Hard X-ray stereographic microscopy for single-shot differential phase imaging.

The characterisation of fast phenomena at the microscopic scale is required for the understanding of catastrophic responses of materials to loads and shocks, the processing of materials by optical or mechanical means, the processes involved in many key technologies such as additive manufacturing and microfluidics, and the mixing of fuels in combustion. Such processes are usually stochastic in nature and occur within the opaque interior volumes of materials or samples, with complex dynamics that evolve in all three dimensions at speeds exceeding many meters per second. There is therefore a need for the ability to record three-dimensional X-ray movies of irreversible processes with resolutions of micrometers and frame rates of microseconds. Here we demonstrate a method to achieve this by recording a stereo phase-contrast image pair in a single exposure. The two images are combined computationally to reconstruct a 3D model of the object. The method is extendable to more than two simultaneous views. When combined with megahertz pulse trains of X-ray free-electron lasers (XFELs) it will be possible to create movies able to resolve 3D trajectories with velocities of kilometers per second.

Molecular dynamics study of the competitive binding of hydrogen peroxide and water molecules with DNA phosphate groups.

The interaction of hydrogen peroxide molecules with the DNA double helix is of great interest for understanding the mechanisms of anticancer therapy utilising heavy ion beams. In the present work, a molecular dynamics study of competitive binding of hydrogen peroxide and water molecules with phosphate groups of the DNA double helix backbone was carried out. The system of DNA double helix in a water solution with hydrogen peroxide molecules and Na[Formula: see text] counterions was simulated. The results show that the hydrogen peroxide molecules bind to oxygen atoms of the phosphate groups of the double helix backbone replacing water molecules of its hydration shell. The complexes of hydrogen peroxide molecules with the phosphate groups are stabilized by one or two hydrogen bonds and by Na[Formula: see text] counterions, forming ion-mediated contacts between phosphate groups and hydrogen peroxide molecules. The complex characterized by one H-bond between the hydrogen peroxide molecule and phosphate group is dominant, the other complexes are rare. The hydrogen peroxide molecule bound to the phosphate group of the double helix backbone can inhibit the formation of hydrogen bonds indispensable for the DNA biological functioning.

Pattern preferences of DNA nucleotide motifs by polyamines putrescine2+, spermidine3+ and spermine4.

The interactions of natural polyamines (putrescine2+, spermidine3+ and spermine4+) with DNA double helix are studied to characterize their nucleotide sequence pattern preference. Atomistic Molecular Dynamics simulations have been carried out for three systems consisting of the same DNA fragment d(CGCGAATTCGCGAATTCGCG) with different polyamines. The results show that polyamine molecules are localized with well-recognized patterns along the double helix with different residence times. We observed a clear hierarchy in the residence times of the polyamines, with the longest residence time (ca 100ns) in the minor groove. The analysis of the sequence dependence shows that polyamine molecules prefer the A-tract regions of the minor groove - in its narrowest part. The preferable localization of putrescine2+, spermidine3+ and spermine4+ in the minor groove with A-tract motifs is correlated with modulation of the groove width by a specific nucleotide sequences. We did develop a theoretical model pointing to the electrostatic interactions as the main driving force in this phenomenon, making it even more prominent for polyamines with higher charges. The results of the study explain the specificity of polyamine interactions with A-tract region of the DNA double helix which is also observed in experiments.

Interaction of Conazole Pesticides Epoxiconazole and Prothioconazole with Human and Bovine Serum Albumin Studied Using Spectroscopic Methods and Molecular Modeling.

The interactions of epoxiconazole and prothioconazole with human serum albumin and bovine serum albumin were investigated using spectroscopic methods complemented with molecular modeling. Spectroscopic techniques showed the formation of pesticide/serum albumin complexes with the static type as the dominant mechanism. The association constants ranged from 3.80 × 104-6.45 × 105 L/mol depending on the pesticide molecule (epoxiconazole, prothioconazole) and albumin type (human or bovine serum albumin). The calculated thermodynamic parameters revealed that the binding of pesticides into serum albumin macromolecules mainly depended on hydrogen bonds and van der Waals interactions. Synchronous fluorescence spectroscopy and the competitive experiments method showed that pesticides bind to subdomain IIA, near tryptophan; in the case of bovine serum albumin also on the macromolecule surface. Concerning prothioconazole, we observed the existence of an additional binding site at the junction of domains I and III of serum albumin macromolecules. These observations were corroborated well by molecular modeling predictions. The conformation changes in secondary structure were characterized by circular dichroism, three-dimensional fluorescence, and UV/VIS absorption methods.

Fungicide Tebuconazole Influences the Structure of Human Serum Albumin Molecule.

Studies of interactions between pesticides and target mammalian proteins are important steps toward understanding the pesticide's toxicity. Using calorimetric and spectroscopic methods, the interaction between triazole fungicide tebuconazole and human serum albumin has been investigated. The spectroscopic techniques showed that fluorescence quenching of human serum albumin by tebuconazole was the result of the formation of tebuconazole/human serum albumin complex with the static type as the dominant mechanism. The association constant was found to be 8.51 × 103 L/mol. The thermodynamic parameters were obtained as ΔH = -56.964 kJ/mol, ΔS = -115.98 J/mol·K. The main active interactions forming the tebuconazole/human serum albumin complex were identified as the interplay between hydrogen bonds and/or van der Waals forces, based on thermodynamic experiments. These binding modes were corroborated well by the predictions of molecular modeling. Hydrogen bonding of tebuconazole with Arg222, Ala215 and Ala291 of human serum albumin played a relevant role in binding. The conformation changes in secondary structure were characterized by circular dichroism and 3D fluorescence spectra.

Fast Fresnel propagation through a set of inclined reflecting planes applicable for X-ray imaging.

We present a fast and accurate method for wave propagation through a set of inclined reflecting planes. It is based on the coordinate transformation in reciprocal space leading to a diffraction integral, which can be calculated only by using two 2D Fast Fourier Transforms and one 2D interpolation. The method is numerically tested, and comparisons with standard methods show its superiority in both computational speed and accuracy. The direct application of this method is found in the X-ray phase contrast imaging using the Bragg magnifier-an optics consisting of crystals asymmetrically diffracting in Bragg geometry.

Single-distance phase retrieval algorithm for Bragg Magnifier microscope.

We present an improved, single-distance phase retrieval algorithm applicable for holographic X-ray imaging of biological objects for an in-line germanium Bragg Magnifier Microscope (BMM). The proposed algorithm takes advantage of a modified shrink-wrap algorithm for phase objects, robust unwrapping algorithm as well as other reasonable constraints applied to the wavefield at the object and the detector plane. The performance of the algorithm is analyzed on phantom objects and the results are shown and discussed. We demonstrated the suitability of the algorithm for the phase retrieval on a more complex biological specimen Tardigrade, where we achieved successful phase retrieval from only a single hologram. The spatial resolution obtained by Fourier spectral power method for biological objects is ∼ 300 nm, the same value as obtained from the reconstructed test pattern. Our results achieved using the new algorithm confirmed the potential of BMM for in-vivo, dose-efficient single-shot imaging of biological objects.

Boolean network-based model of the Bcl-2 family mediated MOMP regulation.

BACKGROUND: Mitochondrial outer membrane permeabilization (MOMP) is one of the most important points in the majority of apoptotic signaling cascades and it is controlled by a network of interactions between the members of the Bcl-2 family. METHODS: To understand the role of individual members of this family within the MOMP regulation, we have constructed a Boolean network-based model of interactions between the Bcl-2 proteins. RESULTS: Computational simulations have revealed the existence of trapping states which, independently from the incoming stimuli, block the occurrence of MOMP. Our results emphasize the role of the antiapoptotic protein Mcl-1 in the majority of these configurations. We demonstrate here the importance of the Bid and Bim for activation of effectors Bax and Bak, and the irreversibility of this activation. The model further points to the antiapoptotic protein Bcl-w as a key factor preventing Bax activation. CONCLUSIONS: In spite of relative simplicity, the Boolean network-based model provides useful insight into main functioning logic of the Bcl-2 switch, consistent with experimental findings.

Revealing the origins of vortex cavitation in a Venturi tube by high speed X-ray imaging.

Hydrodynamic cavitation is useful in many processing applications, for example, in chemical reactors, water treatment and biochemical engineering. An important type of hydrodynamic cavitation that occurs in a Venturi tube is vortex cavitation known to cause luminescence whose intensity is closely related to the size and number of cavitation events. However, the mechanistic origins of bubbles constituting vortex cavitation remains unclear, although it has been concluded that the pressure fields generated by the cavitation collapse strongly depends on the bubble geometry. The common view is that vortex cavitation consists of numerous small spherical bubbles. In the present paper, aspects of vortex cavitation arising in a Venturi tube were visualized using high-speed X-ray imaging at SPring-8 and European XFEL. It was discovered that vortex cavitation in a Venturi tube consisted of angulated rather than spherical bubbles. The tangential velocity of the surface of vortex cavitation was assessed considering the Rankine vortex model.

Hetastarch induced volume changes of starving adenoma and suggested mechanism of action.

Submucosal injection is often required step during endoscopic mucosal resection (EMR). In clinical practice we have observed that the EMR injection solution containing hetastarch (HES) lead to selective increase of the neoplasms volume, facilitating their resection. The aim of this study was to explore the possible mechanisms of such behaviour, which was not reported elsewhere. The HCT116 cell line of human colon cancer was exposed to the same EMR solution in vitro. The significant volume increase of HCT116 cells was observed, but only for starving cell culture, suggesting that the starving is essential for the neoplasms-specific volume change. We suggest, that for the iso-oncotic composition of the EMR submucosa injection solution the HES component is crucial, as it can be subject of the starch hydrolysis followed by facilitated transport of resulting monosaccharides from the submucosa into the neoplastic tissue.

The XBI BioLab for life science experiments at the European XFEL.

The science of X-ray free-electron lasers (XFELs) critically depends on the performance of the X-ray laser and on the quality of the samples placed into the X-ray beam. The stability of biological samples is limited and key biomolecular transformations occur on short timescales. Experiments in biology require a support laboratory in the immediate vicinity of the beamlines. The XBI BioLab of the European XFEL (XBI denotes XFEL Biology Infrastructure) is an integrated user facility connected to the beamlines for supporting a wide range of biological experiments. The laboratory was financed and built by a collaboration between the European XFEL and the XBI User Consortium, whose members come from Finland, Germany, the Slovak Republic, Sweden and the USA, with observers from Denmark and the Russian Federation. Arranged around a central wet laboratory, the XBI BioLab provides facilities for sample preparation and scoring, laboratories for growing prokaryotic and eukaryotic cells, a Bio Safety Level 2 laboratory, sample purification and characterization facilities, a crystallization laboratory, an anaerobic laboratory, an aerosol laboratory, a vacuum laboratory for injector tests, and laboratories for optical microscopy, atomic force microscopy and electron microscopy. Here, an overview of the XBI facility is given and some of the results of the first user experiments are highlighted.

Phase retrieval for arbitrary Fresnel-like linear shift-invariant imaging systems suitable for tomography.

We present a generalization of the non-iterative phase retrieval in X-ray phase contrast imaging applicable for an arbitrary linear shift-invariant (LSI) imaging system with a non-negligible amount of free space propagation (termed as Fresnel-like). Our novel approach poses no restrictions on the propagation distance between optical elements of the system. In turn, the requirements are only demanded for the transfer function of the optical elements, which should be approximable by second-order Taylor polynomials. Furthermore, we show that the method can be conveniently used as an initial guess for iterative phase retrieval, resulting in faster convergence. The proposed approach is tested on synthetic and experimentally measured holograms obtained using a Bragg magnifier microscope - a representative of Fresnel-like LSI imaging systems. Finally, the algorithm is applied to a whole micro-tomographic scan of a biological specimen of a tardigrade, revealing morphological details at the spatial resolution of 300 nm - limiting resolution of the actual imaging system.

Coarse-Grained Simulation of Rodlike Higher-Order Quadruplex Structures at Different Salt Concentrations.

We present a coarse-grained (CG) model of a rodlike higher-order quadruplex with explicit monovalent salts, which was developed from radial distribution functions of an underlying reference atomistic molecular dynamics simulation using inverse Monte Carlo technique. This work improves our previous CG model and extends its applicability beyond the minimal salt conditions, allowing its use at variable ionic strengths. The strategies necessary for the model development are clearly explained and discussed. The effects of the number of stacked quadruplexes and varied salt concentration on the elasticity of the rodlike higher-order quadruplex structures are analyzed. The CG model reproduces the deformations of the terminal parts in agreement with experimental observations without introducing any special parameters for terminal beads and reveals slight differences in the rise and twist of the G-quartet arrangement along the studied biopolymer. The conclusions of our study can be generalized for other G-quartet-based structures.

Characterization of the interaction of hypericin with protein kinase C in U-87 MG human glioma cells.

A fluorescence imaging technique was used to monitor intracellular localization of protein kinase C (PKC) in U-87 MG human glioma cells in the presence of hypericin (Hyp) and phorbol 12-myristate-13-acetate (PMA). It is shown that PKC localization, which reflects its activity, is influenced by Hyp and this influence is different from that observed for PMA which acts as PKC activator. Fluorescence binding experiments were used to determine the binding constants of Hyp to several isoforms of PKC. The obtained values of K(d)s (approximately 100 nM) suggest that Hyp binds with high affinity to PKC. Finally, molecular modeling was used to compare structural models of the interaction of C1B domain of PKC (PKC isoforms alpha, delta, gamma) with Hyp and our previously published model of the (C1B domain PKCgamma)/PMA complex. The influence of Hyp on PKC translocation in U-87 MG cells in comparison with PMA, colocalization fluorescence pattern of Hyp and PKC, the higher binding affinity of Hyp to PKC in comparison with known binding constants of phorbol esters, as well as the binding mode of Hyp and PMA to the C1B domain of PKC suggested by molecular modeling, support the idea that Hyp and PMA might competitively bind to the regulatory domain of PKC.

Molecular Dynamics Simulation Study of Parallel Telomeric DNA Quadruplexes at Different Ionic Strengths: Evaluation of Water and Ion Models.

Most molecular dynamics (MD) simulations of DNA quadruplexes have been performed under minimal salt conditions using the Åqvist potential parameters for the cation with the TIP3P water model. Recently, this combination of parameters has been reported to be problematic for the stability of quadruplex DNA, especially caused by the ion interactions inside or near the quadruplex channel. Here, we verify how the choice of ion parameters and water model can affect the quadruplex structural stability and the interactions with the ions outside the channel. We have performed a series of MD simulations of the human full-parallel telomeric quadruplex by neutralizing its negative charge with K(+) ions. Three combinations of different cation potential parameters and water models have been used: (a) Åqvist ion parameters, TIP3P water model; (b) Joung and Cheatham ion parameters, TIP3P water model; and (c) Joung and Cheatham ion parameters, TIP4Pew water model. For the combinations (b) and (c), the effect of the ionic strength has been evaluated by adding increasing amounts of KCl salt (50, 100, and 200 mM). Two independent simulations using the Åqvist parameters with the TIP3P model show that this combination is clearly less suited for the studied quadruplex with K(+) as counterions. In both simulations, one ion escapes from the channel, followed by significant deformation of the structure, leading to deviating conformation compared to that in the reference crystallographic data. For the other combinations of ion and water potentials, no tendency is observed for the channel ions to escape from the quadruplex channel. In addition, the internal mobility of the three loops, torsion angles, and counterion affinity have been investigated at varied salt concentrations. In summary, the selection of ion and water models is crucial as it can affect both the structure and dynamics as well as the interactions of the quadruplex with its counterions. The results obtained with the TIP4Pew model are found to be closest to the experimental data at all of the studied ion concentrations.

Multiscale simulations of human telomeric G-quadruplex DNA.

We present a coarse-grain (CG) model of human telomeric G-quadruplex, obtained using the inverse Monte Carlo (IMC) and iterative Boltzmann inversion (IBI) techniques implemented within the software package called MagiC. As a starting point, the 2HY9 human telomeric [3 + 1] hybrid, a 26-nucleobase sequence, was modeled performing a 1 µs long atomistic molecular dynamics (MD) simulation. The chosen quadruplex includes two kinds of loops and all possible combinations of relative orientations of guanine strands that can be found in quadruplexes. The effective CG potential for a one bead per nucleotide model has been developed from the radial distribution functions of this reference system. The obtained potentials take into account explicitly the interaction with counterions, while the effect of the solvent is included implicitly. The structural properties of the obtained CG model of the quadruplex provided a perfect match to those resulting from the reference atomistic MD simulation. The same set of interaction potentials was then used to simulate at the CG level another quadruplex topology (PDB id 1KF1 ) that can be formed by the human telomeric DNA sequence. This quadruplex differs from 2HY9 in the loop topology and G-strand relative orientation. The results of the CG MD simulations of 1KF1 are very encouraging and suggest that the CG model based on 2HY9 can be used to simulate quadruplexes with different topologies. The CG model was further applied to a higher order human telomeric quadruplex formed by the repetition, 20 times, of the 1KF1 quadruplex structure. In all cases, the developed model, which to the best of our knowledge is the first model of quadruplexes at the CG level presented in the literature, reproduces the main structural features remarkably well.

Molecular interaction model for the C1B domain of protein kinase C-gamma in the complex with its activator phorbol-12-myristate-13-acetate in water solution and lipid bilayer.

Detailed molecular models of the free C1B domain of protein kinase C-gamma (PKC-gamma) and the C1B domain with its activator phorbol-12-myristate-13-acetate (PMA) in water solution and in the presence of dipalmitoylphosphatidylcholine (DPPC) bilayer are presented. Molecular dynamics of the free C1B domain reveals hydrogen bonds, which are critical for the forming of the diacylglycerols/phorbol esters binding site, and indicates the important role of Gln27 for the geometry of this site. According to the model, PMA interacts with the C1B domain by hydrophobic interactions with Pro11 and Tyr22 and by three persistent hydrogen bonds between the C3 carbonyl group of PMA and Gly23 and between the C20 hydroxyl group of PMA and the Leu21 and Thr12 residues of the C1B domain. The C9 hydroxyl group of PMA does not interact with the C1B domain, but it is involved in the interaction with the DPPC bilayer. Two preferential orientations of the C1B-PMA complex toward the DPPC bilayer resulted from our molecular modeling study.

Analysis of NMR J couplings in partially protected galactopyranosides.

[carbohydrate structure: see text] Hydrogen bond mediated NMR J couplings offer additional structural information. The interpretation of these usually small (h)J couplings are, however, not necessarily straightforward. In the present case of a carbohydrate system, a four-bond classical W coupling, (4)J(HO4,H5), is more reasonable on the basis of, in particular, density functional theory calculations of spin-spin coupling constants at the UB3LYP/6-311G** level of theory.

The mathematical model of the Bcl-2 family mediated MOMP regulation can perform a non-trivial pattern recognition.

Interactions between individual members of the B-cell lymphoma 2 (Bcl-2) family of proteins form a regulatory network governing mitochondrial outer membrane permeabilization (MOMP). Bcl-2 family initiated MOMP causes release of the inter-membrane pro-apoptotic proteins to cytosol and creates a cytosolic environment suitable for the executionary phase of apoptosis. We designed the mathematical model of this regulatory network where the synthesis rates of the Bcl-2 family members served as the independent inputs. Using computational simulations, we have then analyzed the response of the model to up-/downregulation of the Bcl-2 proteins. Under several assumptions, and using estimated reaction parameters, a non-linear stimulus-response emerged, whose characteristics are associated with bistability and switch-like behavior. Interestingly, using the principal component analysis (PCA) we have shown that the given model of the Bcl-2 family interactions classifies the random combinations of inputs into two distinct classes, and responds to these by one of the two qualitatively distinct outputs. As we showed, the emergence of this behavior requires specific organization of the interactions between particular Bcl-2 proteins.

On the diffusion of hypericin in dimethylsulfoxide/water mixtures-the effect of aggregation.

Hypericin (Hyp) is a natural photosensitizing pigment with a possible application in the photodynamic therapy of cancer. Hyp is readily dissolved in dimethylsulfoxide (DMSO) but forms nonsoluble aggregates in an aqueous environment. Fluorescence spectroscopy and diffusion coefficient measurements are used to investigate the self-association of Hyp molecules in DMSO/water mixtures. Fluorescence measurements reveal that Hyp remains in its monomeric form in DMSO/water mixtures containing up to ∼20-30 wt % water. At higher water concentration, Hyp starts to form nonfluorescent aggregates. To determine the size of the aggregates, the diffusion coefficient of Hyp is determined for different DMSO/water mixtures both experimentally and theoretically. Our data indicate that the size of the aggregates increases as more water is added into DMSO. At 50 wt % water content, the effective diffusion coefficient is about 30% smaller than the calculated value for the stacked Hyp tetramer. The results indicate that in an aqueous environment, Hyp presumably produces large molecular weight stacked H-aggregates. We have also confirmed that in an aqueous environment at alkaline pH, molecules of Hyp remain in the monomeric state.