Artículo en Inglés | MEDLINE | ID: mdl-38369484

RESUMEN

BACKGROUND AND PURPOSE: Ferroptosis is a form of regulated cell death characterized by iron-dependent lipid peroxidation. Its role in cancer metastasis remains unclear. In this study, we aimed to investigate the potential involvement of ferroptosis in gastric cancer (GC) metastasis. METHODS: GC cells (AGS, MKN45, HGC27) were used to explore the role of ferroptosis in single and clustered cells with extracellular matrix (ECM) detachment in vitro. We overexpressed glutathione peroxidase 4 (GPX4) to inhibit ferroptosis and assessed the changes in cell proliferation, migration, invasion, and epithelial-mesenchymal transition (EMT). Then tumor tissues from 54 GC patients with and without lymphatic metastasis were collected for immunohistochemical staining to investigate the expression of ferroptosis and EMT markers. Finally, Kaplan-Meier survival curves were used to investigate the relationship between overall survival and expression of GPX4 in 178 GC patients. RESULTS: Detached single cells had lower viability than adherent cells, but cell clustering improved their survival under matrix-detached conditions. Detached single cells exhibited an induction of iron-dependent reactive oxygen species (ROS) accumulation, glutathione (GSH) depletion, lipid peroxidation, upregulation of ACSL4, TFRC and HO-1, increased iron levels, and changes in mitochondrial morphology. Opposite effects were observed in detached clustered cells, including the upregulation of the ferroptosis suppressors GPX4 and SLC7A11. Overexpression of GPX4 inhibited ferroptosis and promoted GC cell proliferation, migration, invasion, and EMT. Immunohistochemical analysis of tumor tissues from GC patients indicated that lymphatic metastasis was associated with higher potential for ferroptosis inhibition and EMT induction. Finally, Kaplan-Meier survival curves demonstrated a significant decrease in overall survival among GC patients with high GPX4 expression. CONCLUSIONS: Our study provides the first evidence that inhibition of ferroptosis is a crucial mechanism promoting GC metastasis. GPX4 may be a valuable prognostic factor for GC patients. These findings suggest that targeting ferroptosis inhibition may be a promising strategy for GC patients with metastatic potential. Trial registration The ethical approval code of this study in Institutional Review Board of Peking Union Medical College Hospital is No: K1447.

5.
Cancer Cell Int ; 24(1): 112, 2024 Mar 25.
Artículo en Inglés | MEDLINE | ID: mdl-38528532

RESUMEN

BACKGROUND: Gastric cancer (GC) remains a malignant tumor with high morbidity and mortality, accounting for approximately 1,080,000 diagnosed cases and 770,000 deaths worldwide annually. Disulfidptosis, characterized by the stress-induced abnormal accumulation of disulfide, is a recently identified form of programmed cell death. Substantial studies have demonstrated the significant influence of immune clearance on tumor progression. Therefore, we aimed to explore the intrinsic correlations between disulfidptosis and immune-related genes (IRGs) in GC, as well as the potential value of disulfidptosis-related immune genes (DRIGs) as biomarkers. METHODS: This study incorporated the single-cell RNA sequencing (scRNA-seq) dataset GSE183904 and transcriptome RNA sequencing of GC from the TCGA database. Disulfidptosis-related genes (DRGs) and IRGs were derived from the representative literature on both cell disulfidptosis and immunity. The expression and distribution of DRGs were investigated at the single-cell level in different GC cell types. Pearson correlation analysis was used to identify the IRGs closely related to disulfidptosis. The prognostic signature of DRIGs was established using Cox and LASSO analyses. We then analyzed and evaluated the differences in long-term prognosis, Gene Set Enrichment Analysis (GSEA), immune infiltration, mutation profile, CD274 expression, and response to chemotherapeutic drugs between the two groups. A tissue array containing 63 paired GC specimens was used to verify the expression of 4 DRIGs and disulfidptosis regulator SLC7A11 through immunohistochemistry staining. RESULTS: The scRNA-seq analysis found that SLC7A11, SLC3A2, RPN1 and NCKAP1 were enriched in specific cell types and closely related to immune infiltration. Four DIRGs (GLA, HIF-1α, VPS35 and CDC37) were successfully identified to establish a signature to potently predict the survival time of GC patients. Patients with high risk scores generally experienced worse prognoses and exhibited greater resistant to classical chemotherapy drugs. Furthermore, the expression of GLA, HIF-1α, VPS35, CDC37 and SLC7A11 were elevated in GC tissues. A high expression of GLA, HIF-1α, VPS35 or CDC37 was associated with more advanced clinical stage of GC and increased SLC7A11 expression. CONCLUSION: Current study first highlights the potential value of DRIGs as biomarkers in GC. We successfully constructed a robust model incorporating four DRIGs to accurately predict the survival time and clinicopathological characteristics of GC patients.

6.
EMBO Rep ; 23(7): e54132, 2022 07 05.
Artículo en Inglés | MEDLINE | ID: mdl-35652247

RESUMEN

Our knowledge of the coordination of intergenerational inheritance and offspring metabolic reprogramming by gastrointestinal endocrine factors is largely unknown. Here, we showed that secretin (SCT), a brain-gut peptide, is downregulated by overnutrition in pregnant mice and women. More importantly, genetic loss of SCT in the maternal gut results in undesirable phenotypes developed in offspring including enhanced high-fat diet (HFD)-induced obesity and attenuated browning of inguinal white adipose tissue (iWAT). Mechanistically, loss of maternal SCT represses iWAT browning in offspring by a global change in genome methylation pattern through upregulation of DNMT1. SCT functions to facilitate ubiquitination and degradation of DNMT1 by activating AMPKα, which contributes to the observed alteration of DNMT1 in progeny. Lastly, we showed that SCT treatment during pregnancy can reduce the development of obesity and improve glucose tolerance and insulin resistance in offspring of HFD-fed females, suggesting that SCT may serve as a novel biomarker or a strategy for preventing metabolic diseases.


Asunto(s)
Resistencia a la Insulina , Secretina , Tejido Adiposo/metabolismo , Tejido Adiposo Pardo/metabolismo , Tejido Adiposo Blanco/metabolismo , Animales , Dieta Alta en Grasa/efectos adversos , Femenino , Humanos , Ratones , Ratones Endogámicos C57BL , Obesidad/genética , Obesidad/metabolismo , Obesidad/prevención & control , Embarazo , Secretina/metabolismo
7.
J Cardiovasc Pharmacol ; 83(2): 167-172, 2024 Feb 01.
Artículo en Inglés | MEDLINE | ID: mdl-37924289

RESUMEN

ABSTRACT: The current work was aimed at exploring the association between single nucleotide polymorphisms (SNPs) in the ICAM-1 gene, along with the identification of additional haplotypes and their potential role in the susceptibility to ischemic cardiomyopathy (ICM). The control group underwent a Hardy-Weinberg equilibrium test. The associations of genotypes and alleles with susceptibility to ICM were then analyzed using logistic regression analysis. Subsequently odds ratios (ORs) along with 95% confidence intervals (95% CI) were calculated. Interaction analysis was conducted between these SNPs. Furthermore, linkage disequilibrium analysis and haplotype analysis were performed on SNPs that showed interactions with each other. The incidence of ICM was significantly higher among individuals carrying the T allele of rs3093032 (OR = 2.032, 95% CI, 1.275-3.241, P = 0.003) relative to those with the C allele. In addition, CT genotype carriers had a higher susceptibility to ICM than CC genotype carriers (OR = 2.490, 95% CI, 1.445-4.29, P = 0.001). Furthermore, 3 SNPs (rs3093032, rs923366, rs3093030) exhibited a strong interaction with each other, whereas rs281437 showed no interaction with the other 3 SNPs. Individuals carrying the C rs3093032 -T rs923366 -C rs3093030 haplotype had an elevated risk of ICM compared with those carrying the C rs3093032 -C rs923366 -C rs3093030 haplotype (OR = 2.280, 95% CI, 1.568-3.315, P < 0.001). Moreover, individuals carrying the T rs3093032 -C rs923366 -C rs3093030 haplotype were more susceptible to ICM than those carrying the C rs3093032 -C rs923366 -C rs3093030 haplotype (OR = 2.388, 95% CI, 1.469-3.880, P < 0.001). Regarding rs3093032, the minor alleles and haplotypes are associated with an increased ICM risk: 3 SNPs (rs3093032, rs923366, rs3093030) in ICAM-1 have strong interaction with each other.


Asunto(s)
Cardiomiopatías , Predisposición Genética a la Enfermedad , Humanos , Molécula 1 de Adhesión Intercelular/genética , Frecuencia de los Genes , Estudios de Casos y Controles , Genotipo , Haplotipos , Polimorfismo de Nucleótido Simple
8.
J Nanobiotechnology ; 22(1): 474, 2024 Aug 09.
Artículo en Inglés | MEDLINE | ID: mdl-39123234

RESUMEN

The activation of ferroptosis presents a versatile strategy for enhancing the antitumor immune responses in cancer therapy. However, developing ferroptosis inducers that combine high biocompatibility and therapeutic efficiency remains challenging. In this study, we propose a novel approach using biological nanoparticles derived from outer membrane vesicles (OMVs) of Escherichia coli for tumor treatment, aiming to activate ferroptosis and stimulate the immune responses. Specifically, we functionalize the OMVs by anchoring them with ferrous ions via electrostatic interactions and loading them with the STING agonist-4, followed by tumor-targeting DSPE-PEG-FA decoration, henceforth referred to as OMV/SaFeFA. The anchoring of ferrous ions endows the OMVs with peroxidase-like activity, capable of inducing cellular lipid peroxidation by catalyzing H2O2 to •OH. Furthermore, OMV/SaFeFA exhibits pH-responsive release of ferrous ions and the agonist, along with tumor-targeting capabilities, enabling tumor-specific therapy while minimizing side effects. Notably, the concurrent activation of the STING pathway and ferroptosis elicits robust antitumor responses in colon tumor-bearing mouse models, leading to exceptional therapeutic efficacy and prolonged survival. Importantly, no acute toxicity was observed in mice receiving OMV/SaFeFA treatments, underscoring its potential for future tumor therapy and clinical translation.


Asunto(s)
Ferroptosis , Ferroptosis/efectos de los fármacos , Animales , Ratones , Línea Celular Tumoral , Membrana Externa Bacteriana , Escherichia coli , Humanos , Nanopartículas/química , Femenino , Ratones Endogámicos BALB C , Peroxidación de Lípido/efectos de los fármacos , Antineoplásicos/farmacología , Antineoplásicos/química , Neoplasias del Colon/tratamiento farmacológico , Iones
9.
Artículo en Inglés | MEDLINE | ID: mdl-38758376

RESUMEN

PURPOSE: To compare the accuracy of 14 formulas in calculating intraocular lens (IOL) power in extremely long eyes with axial length (AL) over 30.0 mm. METHODS: In this retrospective study, 211 eyes (211 patients) with ALs > 30.0 mm were successfully treated with cataract surgery without complications. Ocular biometric parameters were obtained from IOLMaster 700. Fourteen formulas were evaluated using the optimized A constants: Barrett Universal II (BUII), Kane, Emmetropia Verifying Optical (EVO) 2.0, PEARL-DGS, T2, SRK/T, Holladay 1, Holladay 2, Haigis and Wang-Koch AL adjusted formulas (SRK/Tmodified-W/K, Holladay 1modified-W/K, Holladay 1NP-modified-W/K, Holladay 2modified-W/K, Holladay 2NP-modified-W/K). The mean prediction error (PE) and standard deviation (SD), mean absolute errors (MAE), median absolute errors (MedAE), and the percentage of prediction errors (PEs) within ± 0.25 D, ± 0.50 D, ± 1.00 D were analyzed. RESULTS: The Kane formula had the smallest MAE (0.43 D) and MedAE (0.34 D). The highest percentage of PE within ± 0.25 D was for EVO 2.0 (37.91%) and the Holladay 1NP-modified-W/K formulas (37.91%). The Kane formula had the highest percentage of PEs in the range of ± 0.50, ± 0.75, ± 1.00, and ± 2.00 D. There was no significant difference in PEs within ± 0.25, ± 0.50 ± 0.75 and ± 1.00 D between BUII, Kane, EVO 2.0 and Wang-Koch AL adjusted formulas (P > .05) by using Cochran's Q test. The Holladay 2modified-W/K formula has the lowest percentage of hyperopic outcomes (29.38%). CONCLUSIONS: The BUII, Kane, EVO 2.0 and Wang-Koch AL adjusted formulas have comparable accuracy for IOL power calculation in eyes with ALs > 30.0 mm.

10.
Plant Dis ; 2024 Sep 11.
Artículo en Inglés | MEDLINE | ID: mdl-39261746

RESUMEN

Metaplexis japonica (Thunb.) Makino, commonly known as rough potato, has a wide distribution in China, Japan, Korea, and adjacent Russia. In China, M. japonica is a traditional herbal medicinal plant, which is also cultivated as a vegetable (Shi et al. 2020; Wei et al. 2019). In July 2023, leaves of M. japonica plants growing near a soybean field in Qingdao, Shandong province, exhibited leaf crinkling, mosaic and distorting symptoms of probable virus infection (Supplementary Figure 1). The disease incidence in a 50 m2 area was approximately 40%. To identify the suspected viral etiological agents, symptomatic leaves from 10 M. japonica plants were collected and pooled to perform small RNA deep sequencing (sRNA-Seq). TransZol Up Total RNA Extraction Kit (TransGen Biotech, Beijing, China) was used to extract total RNA. Small RNA library construction and high-throughput sequencing (HTS) were performed on Illumina NovaSeq platform by Genepioneer (Nanjing, China) (Li et al. 2024). A total of 17,384,311 raw reads were obtained. Redundant reads were removed by cutadapt software (version 1.18) to obtain 11,580,876 clean reads with 18 to 26 nucleotide (nt) sizes. The clean reads were assembled using velvet software (version 1.1.07). A total of forty-six small contigs from 42 to 283 nt were identified, with 85 to 100% nucleotide sequence identities, respectively, to metaplexis yellow mottle-associated virus (MeYMaV, genus Caulimovirus, family Caulimoviridae, accession numbers: NC_077108.1). Finally, 1,355,955 reads (11.71% mapped ratio of total reads, cover 56.7% over the MeYMaV genome) were mapped to the genome of MeYMaV by bwa software (version 0.7.17-r1188). To confirm the sRNA-Seq results, PCR was performed with specific primers MeYMaV-N-F/MeYMaV-N-R (5'-TGGTATCAGAGCCTAGTTAA-3'/5'-GGAGTTGGTAATGTATTACC-3') and MeYMaV-C-F/MeYMaV-C-R (5'-AATGGAACGGCTGTTAGTAT3'/TTAATTTCTAGCCCTTGGCTACTTAC). Both the primer pairs were designed using GenBank accession numbers: NC_077108.1 (Yang et al. 2021) to obtain the N and C terminals genome fragments of 10 MeYMaV plants. Two amplicons approximately in 4000-, and 3900-bp sizes were amplified (Supplementary Figure 2), sequenced (tsingke, Beijing, China) and aligned to obtain 7,742-nt complete MeYMaV genome sequence (Accession no. PP892524). BLASTn analysis revealed 90.16% and 92.18% sequence identity, respectively, with the MeYMaV isolate LM-Cau-A (NC_077108.1) based on complete genome and coat protein sequences, respectively. Previously, cucumber mosaic virus and MeYMaV were reported in M. japonica from Jiangsu and Liaoning provinces in China, respectively (Yang et al. 2018; 2021). To our knowledge, this is the first natural infection report of MeYMaV in M. japonica in Shandong, China. The natural occurrence of MeYMaV is not only affects the quality of M. japonica, but also poses a potential threat to surrounding crops. This study enriches information on the disease distribution of MeYMaV and will be helpful for disease management.

11.
J Integr Plant Biol ; 66(8): 1752-1768, 2024 Aug.
Artículo en Inglés | MEDLINE | ID: mdl-38961693

RESUMEN

Dwarfing is a pivotal agronomic trait affecting both yield and quality. Citrus species exhibit substantial variation in plant height, among which internode length is a core element. However, the molecular mechanism governing internode elongation remains unclear. Here, we unveiled that the transcriptional cascade consisting of B-BOX DOMAIN PROTEIN 22 (BBX22) and ELONGATED HYPOCOTYL 5 (HY5) finely tunes plant height and internode elongation in citrus. Loss-of-function mutations of BBX22 in an early-flowering citrus (Citrus hindsii "SJG") promoted internode elongation and reduced pigment accumulation, whereas ectopic expression of BBX22 in SJG, sweet orange (C. sinensis), pomelo (C. maxima) or heterologous expression of BBX22 in tomato (Solanum lycopersicum) significantly decreased internode length. Furthermore, exogenous application of gibberellin A3 (GA3) rescued the shortened internode and dwarf phenotype caused by BBX22 overexpression. Additional experiments revealed that BBX22 played a dual role in regulation internode elongation and pigmentation in citrus. On the one hand, it directly bound to and activated the expression of HY5, GA metabolism gene (GA2 OXIDASE 8, GA2ox8), carotenoid biosynthesis gene (PHYTOENE SYNTHASE 1, PSY1) and anthocyanin regulatory gene (Ruby1, a MYB DOMAIN PROTEIN). On the other hand, it acted as a cofactor of HY5, enhancing the ability of HY5 to regulate target genes expression. Together, our results reveal the critical role of the transcriptional cascade consisting of BBX22 and HY5 in controlling internode elongation and pigment accumulation in citrus. Unraveling the crosstalk regulatory mechanism between internode elongation and fruit pigmentation provides key genes for breeding of novel types with both dwarf and health-beneficial fortification in citrus.


Asunto(s)
Citrus , Frutas , Regulación de la Expresión Génica de las Plantas , Pigmentación , Proteínas de Plantas , Citrus/genética , Citrus/crecimiento & desarrollo , Citrus/anatomía & histología , Citrus/metabolismo , Proteínas de Plantas/genética , Proteínas de Plantas/metabolismo , Regulación de la Expresión Génica de las Plantas/efectos de los fármacos , Pigmentación/genética , Frutas/genética , Frutas/crecimiento & desarrollo , Frutas/metabolismo , Giberelinas/metabolismo , Giberelinas/farmacología , Factores de Transcripción/metabolismo , Factores de Transcripción/genética , Factores de Transcripción con Cremalleras de Leucina de Carácter Básico/metabolismo , Factores de Transcripción con Cremalleras de Leucina de Carácter Básico/genética , Fenotipo
12.
Geriatr Nurs ; 59: 498-506, 2024.
Artículo en Inglés | MEDLINE | ID: mdl-39146640

RESUMEN

The objective of the study was to explore the association between basic vital signs and consciousness status in patients with primary brainstem hemorrhage (PBH). Patients with PBH were categorized into two groups based on Glasgow Coma Scale (GCS) scores: disturbance of consciousness (DOC) group (GCS=3-8) and non-DOC group (GCS=15). Within DOC group, patients were further divided into behavioral (GCS=4-8) and non-behavioral (GCS=3) subgroups. Basic vital signs, such as body temperature, heart rate, and respiratory rate, were monitored every 3 hours during the acute bleeding phase (1st day) and the bleeding stable phase (7th day) of hospitalization. The findings revealed a negative correlation between body temperature and heart rate with GCS scores in DOC group at both time points. Moreover, basic vital signs were notably higher in the DOC group compared to non-DOC group. Specifically, the non-behavioral subgroup within DOC group exhibited significantly elevated heart rates on the 1st day of hospitalization and moderately increased respiratory rates on the 7th day compared to the control group. Scatter plots illustrated a significant relationship between body temperature and heart rate with consciousness status, while no significant correlation was observed with respiratory rate. In conclusion, the study suggests that monitoring basic vital signs, particularly body temperature and heart rate, can serve as valuable indicators for evaluating consciousness status in PBH patients. These basic vital signs demonstrated variations corresponding to lower GCS scores. Furthermore, integrating basic vital sign monitoring with behavioral assessment could enhance the assessment of consciousness status in PBH patients.


Asunto(s)
Estado de Conciencia , Escala de Coma de Glasgow , Signos Vitales , Humanos , Masculino , Femenino , Anciano , Estado de Conciencia/fisiología , Temperatura Corporal , Frecuencia Cardíaca/fisiología , Tronco Encefálico/fisiopatología , Monitoreo Fisiológico/métodos , Trastornos de la Conciencia/fisiopatología , Persona de Mediana Edad , Frecuencia Respiratoria
13.
Zhongguo Zhong Yao Za Zhi ; 49(7): 1762-1773, 2024 Apr.
Artículo en Zh | MEDLINE | ID: mdl-38812188

RESUMEN

The study aimed to investigate the therapeutic effects of the n-butanol extract of Pulsatilla Decoction(BEPD) on ulcerative colitis(UC) via the bone morphogenetic protein(BMP) signaling pathway. C57BL/6 mice were divided into six groups: control, model, mesalazine, and BEPD low-, medium-, and high-dose groups. Except for the control group, the rest groups were treated with 3% dextran sulfate sodium(DSS) freely for seven consecutive days to establish the UC mouse model, followed by treatment with different concentrations of BEPD and mesalazine by gavage. The murine body weight and disease activity index(DAI) were recorded. After the mice were sacrificed, their colon tissues were collected for histological analysis. Alcian blue/periodic acid-Schiff(AB/PAS) staining was used to detect the number and mucus secretion status of goblet cells; immunohistochemistry was performed to measure the expression of ki67, cleaved caspase-3, mucin 2(Muc2), and matrix metalloproteinase-9(MMP9) in colon tissues; and immunofluorescence was used to analyze the expression of tight junction proteins in colon tissues, and enzyme linked immunosorbent assay(ELISA) was employed to quantify the levels of tumor necrosis factor-α(TNF-α), interleukin(IL)-1ß, and IL-6. Western blot was conducted to evaluate the expression of BMP pathway-related proteins in mouse colon tissues. Quantitative real-time PCR(qRT-PCR) was performed to measure the expression of genes related to goblet cell differentiation in mouse colon tissues. In addition, this study also examined the protective effect and underlying mechanism of BEPD-containing serum on lipopolysaccharide(LPS)-induced barrier damages in LS174T goblet cells in vitro. The results showed that BEPD significantly alleviated UC symptoms in mice, restored goblet cell diffe-rentiation function, promoted Muc2 secretion and tight junction protein expression, and suppressed inflammatory factor secretion while activating the BMP signaling pathway. Therefore, BEPD may exert its therapeutic effects on UC by activating the BMP signaling pathway, providing a new strategy for drug intervention in UC.


Asunto(s)
Colitis Ulcerosa , Medicamentos Herbarios Chinos , Pulsatilla , Transducción de Señal , Animales , Humanos , Masculino , Ratones , Proteínas Morfogenéticas Óseas/metabolismo , Proteínas Morfogenéticas Óseas/genética , Colitis Ulcerosa/tratamiento farmacológico , Colitis Ulcerosa/metabolismo , Medicamentos Herbarios Chinos/farmacología , Medicamentos Herbarios Chinos/administración & dosificación , Ratones Endogámicos C57BL , Pulsatilla/química , Transducción de Señal/efectos de los fármacos
14.
J Proteome Res ; 22(3): 908-918, 2023 03 03.
Artículo en Inglés | MEDLINE | ID: mdl-36648763

RESUMEN

Peritoneal fibrosis progression is regarded as a significant cause of the loss of peritoneal function, markedly limiting the application of peritoneal dialysis (PD). However, the pathogenesis of peritoneal fibrosis remains to be elucidated. Tissue-derived extracellular vesicles (EVs) change their molecular cargos to adapt the environment alteration, mediating intercellular communications and play a significant role in organ fibrosis. Hence, we performed, for the first time, four-dimensional label-free quantitative liquid chromatography-tandem mass spectrometry proteomic analyses on EVs from normal peritoneal tissues and PD-induced fibrotic peritoneum in mice. We demonstrated the alterations of EV concentration and protein composition between normal control and PD groups. A total of 2339 proteins containing 967 differentially expressed proteins were identified. Notably, upregulated proteins in PD EVs were enriched in processes including response to wounding and leukocyte migration, which participated in the development of fibrosis. In addition, EV proteins of the PD group exhibited unique metabolic signature compared with those of the control group. The glycolysis-related proteins increased in PD EVs, while oxidative phosphorylation and fatty acid metabolism-related proteins decreased. We also evaluated the effect of cell-type specificity on EV proteins, suggesting that mesothelial cells mainly cause the alterations in the molecular composition of EVs. Our study provided a useful resource for further validation of the key regulator or therapeutic target of peritoneal fibrosis.


Asunto(s)
Vesículas Extracelulares , Diálisis Peritoneal , Fibrosis Peritoneal , Ratones , Animales , Peritoneo/metabolismo , Peritoneo/patología , Fibrosis Peritoneal/metabolismo , Fibrosis Peritoneal/patología , Fibrosis Peritoneal/terapia , Proteómica/métodos , Diálisis Peritoneal/efectos adversos , Diálisis Peritoneal/métodos , Vesículas Extracelulares/patología
15.
Clin Genet ; 104(3): 313-323, 2023 09.
Artículo en Inglés | MEDLINE | ID: mdl-37310084

RESUMEN

The current study investigated the association between polymorphisms of the ICAM-1 gene and prognosis of Ischemic cardiomyopathy (ICM), and developed a prognostic nomogram for ICM on the basis of ICAM-1 gene variants. The current study included totally 252 patients with ICM. In addition, PCR-RFLP (polymerase chain reaction-restriction fragment length polymorphism) was used to genotype SNPs in the ICAM-1 gene in the patients. Later, the nomogram model was built by combining clinical data and ICAM-1 gene variants. This study used the least absolute shrinkage and selection operator (LASSO) regression model to optimize feature selection into an ICM prognostic model. Furthermore, multivariate Cox-regression was applied to build the prognostic model, which included clinical and gene features chosen by the LASSO regression model. Following that, the receiver operating characteristic (ROC) curve, C-index, calibration plot analyses and decision curve analysis (DCA) were carried out to evaluate the discrimination ability, consistency, and clinical utility of the prognostic model, and the bootstrap method was adopted for internal validation. predicting factors rs112872667, treating by PCI or CABG, ventricular arrhythmia, left ventricular end-diastolic diameter (LVDD), use of ß-blockers, systolic blood pressure (SBP), heart rate (HR), and serum sodium were incorporated into the prognostic nomogram. The constructed nomogram performed well in discrimination ability, as observed by the time-dependent C-index. Furthermore, as shown by calibration curves, our nomogram's predicted probabilities were highly consistent with measured values. With threshold probabilities, DCA suggested that our nomogram could be useful in the clinic. mutation of rs112872667 have critical predictive value on the prognosis of ICM, ICM patients with the mutant genotype (CT or TT) have higher survival probability than those with the wild genotype (CC). Mutation of rs112872667 in ICAM-1 gene have critical predictive value on the prognosis of ICM, ICM patients with the mutant genotype (CT or TT) have higher survival probability than those with the wild genotype (CC).


Asunto(s)
Cardiomiopatías , Intervención Coronaria Percutánea , Humanos , Nomogramas , Molécula 1 de Adhesión Intercelular/genética , Pronóstico , Polimorfismo de Nucleótido Simple/genética , Factor Intrinseco , Cardiomiopatías/genética
16.
Microb Pathog ; 184: 106335, 2023 Nov.
Artículo en Inglés | MEDLINE | ID: mdl-37673353

RESUMEN

BACKGROUND: Increasing studies have shown that the imbalance of the respiratory microbial flora is related to the occurrence of COPD, the severity and frequency of exacerbations and mortality.However, it remains unclear how the sputum microbial flora differs during exacerbations in COPD patients manifesting emphysema phenotype, chronic bronchitis with emphysema phenotype and asthma-COPD overlap phenotype. METHODS: Sputum samples were obtained from 29 COPD patients experiencing acute exacerbations who had not received antibiotics or systemic corticosteroids within the past four weeks.Patients were divided into three groups;emphysema phenotype(E);chronic bronchitis with emphysema phenotype(B+E) and asthma-COPD overlap phenotype(ACO).We utilized metagenomic Next Generation Sequencing (mNGS) technology to analyze the sputum microbial flora in COPD patients with different phenotypes during exacerbations. RESULTS: There was no significant difference in alpha diversity and beta diversity among three groups.The microbial flora composition was similar in all three groups during exacerbations except for a significant increase in Streptococcus mitis in ACO.Through network analysis,we found Candidatus Saccharibacteria oral taxon TM7x and Fusobacterium necrophorum were the core nodes of the co-occurrence network in ACO and E respectively.They were positively correlated with some species and play a synergistic role.In B+E,Haemophilus pittmaniae and Klebsiella pneumoniae had a synergistic effect.Besides,some species among the three groups play a synergistic or antagonistic role.Through Spearman analysis,we found the relative abundance of Streptococcus mitis was negatively correlated with the number of hospitalizations in the past year(r = -0.410,P = 0.027).We also observed that the relative abundance of Prevotella and Prevotella melaninogenica was negatively correlated with age(r = -0.534,P = 0.003;r = -0.567,P = 0.001),while the relative abundance of Streptococcus oralis and Actinomyces odontolyticus was positively correlated with age(r = 0.570,P = 0.001;r = 0.480,P = 0.008).In addition,the relative abundance of Prevotella melaninogenica was negatively correlated with peripheral blood neutrophil ratio and neutrophil to lymphocyte ratio(r = -0.479,P = 0.009;r = -0.555,P = 0.002),while the relative abundance of Streptococcus sanguinis was positively correlated with peripheral blood neutrophil ratio and neutrophil to lymphocyte ratio (r = 0.450,P = 0.014;r = 0.501,P = 0.006).There was also a significant positive correlation between Oribacterium and blood eosinophil counts(r = 0.491,P = 0.007). CONCLUSION: Overall,we analyzed the sputum microbiota of COPD patients with different phenotypes and its relationship with clinical indicators, and explored the relationships between microbiota and inflammation in COPD.We hope to alter the prognosis of patients by inhibiting specific bacterial taxa related to inflammation and using guide individualized treatment in the future research.


Asunto(s)
Asma , Bronquitis Crónica , Enfisema , Enfermedad Pulmonar Obstructiva Crónica , Humanos , Esputo , Fenotipo , Inflamación
17.
Fish Shellfish Immunol ; 132: 108452, 2023 Jan.
Artículo en Inglés | MEDLINE | ID: mdl-36471559

RESUMEN

Apoptosis-associated speck-like protein containing a caspase recruitment domain (ASC), as a critical adaptor molecule in inflammasome complexes, plays an important role in mediating inflammation reaction. In this study, the complete cDNA of ASC gene with 891 bp was cloned in Qihe crucian carp Carassius auratus (named as CaASC), which was composed of a 5'-UTR of 36 bp, a 3'-UTR of 252 bp, and an ORF of 603 bp encoded 200 amino acids with a predicted isoelectric point of 5.61 and a molecular mass of 22.0 kDa. Multiple sequence alignment and motif analysis revealed that CaASC contained a conserved N-terminal Pyrin domain (PYD) and a C-terminal Caspase recruitment domain (CARD). CaASC mRNA and protein expressions were detected in selected tissues, with the highest mRNA level in the spleen. Meanwhile, CaASC gene expressions were clearly altered in intestine, gill, skin, spleen, liver and head kidney of fish challenged by Aeromonas hydrophila, LPS, and polyI:C, respectively. The recombined proteins of CaASC with fluorescent tag were over-expressed in transfected 293T cells, and the green specks were observed obviously and located in the cytoplasm. Furthermore, knockdown of CaASC reduced the expression of IL-1ß and promoted the bacterial colonization in fish tissues, while overexpression of CaASC increased the expression of IL-1ß and hampered the bacterial colonization in these tissues. Taken together, these results identified the molecular characteristics of CaASC in C. auratus, and revealed its role in regulating IL-1ß expression and restricting bacterial infection in vivo.


Asunto(s)
Enfermedades de los Peces , Infecciones por Bacterias Gramnegativas , Animales , Carpa Dorada/genética , Carpa Dorada/metabolismo , Aeromonas hydrophila/fisiología , Regulación de la Expresión Génica , Proteínas de Peces/química , Infecciones por Bacterias Gramnegativas/microbiología , ARN Mensajero/genética , ARN Mensajero/metabolismo , Enfermedades de los Peces/microbiología
18.
Arch Insect Biochem Physiol ; 113(3): e22014, 2023 Jul.
Artículo en Inglés | MEDLINE | ID: mdl-37032458

RESUMEN

QiufengN is a silkworm strain. During the feeding process of QiufengN, a mutant of black pupal cuticle QiufengNBP was found. Some silkworm pupae of the mutant were unable to easily molt during pupation, and some silkworm eggs produced by developed normally but larvae were unable to break out of the eggshells. These phenomena had not been observed in other black pupa mutants. Genetic analysis showed that the melanization trait of QiufengNBP is controlled by a recessive gene located on the autosome and follows Mendelian inheritance. Results of positional cloning and qRT-PCR showed that the occurrence of black pupae was caused by the mutation of the ebony gene on chromosome 26. 2-DE analysis of the pupal cuticle of QiufengN and QiufengNBP found that the 30K protein, the main storage protein for the growth and development of silkworms and an important energy substance for embryonic development, has changed significantly. In addition, the expression level of Bombyx mori hatching enzyme (BmHEL), which can soften the eggshell during the hatching process of silkworm, was significantly higher in the eggs of black pupae before and after hatching than in normal eggs. The mutation of ebony makes hatching difficult for silkworms, and increases in BmHEL is needed to soften the eggshell. This study showed that ebony may have important effects on the formation of silkworm pigment and egg hatching, and its formation mechanism is complex and deserves further study.


Asunto(s)
Bombyx , Animales , Bombyx/metabolismo
19.
J Dairy Sci ; 106(10): 6688-6700, 2023 Oct.
Artículo en Inglés | MEDLINE | ID: mdl-37558047

RESUMEN

Milk-clotting enzyme (MCE) is the essential active agents in dairy processing. The traditional MCE is mainly obtained from animal sources, in which calf rennet is the most widely used in cheese industry. Traditional MCE substitute is becoming necessary due to its limited production and increased cheese consumption. A novel traditional MCE substitute was produced from Bacillus velezensis DB219 in this study. The DB219 MCE exhibited a notable specific activity of 6,110 Soxhlet units/mg and 3.16-fold purification yield with 28.87% recovery through ammonium sulfate fractionation and DEAE-Sepharose Fast Flow. The purified DB219 MCE was a metalloprotease with a molecular weight of 36 kDa. The DB219 MCE was weak acid resistance and stable at pH 6.0 to 10.0 and temperature <45°C. The highest milk-clotting activity was observed in substrate at pH 5.5 added with 20 to 30 mM CaCl2. The Michaelis constant and maximal velocity for casein were 0.31 g/L and 14.22 µmol/min. The DB219 MCE preferred to hydrolyze ß-casein instead of α-casein. The DB219 MCE hydrolyzed α-casein, ß-casein, and κ-casein to generate significantly different peptides in comparison with calf rennet and ES6023 MCE (fungal MCE) through SDS-PAGE and reversed-phase HPLC analysis. The DB219 MCE mainly cleaved Thr124-Ile125 and Ser104-Phe105 bonds in κ-casein and had unique casein cleavage sites and peptide composition through LC-MS/MS analysis. The DB219 MCE was potential to be a new milk coagulant and enriched kinds of traditional MCE substitute.


Asunto(s)
Queso , Leche , Animales , Leche/química , Caseínas/química , Cromatografía Liquida/veterinaria , Espectrometría de Masas en Tándem/veterinaria , Metaloproteasas , Péptidos/análisis , Queso/análisis
20.
Ecotoxicol Environ Saf ; 262: 115161, 2023 Jun 23.
Artículo en Inglés | MEDLINE | ID: mdl-37356398

RESUMEN

Aflatoxin B1 (AFB1) is the most toxic mycotoxin contaminant, which is widely present in crops and poses a major safety hazard to animal and human health. To alleviate the cytotoxic effects of AFB1 on the intestine, we tested the protective effects of porcine ß-defensin-2 (pBD-2). Results demonstrated that pBD-2 inhibited oxidative stress induced by AFB1 via decreasing the levels of ROS and enhancing the expression of antioxidant factors SOD-2 and NQO-1. In addition, pBD-2 attenuated AFB1-induced intestinal porcine epithelial cell line-J2 (IPEC-J2) injury through blocking mitochondria-mediated apoptosis. In vivo, pBD-2 treatment restored the intestinal mucosal structure and reduced the expression levels of apoptosis factors caspase-3 and Bax/Bcl-2. In conclusion, these results indicated that pBD-2 can alleviate AFB1-induced intestinal mucosal injury by inhibiting oxidative stress and mitochondria-mediated apoptosis. This study provides an effective strategy in developing pBD-2 as green feed additive to prevent AFB1 damage to animals.

SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA