Neurodegeneration in frontotemporal lobar degeneration and motor neurone disease associated with expansions in C9orf72 is linked to TDP-43 pathology and not associated with aggregated forms of dipeptide repeat proteins.

AIMS: A hexanucleotide expansion in C9orf72 is the major genetic cause of inherited behavioural variant Frontotemporal dementia (bvFTD) and motor neurone disease (MND), although the pathological mechanism(s) underlying disease remains uncertain. METHODS: Using antibodies to poly-GA, poly-GP, poly-GR, poly-AP and poly-PR proteins, we examined sections of cerebral cortex, hippocampus, thalamus, cerebellum and spinal cord, from 20 patients with bvFTD and/or MND bearing an expansion in C9orf72 for aggregated deposits of dipeptide repeat proteins (DPR). RESULTS: Antibodies to poly-GA, poly-GP and poly-GR detected numerous rounded cytoplasmic inclusions (NCI) within granule cells of hippocampal dentate gyrus and those of the cerebellum, as well as 'star-burst' shaped NCI in pyramidal neurones of CA3/4 region of hippocampus. NCI were uncommon in Purkinje cells, and only very rarely seen in anterior horn cells. Poly-PA antibody detected occasional NCI within CA3/4 neurones alone, whereas poly-PR antibody did not identify any NCI but immunostained the nucleus of anterior horn cells, CA3/4 neurones and Purkinje cells, in patients with or without expansion in C9orf72, as well as in normal controls. Poly-GA antibody generally detected more DPR than poly-GP, which in turn was greater than poly-GR. All patients with bvFTD + MND or MND showed plentiful p62/TDP-43 positive inclusions in remaining anterior horn cells. CONCLUSION: Degeneration and loss of anterior horn cells associated with expansions in C9orf72 occurs in the absence of DPR, and implies that changes involving loss of nuclear staining for and a cytoplasmic aggregation of TDP-43 are more likely to be the cause of this.

Usefulness of colonoscopic examination with indigo carmine in diagnosing microscopic colitis.

Microscopic colitis, comprising collagenous colitis and lymphocytic colitis, is epitomized by chronic watery diarrhea, endoscopically normal colonic mucosa, and characteristic histopathological features. Reports on chromoendoscopic findings in microscopic colitis are scarce and in this paper we describe such findings. We have examined 13 patients with microscopic colitis by means of chromoendoscopy with indigo carmine 0.2 % - 0.5 %. In all 13 cases continuous mucosal changes were seen, with disappearance of innominate grooves or with irregularity of grooves. The segmental distribution of abnormal chromoendoscopic findings corresponded almost completely with the microscopic features. A diffuse mosaic pattern was found in five of 10 cases of collagenous colitis and in all three cases of lymphocytic colitis. Uneven surface was seen in four cases of collagenous colitis, one of collagenous colitis in remission, and one of lymphocytic colitis, and a nodular surface was recorded in five cases of collagenous colitis but in none of the lymphocytic colitis cases. If these findings can be reproduced in larger series of microscopic colitis cases, the need for biopsies as a diagnostic tool might be restricted to patients where chromoendoscopy shows clear mucosal changes, thereby saving costs and limiting possible complications associated with multiple biopsies.

Disturbed CD4+ T cell homeostasis and in vitro HIV-1 susceptibility in transgenic mice expressing T cell line-tropic HIV-1 receptors.

T cell line-tropic (T-tropic) HIV type 1 strains enter cells by interacting with the cell-surface molecules CD4 and CXCR4. We have generated transgenic mice predominantly expressing human CD4 and CXCR4 on their CD4-positive T lymphocytes (CD4+ T cells). Their primary thymocytes are susceptible to T-tropic but not to macrophage-tropic HIV-1 infection in vitro, albeit with a viral antigen production less efficient than human peripheral blood mononuclear cells. Interestingly, even without HIV infection, transgenic mice display a CD4+ T cell depletion profile of peripheral blood reminiscent of that seen in AIDS patients. We demonstrate that CD4+ T cell trafficking in transgenic mice is biased toward bone marrow essentially due to CXCR4 overexpression, resulting in the severe loss of CD4+ T cells from circulating blood. Our data suggest that CXCR4 plays an important role in lymphocyte trafficking through tissues, especially between peripheral blood and bone marrow, participating in the regulation of lymphocyte homeostasis in these compartments. Based on these findings, we propose a hypothetical model in which the dual function of CXCR4 in HIV-1 infection and in lymphocyte trafficking may cooperatively induce progressive HIV-1 infection and CD4+ T cell decline in patients.

A coordinated change in chemokine responsiveness guides plasma cell movements.

Antibody-secreting plasma cells are nonrecirculatory and lodge in splenic red pulp, lymph node medullary cords, and bone marrow. The factors that regulate plasma cell localization are poorly defined. Here we demonstrate that, compared with their B cell precursors, plasma cells exhibit increased chemotactic sensitivity to the CXCR4 ligand CXCL12. At the same time, they downregulate CXCR5 and CCR7 and have reduced responsiveness to the B and T zone chemokines CXCL13, CCL19, and CCL21. We demonstrate that CXCL12 is expressed within splenic red pulp and lymph node medullary cords as well as in bone marrow. In chimeric mice reconstituted with CXCR4-deficient fetal liver cells, plasma cells are mislocalized in the spleen, found in elevated numbers in blood, and fail to accumulate normally in the bone marrow. Our findings indicate that as B cells differentiate into plasma cells they undergo a coordinated change in chemokine responsiveness that regulates their movements in secondary lymphoid organs and promotes lodgment within the bone marrow.

Outcomes of multimodality therapy for stage IVB esophageal cancer with distant organ metastasis (M1-Org).

Esophageal cancer patients with distant organ metastasis have usually been treated only to palliate symptoms without multimodality therapy. The current study evaluates the role of multimodality therapy in esophageal squamous cell cancer patients with distant organ metastasis. Between February 1988 and January 2007, 80 esophageal squamous cell cancer patients with distant organ metastases were treated at our institution. Multimodality therapy was performed in 58 patients: 43 patients received chemoradiotherapy, 13 underwent surgery followed by chemotherapy and/or radiation therapy, and two received chemotherapy or chemoradiotherapy followed by surgery. Thirteen patients received single-modality therapy; chemotherapy, radiotherapy, or surgery alone. The remaining nine patients received best supportive care alone. The metastatic organ was the liver (n= 40), the lungs (n= 33), bone (n= 10), and other (n= 6). Nine patients had metastasis in two organs. There was no difference in the median survival among the sites of organ metastasis, lung, liver, or bone (P= 0.8786). The survival of patients treated with multimodality therapy was significantly better than that of the patients who received single-modality therapy or best supportive care alone (P < 0.0001). In patients treated with multimodallity therapy, there was no difference in survival for patients treated with surgery compared with patients treated without surgery (P= 0.1291). This retrospective study involves an inevitable issue of patient selection bias. However, these results suggested that multimodality therapy could improve survival of the esophageal squamous cell cancer patients with distant organ metastasis.

Minor salivary gland carcinomas of oral cavity and oropharynx.

This paper reviews 22 cases of minor salivary gland carcinoma of the oral cavity or oropharynx which were treated at Kurume University Hospital between 1976 and 2005. Minor salivary gland carcinoma was observed in eight of 362 patients with cancer of the oral cavity (2 per cent), and in 14 of 275 patients with cancer of the oropharynx (5 per cent). The five-year and 10-year survival rates of patients with oropharyngeal minor salivary gland carcinoma were 90 per cent. No statistically significant difference was observed between survival rates for oropharyngeal minor salivary gland carcinoma and for oropharyngeal squamous cell carcinoma (p = 0.06). The five- and 10-year survival rates of patients with oral cavity minor salivary gland carcinoma were 75 and 37 per cent, respectively. No statistically significant difference was observed between survival rates for oral cavity minor salivary gland carcinoma and oral cavity squamous cell carcinoma.Patients' survival results correlated well with the clinical stage of their lesions. A significant difference in survival was observed, comparing stage IV with stages I, II and III (p = 0.04). In contrast, no significant relationship was found between either survival and tumour type or survival and treatment. Adjuvant therapy is recommended for patients with grade III adenoid cystic carcinoma with perineural infiltration or intravascular infiltration.

Prevalence of adult-onset multifactorial disease among offspring of atomic bomb survivors.

The first study to examine whether parental radiation exposure leads to increased heritable risk of common adult-onset multifactorial diseases (i.e., hypertension, diabetes mellitus, hypercholesterolemia, ischemic heart disease, and stroke) was conducted among 11,951 participants in the clinical examination program out of a potential of 24,673 mail survey subjects who were offspring of survivors born from May 1946 through December 1984. Logistic regression analyses demonstrated no evidence of an association between the prevalence of multifactorial diseases in the offspring and parental radiation exposure, after adjusting for age, city, gender and various risk factors. The odds ratio (OR) for a paternal dose of 1 Gy was 0.91 [95% confidence interval (CI) 0.81-1.01, P = 0.08], and that for a maternal dose of 1 Gy was 0.98 (95% CI 0.86-1.10, P = 0.71). There was no apparent effect of parental age at exposure or of elapsed time between parental exposure and birth, but male offspring had a low odds ratio (OR = 0.76 at 1 Gy) for paternal exposure, but cautious interpretation is needed for this finding. The clinical assessment of nearly 12,000 offspring of A-bomb survivors who have reached a median age of about 50 years provided no evidence for an increased prevalence of adult-onset multifactorial diseases in relation to parental radiation exposure.

First Report of Tomato chlorotic spot virus Infecting Spilanthes oleracea in Brazil.

Spilanthes oleracea L., popularly known as toothache plant, belongs to the family Asteraceae and is a South American native plant. Fresh leaves can be eaten for their medicinal properties or used by the cosmetics industry for their spilol contents. Plants showing leaf deformation that were collected in a field in São Paulo State, Brazil in March 2005 were suspected to be infected by a virus. Electron microscopy of leaf dip preparations of symptomatic plants revealed pleiomorphic particles typical of tospoviruses. Extracts from these plants prepared with 0.01 M sodium phosphate buffer, pH 7.0, containing 1% sodium sulfite were mechanically inoculated to indicator plants. Chenopodium amaranticolor and Gomphrena globosa were symptomless. Necrotic local lesions were observed on C. quinoa. Necrotic local lesions followed by a systemic necrosis that caused the death of the plants were observed on Datura stramonium, Nicotiana glutinosa, and N. tabacum 'TNN' and 'Turkish'. Concentric rings followed by systemic necrosis and plant death were induced on N. rustica, N. tabacum 'Havana 425', N. clevelandii, Physalis floridana, Capsicum annum 'Magda', and Solanum lycopersicum 'Santa Clara'. Total RNA was extracted (1) from infected S. oleracea and N. rustica plants for reverse transcription-PCR amplification with tospovirus specific primers BR60 (5' CCCGGATCCTGCAGAGCAATTGTGTCA 3') and BR65 (5' ATCAAGCCTTCTGAAAGTCAT 3') (2), which amplified an approximate 440-bp fragment covering part of the nucleocapsid protein gene. This fragment was sequenced (EMBL Accession No. AM887766) and showed 99% nt sequence identity with Tomato chlorotic spot virus (TCSV) (GenBank Accession No. AF521102), a tospovirus species (3). To our knowledge, this is the first report of a tospovirus infecting S. oleracea in Brazil and indicates that this plant might constitute a reservoir of TCSV or other tospoviruses that could also infect tomato and pepper plants. References: (1) Y. D. Bertheau et al. DNA amplification by polymerase chain reaction (PCR) 1998 in: Methods for the Detection and Quantification of Erwinia carotovora subsp. atroseptica on Potatoes. M. C. N. Perombelon and J. M. van der Wolf, eds. Scott. Crop Res. Inst. Occas. Publ. Dundee, Scotland, 1998. (2) M. Eiras et al. Fitopatol. Bras. 26:170, 2001. (3) F. Lovato et al. Virus Genes 29:321, 2004.

Dioxin-like activity of brominated dioxins as individual compounds or mixtures in in vitro reporter gene assays with rat and mouse hepatoma cell lines.

In vitro reporter gene assays detecting dioxin-like compounds have been developed and validated since the middle 1990's, and applied to the determination of dioxin-like activities in various samples for their risk management. Data on characterizing the potency of individual brominated dioxins and their activity in mixture with chlorinated dioxins are still limited on the cell-based assay. This study characterized the dioxin-like activities of the 32 brominated dioxins, such as polybrominated dibenzo-p-dioxins, polybrominated dibenzofurans (PBDFs), coplanar polybrominated biphenyls, mixed halogenated dibenzo-p-dioxins and dibenzofurans (PXDFs), as a sole component or in a mixture by DR-CALUX (dioxin-responsive chemically activated luciferase expression) using the rat hepatoma H4IIE cell line and XDS-CALUX (xenobiotic detection systems-chemically activated luciferase expression) assays using the mouse hepatoma H1L6.1 cell line. The 2,3,7,8-TCDD-relative potencies (REPs) of most of the brominated dioxins were within a factor of 10 of the WHO toxicity equivalency factor (WHO-TEF) for the chlorinated analogues. The REPs of a few PXDFs were an order of magnitude higher than the corresponding WHO-TEFs, indicating their toxicological importance. Results with reconstituted mixtures suggest that the activity of brominated and chlorinated dioxins in both CALUX assays was dose-additive. Thus, obtained results indicated the applicability of the CALUX assays as screening tools of brominated dioxins together with their chlorinated analogues.

Temporal and spatial variations in structural protein expression during the progression from stunned to hibernating myocardium.

BACKGROUND: Dysfunctional and normally perfused remote regions show equal myolysis and glycogen accumulation in pig hibernating myocardium. We tested the hypothesis that these arose secondary to elevations in preload rather than ischemia. METHODS AND RESULTS: Expression of structural protein (desmin, desmoplakin, titin, cardiotin, alpha-smooth muscle actin, lamin-A/C, and lamin-B2) in viable dysfunctional myocardium was analyzed by immunohistochemistry. We performed blinded analysis of paired dysfunctional left anterior descending coronary artery and normal remote subendocardial samples from stunned (24 hours; n=6), and hibernating (2 weeks; n=6) myocardium versus sham controls pigs (n=7). Within 24 hours, cardiac myocytes globally reexpressed alpha-smooth muscle actin. In stunned myocardium, cardiotin was globally reduced, whereas reductions in desmin were restricted to the dysfunctional region. Alterations progressed with the transition to hibernating myocardium, in which desmin, cardiotin, and titin were globally reduced. A qualitatively similar reorganization of cytoskeletal proteins occurred 3 hours after transient elevation of left ventricular end-diastolic pressure to 33+/-3 mm Hg. CONCLUSIONS: Qualitative cardiomyocyte remodeling similar to that in humans with chronic hibernation occurs rapidly after a critical coronary stenosis is applied, as well as after transient elevations in left ventricular end-diastolic pressure in the absence of ischemia. Thus, reorganization of cytoskeletal proteins in patients with viable dysfunctional myocardium appears to reflect chronic and/or cyclical elevations in preload associated with episodes of spontaneous regional ischemia.

Effects of long-term therapy with bosentan on the progression of left ventricular dysfunction and remodeling in dogs with heart failure.

OBJECTIVES: In this study, we examined the effects of long-term therapy with bosentan on the progression of LV dysfunction and remodeling in dogs with moderate HF. BACKGROUND: Acute intravenous administration of bosentan, a mixed endothelin-1 type A and type B receptor antagonist, was shown to improve left ventricular (LV) function in patients and dogs with heart failure (HF). METHODS: Left ventricular dysfunction was induced by multiple, sequential intracoronary microembolizations in 14 dogs. Embolizations were discontinued when LV ejection fraction (EF) was between 30% and 40%. Dogs were randomized to three months of therapy with bosentan (30 mg/kg twice daily, n = 7) or no therapy at all (control, n = 7). RESULTS: In untreated dogs, EF decreased from 35 +/- 1% before initiating therapy to 29 +/- 1% at the end of three months of therapy (p = 0.001), and LV end-diastolic volume (EDV) and end-systolic volume (ESV) increased (EDV: 71 +/- 3 vs. 84 +/- 8 ml, p = 0.08; ESV: 46 +/- 2 vs. 60 +/- 6 ml, p = 0.03). By contrast, in dogs treated with bosentan, EF tended to increase from 34 +/- 2% before initiating therapy to 39 +/- 1% at the end of three months of therapy (p = 0.06), and EDV and ESV decreased (EDV: 75 +/- 3 vs. 71 +/- 4 ml, p = 0.05; ESV: 48 +/- 2 vs. 43 +/- 3 ml, p = 0.01). Furthermore, compared with untreated dogs, dogs treated with bosentan showed significantly less LV cardiomyocyte hypertrophy and LV volume fraction of interstitial fibrosis. CONCLUSIONS: In dogs with moderate HF, long-term therapy with bosentan prevents the progression of LV dysfunction and attenuates LV chamber remodeling. The findings support the use of mixed endothelin-1 receptor antagonists as adjuncts to the long-term treatment of HF.

Genomic organization of the S locus: Identification and characterization of genes in SLG/SRK region of S(9) haplotype of Brassica campestris (syn. rapa).

In Brassica, two self-incompatibility genes, encoding SLG (S locus glycoprotein) and SRK (S-receptor kinase), are located at the S locus and expressed in the stigma. Recent molecular analysis has revealed that the S locus is highly polymorphic and contains several genes, i.e., SLG, SRK, the as-yet-unidentified pollen S gene(s), and other linked genes. In the present study, we searched for expressed sequences in a 76-kb SLG/SRK region of the S(9) haplotype of Brassica campestris (syn. rapa) and identified 10 genes in addition to the four previously identified (SLG(9), SRK(9), SAE1, and SLL2) in this haplotype. This gene density (1 gene/5.4 kb) suggests that the S locus is embedded in a gene-rich region of the genome. The average G + C content in this region is 32.6%. An En/Spm-type transposon-like element was found downstream of SLG(9). Among the genes we identified that had not previously been found to be linked to the S locus were genes encoding a small cysteine-rich protein, a J-domain protein, and an antisilencing protein (ASF1) homologue. The small cysteine-rich protein was similar to a pollen coat protein, named PCP-A1, which had previously been shown to bind SLG.

Tumor necrosis factor and interleukin-1 synergize with irradiation in expression of GM-CSF gene in human fibroblasts.

Tumor necrosis factor (TNF) and interleukin-1 (IL-1) improve the survival of lethally irradiated animals through production of hematopoietic growth factors. Exposure of fibroblasts to TNF (1000 U/ml) drastically increased granulocyte-macrophage colony-stimulating factor (GM-CSF) mRNA at 1 h and the level returned nearly to baseline by 24 h. Levels of GM-CSF RNA were less than basal level at 24 h after exposure to irradiation alone. In contrast, cells cultured with TNF (1 h) and then irradiated, had prominent expression of GM-CSF mRNA at 24 h. Transcriptional run-on analysis has shown that TNF stimulated the rate of GM-CSF transcription by > 10-fold in irradiated cells. Moreover, TNF stabilized GM-CSF mRNA at 24 h after irradiation; 4 increased from < 20 min in untreated cells to > 2 h in cells cultured initially with TNF and followed by irradiation. We repeated the same experiments with IL-1 and found that IL-1 had the same effects on accumulation, transcription, and stabilization of GM-CSF RNA. Our findings indicate that TNF and IL-1 synergize with irradiation in expression of GM-CSF gene in human fibroblasts; this increased expression occurs by enhancement of transcriptional rate and post-transcriptional stabilization of GM-CSF mRNA.

Chromosomal instability and radiosensitivity in myelodysplastic syndrome cells.

Myelodysplastic syndrome (MDS) is a clonal disorder of hematopoietic stem cells. To investigate whether chromosomal instability and/or DNA repair defects are involved in the development of MDS, we measured the micronucleus (MN) frequency in peripheral blood lymphocytes exposed to various doses of X-rays, using a cytokinesis-block micronucleus assay. The spontaneous MN frequencies in RAEB and RAEB-T patients were significantly higher than those in normal individuals (P = 0.0224, P = 0.008, respectively). Also, the X-ray-induced MN frequencies in RA/RARS, RAEB, and RAEB-T patients were significantly higher than those in normal individuals (P = 0.007, P = 0.003, P = 0.003, respectively, at 2 Gy). In order to elucidate the cause of unusual radiosensitivity, we measured the expression levels of nucleotide excision repair (NER) genes in peripheral blood mononuclear cells using a RT-PCR method. Reduction of NER gene expression was found in only one of 10 patients with low risk MDS, but in four of 11 patients with high risk MDS. Our data suggest that chromosomal instability and DNA repair defects may be involved in the pathophysiology of disease progression of MDS.

Transcriptional regulation of the gene for epidermal growth factor-like peptides in sea urchin embryos.

Exogastrula-inducing peptides (EGIPs), which are epidermal growth factor-related peptides of the sea urchin Anthocidaris crassispina, are substances that elicit abnormal gastrulation (exogastrulation) during embryogenesis of the sea urchin. In the present study we have examined the regulation of the expression of the EGIP precursor gene (EGIP) in sea urchin embryos. Whole mount in situ hybridization showed that EGIP is zygotically expressed afterthe onset of gastrulation in subdomains of the embryonic and larval ectoderm. The expression is confined in early gastrulae to small ectodermal regions adjoining the vegetal plate, which progressively expand to almost the entire ectoderm except the oral hood and postoral tips of the arms in later stages. In adults the expression is restricted to the ovary. Zygotic EGIP expression is sensitive to dissociation of embryonic cells, as well as to disruption of the extracellular matrix (ECM) with 5-cis-hydroxyproline, suggesting requirements for interaction with neighboring cells and/or with the ECM. The expression of reporter genes (chloramphenicol acetyl transferase and green fluorescent protein) under the regulation of the 4.6 kb upstream region of EGIP is temporally and spatially similar to that of the endogenous gene, showing that EGIP expression is regulated at the transcription level during embryogenesis by the cis-elements within the 4.6 kb upstream region.

Characterization of expressed genes in the SLL2 region of self-compatible Arabidopsis thaliana.

Self-incompatibility in Brassica species is regulated by a set of S-locus genes: SLG, SRK, and SP11/SCR. In the vicinity of the S-locus genes, several expressed genes, SLL2 and SP2/ClpP, etc., were identified in B. campestris. Arabidopsis thaliana is a self-compatible Brassica relative, and its complete genome has been sequenced. From comparison of the genomic sequences between B. campestris and A. thaliana, microsynteny between gene clusters of Arabidopsis and Brassica SLL2 regions was observed, though the S-locus genes, SLG, SRK, and SP11/SCR were not found in the region of Arabidopsis. Almost all genes predicted in this region of Arabidopsis were expressed in both vegetative and reproductive organs, suggesting that the genes in the SLL2 region might not be related to self-incompatibility. Considering the recent speculation that the S-locus genes were translocated as a single unit between Arabidopsis and Brassica, the translocation might have occurred in the region between the SLL2 and SP7 genes.

Highly conserved 5'-flanking regions of two self-incompatibility genes, SLG9 and SRK9.

The nucleotide (nt) sequences of the 5'-flanking regions of two Brassica self-incompatibility genes, SLG9 and SRK9, were determined. Their sequences were highly conserved: a region spanning 1.9 kb in the 5'-flanking region was completely identical except for a 1319-bp segment in SLG9. These observations strongly suggest that SLG9 and SRK9 together with their promoter regions were involved in a gene duplication or conversion event which occurred before the 1319-bp SLG9-specific sequence was inserted in SLG9 or deleted in SRK9.

Direct cloning of the Brassica S locus by using a P1-derived artificial chromosome (PAC) vector.

Self-incompatibility of Brassica is regulated by the S locus, which contains several genes including SLG and SRK. We found that both SLG and SRK genes were located at an approx. 80-kb MluI fragment in an S9 haplotype of B. campestris. Therefore, we cloned this MluI fragment into a BssHII site of the P1-derived artificial chromosome (PAC) vector. The utility of the direct cloning method is discussed in this study.

Induction of a novel cytochrome P450 (CYP93 family) by methyl jasmonate in soybean suspension-cultured cells.

We isolated a cDNA encoding a novel cytochrome P450 (CYP93A1) from soybean suspension-cultured cells that had been treated with methyl jasmonate (MeJA). The amino acid sequence of the gene product had 30-40% identity with those of other plant P450s. The protein contained the heme-binding domain which is highly conserved among plant P450s. Transcription of the cytochrome P450 gene in soybean cells was induced by 30 microM MeJA even in the presence of cycloheximide, and reached maximum level 6 h after MeJA treatment. This is the first report of a plant cytochrome P450 gene whose transcription is induced by MeJA even without protein synthesis.