Observation of gauge invariance in a 71-site Bose-Hubbard quantum simulator.

The modern description of elementary particles, as formulated in the standard model of particle physics, is built on gauge theories1. Gauge theories implement fundamental laws of physics by local symmetry constraints. For example, in quantum electrodynamics Gauss's law introduces an intrinsic local relation between charged matter and electromagnetic fields, which protects many salient physical properties, including massless photons and a long-ranged Coulomb law. Solving gauge theories using classical computers is an extremely arduous task2, which has stimulated an effort to simulate gauge-theory dynamics in microscopically engineered quantum devices3-6. Previous achievements implemented density-dependent Peierls phases without defining a local symmetry7,8, realized mappings onto effective models to integrate out either matter or electric fields9-12, or were limited to very small systems13-16. However, the essential gauge symmetry has not been observed experimentally. Here we report the quantum simulation of an extended U(1) lattice gauge theory, and experimentally quantify the gauge invariance in a many-body system comprising matter and gauge fields. These fields are realized in defect-free arrays of bosonic atoms in an optical superlattice of 71 sites. We demonstrate full tunability of the model parameters and benchmark the matter-gauge interactions by sweeping across a quantum phase transition. Using high-fidelity manipulation techniques, we measure the degree to which Gauss's law is violated by extracting probabilities of locally gauge-invariant states from correlated atom occupations. Our work provides a way to explore gauge symmetry in the interplay of fundamental particles using controllable large-scale quantum simulators.

First Report of Colletotrichum fructicola Causing Leaf Spot on Smilax glabra Roxb in China.

Smilax glabra Roxb is a medicinal plant distributed in 17 countries and used in the production of food and tea (Wu et al. 2022). In May 2021, a leaf spot disease was observed on ~60% of S. glabra plants in a field (∼0.4 ha) in Qinzhou City, Guangxi Province. Initially, small, circular, brown spots appeared on the leaf surfaces, which then gradually expanded into large, sunken, dark brown necrotic areas. As disease progressed, lesions merged into large spots, eventually leading to defoliation. To determine the causal agent, six symptomatic plants were collected from the field. Small pieces (∼5 mm2) were cut from the infected leaves (n = 12), sterilized for two min in 1% NaOCl, and rinsed three times in sterile water. Then, the leaf tissues were placed on potato dextrose agar (PDA) with chloramphenicol (0.1 g/liter) and incubated for 3 days at 28°C (12-h photoperiod). Pure cultures were obtained by transferring hyphal tips from recently germinated spores or colony edges onto PDA. Among the 17 isolates, 15 exhibited similar morphologies. Two single-spore isolates (TFL45.1 and TFL46.2) were subjected to further morphological and molecular characterization. Colonies on PDA were grayish green with a white outer ring and cottony surface, and pale blackish green on the reverse side. Conidia were hyaline, aseptate, straight, and cylindrical, with rounded ends, and 11.4 to 16.5 µm × 4.1 to 6.1 µm (average 13.9 × 4.8 µm, n = 100). Appressoria were brown to dark brown, with a smooth edge and different shapes such as ovoid, elliptical or irregular, and 6.8 to 8.9 µm × 5.9 to 7.8 µm (average 7.7 × 6.6 µm, n = 25). For molecular identification, eight target gene sequences, internal transcribed spacer (ITS), glyceraldehydes-3-phosphate dehydrogenase (GAPHD), calmodulin (CAL), partial actin (ACT), chitin synthase (CHS-1), glutamine synthetase (GS), manganese superoxide dismutase (SOD2), and ß-tubulin (TUB) were selected for PCR amplification (Weir et al. 2012). The resulting sequences were deposited in GenBank (OR399160-61 and OR432537-50). BLASTn analysis of the obtained sequences showed 99-100% identity with those of the ex-type strain C. fructicola ICMP:18581 (JX010165, JX010033, FJ917508, FJ907426, JX009866, JX010095, JX010327, JX010405) (Weir et al. 2012). In addition, a phylogenetic analysis confirmed the isolates as C. fructicola. Therefore, based on morphological and molecular characteristics (Park et al. 2018; Weir et al. 2012), the isolates were identified as C. fructicola. To verify pathogenicity, three healthy leaves on each of six two-year-old S. glabra plants were inoculated with ∼5 mm2 mycelial discs or aliquots of 10 µl suspension (106 conidia/ml) of the strain TFL46.2, and six control plants were inoculated with sterile PDA discs or sterile water. All plants were enclosed in plastic bags and incubated in a greenhouse at 25°C (12-h photoperiod). Six days post-inoculation, leaf spot symptoms appeared on the inoculated leaves. No symptoms were detected in the controls. Experiments were replicated three times with similar results. To fulfill Koch's postulates, C. fructicola was consistently re-isolated from symptomatic tissue and confirmed by morphology and sequencing of the eight genes, whereas no fungus was isolated from the control plants. To our knowledge, this is the first report of C. fructicola causing leaf spot disease on S. glabra. Further studies will be needed to develop strategies against this disease based on the identification of this pathogen.

First Report of Exserohilum rostratum Causing Brown Spot on Spartina alterniflora in China.

Spartina alterniflora Loisel, a perennial grass, has become an invasive species in China's coastal wetlands (Zhang et al. 2018). In July 2021, brown spot symptoms were observed on S. alterniflora in a coastal wetland (21°45'48″N, 108°44'00″E) in Beihai City, Guangxi Province, China. The disease affected approximately 50% of the plants in the surveyed area (0.2 ha) and was also observed in other regions of Beihai. It caused brown lesions with a gray or whitish center on the leaves and stems of S. alterniflora. As the disease developed, it ultimately led to leaf shedding and plant death. To isolate the causal agent, 18 fragments (~ 5 mm) from six symptomatic plants (3 leaf pieces per plant) were surface sterilized with 1% NaOCl solution for 2 min and rinsed three times with sterilized water. Subsequently, the tissues were placed on potato dextrose agar (PDA) medium supplemented with chloramphenicol (0.1 g/liter) and incubated at 28°C for three days. The hyphal tips were transferred onto fresh PDA to obtain pure cultures. A total of 25 isolates were obtained, 20 of which shared similar morphologies, while the remaining five exhibited distinct morphological characteristics and were non-pathogenic to S. alterniflora. Three isolates (MC16.1.3, MC16.6.2, and MC16.8.3) were randomly selected from the 20 for further investigation. The colonies on PDA were flat with dense aerial mycelia. The colony margins were entire, light brown in the centre, white to grey at the margin; reverse dark brown in the centre, gray at the margin. Conidia were straight to slightly curved, light olive-brown to dark olive-brown, septate, measured 33.5 to 79.1 µm × 10.4 to 18.7 µm (average 52.9 × 14.4 µm, n = 100), with a distinctly protruding hilum swelled from the basal cell. For molecular identification, the genomic DNA was extracted from mycelium on PDA using the CTAB method (Guo et al. 2000). The internal transcribed spacer (ITS), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and translation elongation factor 1 alpha (TEF1-α) genes were amplified and sequenced with the primer pairs ITS1/ITS4 (White et al. 1990), GPD1/GPD2 (Berbee et al. 1999), and EF1-983/EF1-2218 (Rehner et al. 2005), respectively. A BLAST analysis revealed that the ITS (OR516787-9), GAPDH (OR523686-8), and TEF-α (OR523683-5) had 99.1 to 99.7% identity with those of E. rostratum strains BRIP 11417 (LT837836, LT882553, and LT896656) and CBS 128061 (KT265240, LT715900, and LT896658) (Hernández-Restrepo et al. 2018). Based on the concatenated sequences, a phylogenetic tree generated by PhyloSuite software (Zhang et al., 2020) through Bayesian inference (BI) and Maximum Likelihood (ML) methods placed the isolates within E. rostratum. These morphological characteristics and molecular analyses confirmed the pathogen as E. rostratum (Hernández-Restrepo et al. 2018; Kaboré et al. 2022). To confirm pathogenicity, a conidial water suspension (~ 1 × 106 conidia/ml) of each of the three strains was inoculated on nine healthy S. alterniflora plants that had been grown for six months. Control plants were treated with sterile water. All plants were then enclosed in plastic bags and incubated in a greenhouse at 28°C. Six days after inoculation, the plants exhibited symptoms similar to those observed in nature. The control plants developed no symptoms. These experiments were replicated three times with similar results. To fulfill Koch's postulates, E. rostratum was consistently re-isolated from symptomatic tissue and confirmed by morphology and sequencing, whereas no fungus was isolated from the control plants. In recent years, S. alterniflora has posed a serious threat to the indigenous biodiversity of wetland ecosystems (Zhang et al. 2018). To our knowledge, this is the first report of E. rostratum causing brown spot on S. alterniflora worldwide.

Identification of cis-acting elements upstream of regR gene in streptococcus pneumoniae.

The identification and characterization of functional cis-acting elements is of fundamental importance for comprehending the regulatory mechanisms of gene transcription and bacterial pathogenesis. The transcription factor RegR has been demonstrated to control both competence and virulence in Streptococcus pneumoniae. Despite the clear contribution of RegR to these pathways, the mechanisms underlying its transcriptional regulation remain poorly understood. In this study, we conducted mutational analysis, gene dissection and luciferase activity assays to characterize the cis-elements situated upstream of the regR gene. Our findings revealed that a 311 bp 3'-terminal DNA sequence of the spd0300 gene represents a central region of the upstream cis-acting element of regR. Further investigations identified two structurally similar enhancer-like sequences within this region which feature prominently in the regulation of regR transcription. Furthermore, employing DNA pull-down assays allowed us to enrich the trans-acting factors with the potential to interact with these cis-acting elements. Notably, we found that the competence regulator ComE was implicated in the regulation of regR transcription, a finding which was corroborated by electrophoretic mobility shift assays (EMSA) and quantitative real-time PCR analyses (qRT-PCR). Taken together, our data thus provide fresh insight into the transcriptional regulation of regR.

Interrelated Thermalization and Quantum Criticality in a Lattice Gauge Simulator.

Gauge theory and thermalization are both topics of essential importance for modern quantum science and technology. The recently realized atomic quantum simulator for lattice gauge theories provides a unique opportunity for studying thermalization in gauge theory, in which theoretical studies have shown that quantum thermalization can signal the quantum phase transition. Nevertheless, the experimental study remains a challenge to accurately determine the critical point and controllably explore the thermalization dynamics due to the lack of techniques for locally manipulating and detecting matter and gauge fields. We report an experimental investigation of the quantum criticality in the lattice gauge theory from both equilibrium and nonequilibrium thermalization perspectives, with the help of the single-site addressing and atom-number-resolved detection capabilities. We accurately determine the quantum critical point and observe that the Néel state thermalizes only in the critical regime. This result manifests the interplay between quantum many-body scars, quantum criticality, and symmetry breaking.

Scalable Multipartite Entanglement Created by Spin Exchange in an Optical Lattice.

Ultracold atoms in optical lattices form a competitive candidate for quantum computation owing to the excellent coherence properties, the highly parallel operations over spins, and the ultralow entropy achieved in qubit arrays. For this, a massive number of parallel entangled atom pairs have been realized in superlattices. However, the more formidable challenge is to scale up and detect multipartite entanglement, the basic resource for quantum computation, due to the lack of manipulations over local atomic spins in retroreflected bichromatic superlattices. In this Letter, we realize the functional building blocks in quantum-gate-based architecture by developing a cross-angle spin-dependent optical superlattice for implementing layers of quantum gates over moderately separated atoms incorporated with a quantum gas microscope for single-atom manipulation and detection. Bell states with a fidelity of 95.6(5)% and a lifetime of 2.20±0.13 s are prepared in parallel, and then connected to multipartite entangled states of one-dimensional ten-atom chains and two-dimensional plaquettes of 2×4 atoms. The multipartite entanglement is further verified with full bipartite nonseparability criteria. This offers a new platform toward scalable quantum computation and simulation.

First Report of Epicoccum latusicollum Causing Leaf Spot Disease on Banana in China.

Banana (Musa acuminata) is one of the most important fruit crops in the world. In June 2020, a leaf spot disease was detected on M. acuminata (AAA Cavendish cv. Williams B6) in a commercial plantation (∼1.2 ha), Nanning, Guangxi province, China. The disease occurred on ~30% of plants. The first symptoms were round or irregular dark brown spots on the leaf surface, which progressively expanded into large, suborbicular or irregular-shaped dark brown necrotic areas. Finally, the lesions coalesced and resulted in leaf abscission. Fragments of tissues (~5 mm) were cut from six symptomatic leaves, surface disinfected (2 min in 1% NaOCl, and rinsed three times in sterile water), and incubated on potato dextrose agar (PDA) at 28°C for 3 days. The hyphal tips from emerging colonies were transferred onto fresh PDA plates to obtain pure cultures. From the 23 isolates, 19 exhibited similar morphology. The colonies on PDA and Oatmeal agar (OA) were villose, dense, white to grey. NaOH spot test resulted in a dark green discolouration on malt extract agar (MEA) cultures. After 15 days of incubation, pycnidia were observed, which were dark, spherical or flat spherical, 67.1 to 173.1 µm (n = 64) in diameter. Conidia were oval mostly, aseptate, hyaline, guttulate, 4.1 to 6.3 × 1.6 to 2.8 µm (n = 72). Morphological features were similar to Epicoccum latusicollum (Chen et al. 2017, Qi et al. 2021). The internal transcribed spacer (ITS), the partial 28S large subunit rDNA (LSU), beta-tubulin (TUB), and RNA polymerase II second largest subunit (RPB2) genes of the three representative isolates (GX128.6.3, GX132.14.1, GX140.4.3) were amplified and sequenced using the primers ITS1/ITS4 (White et al. 1990), LR0R/LR5 (Vilgalys and Hester 1990, Rehner and Samuels 1994), TUB2-Ep-F/TUB2-Ep-R (GTTCACCTTCAAACCGGTCAATG/AAGTTGTCGGGACGGAAGAGCTG), and RPB2-Ep-F/RPB2-Ep-R (GGTCTTGTGTGCCCCGCTGAGAC/TCGGGTGACATGACAATCATGGC), respectively. The ITS (OL614830-32), LSU (OL739128-30), TUB (OL739131-33), and RPB2 (OL630965-67) sequences were 99% (478/479, 478/479, and 478/479 bp), 99% (881/882, 867/868, and 877/878 bp), 99 to 100% (332/333, 333/333, and 333/333 bp), and 100% (556/556, 559/559, and 555/555 bp) identical to those of the ex-type E. latusicollum LC5181 (KY742101, KY742255, KY742343, KY742174) (Chen et al. 2017). A phylogenetic analysis confirmed the isolates as E. latusicollum. Therefore, based on morphological and molecular data, the isolates were identified as E. latusicollum. To verify pathogenicity, healthy leaves on 1.5 months old banana plants (cv. Williams B6) were stab-wounded using a needle and inoculated with either mycelial discs (5 mm) or aliquots of 10 µl conidial suspension (106 conidia/ml). Three leaves on each of six plants were inoculated. Each leaf had four inoculation sites, two were inoculated with a representative strain, and two treated with pollution-free PDA discs or sterile water served as controls. All plants were incubated in a greenhouse at 28°C (12-h photoperiod, 80% humidity). After seven days, leaf spot appeared on the inoculated leaves. No symptoms were detected on controls. The experiments were repeated three times showed similar results. To fulfill Koch's postulates, the Epicoccum isolates were consistently re-isolated from symptomatic tissue and confirmed by morphology and sequencing. To our knowledge, this is the first report of E. latusicollum causing leaf spot on banana in China. This study may provide the basis for control of the disease.

First Report of Epicoccum latusicollum Causing Leaf Blight on Curcuma kwangsiensis in China.

Curcuma kwangsiensis S. G. Lee et C. F. Liang is a traditional Chinese medicinal plant distributed in Guangxi and Yunnan Province, China. In May 2021, a leaf blight disease on C. kwangsiensi was observed in a plantation (~ 2 ha) in Lingshan county (21°51'00″N, 108°44'00″E), Guangxi Province. Disease incidence was up to 30% (n = 200). Initially, yellow to brown, irregular, water-soaked spots appeared at the tips or margins of leaves. As the disease progressed, the lesions gradually enlarged, merged. Finally, the entire leaf wilted, leading to defoliation. To isolate the pathogen, eighteen small pieces ( ~ 5 mm2) were cut from the margin of the necrotic lesions, surface disinfected with 1% NaOCl solution for 2 min, and rinsed three times in sterile water. Then the tissues were plated onto potato dextrose agar (PDA) and incubated for 3 days at 28°C. Hyphal tips from recently germinated spores were transferred to PDA to obtain pure cultures. Twelve isolates were obtained, of which ten isolates with similar morphological characterization. Two single-spore isolates (CK45.1 and CK45.2) were subjected to further morphological and molecular characterization. Colonies on PDA were villose, had a dense growth of aerial mycelia, and appeared white to grayish eventually. Pycnidia were brown, predominantly spheroidal, and 45.0 to 205.4 µm in diameter (n = 60). Conidia were ellipsoidal, aseptate, and 3.8 to 6.1 × 1.8 to 3.6 µm (n = 90). Morphological characteristics are similar to those of Epicoccum latusicollum (Chen et al. 2017).For molecular identification, primers ITS1/ITS4 (White et al. 1990), LR0R/LR5 (Vilgalys and Hester 1990, Rehner and Samuels 1994), RPB2-Ep-F (GGTCTTGTGTGCCCCGCTGAGAC)/RPB2-Ep-R TCGGGTGACATGACAATCATGGC), and TUB2-Ep-F (GTTCACCTTCAAACCGGTCAATG)/TUB2-Ep-R (AAGTTGTCGGGACGGAAGAGCTG) were used to amplify the internal transcribed spacer (ITS), partial nuclear large subunit rDNA (LSU), RNA polymerase II second largest subunit (rpb2), and ß-tubulin (tub2) genes, respectively. The obtained ITS (OP788080-81), LSU (OP811325-26), rpb2 (OP811267-68) and tub2 (OP811269-70) sequences showed 99.8% (478/479, and 478/479 bp), 99.9% (881/882, and 870/871 bp), 99.8 to 100% (429/431, and 429/430 bp), and 99.7% (332/333, and 332/333 bp) identity with those of ex-type strain E. latusicollum CGMCC 3.18346 (KY742101, KY742255, KY742174, KY742343). In addition, a phylogenetic analysis confirmed the isolates as E. latusicollum. Therefore, based on morphological and molecular characteristics, the isolates were identified as E. latusicollum. To verify pathogenicity, healthy leaves on nine plants (1 leaf per plant) were inoculated with mycelial discs from 5-day-old water-agar medium (WA) cultures of the strain CK45.1. Each leaf had four inoculation sites, two were inoculated with a representative strain, and two treated with pollution-free WA discs served as control. Plants were covered with transparent plastic bags and maintained in a greenhouse at 25°C with a 12 h photoperiod. Six days post-inoculation, the inoculated sites of leaves showed brown lesions, while the control remained healthy. The experiments repeated three times showed similar results. Koch's postulates were fulfilled by re-isolation of E. latusicollum from the lesions. To our knowledge, this is the first report of E. latusicollum causing leaf blight of C. kwangsiensi in China. This report might provide important information for growers to manage this disease.

Ammonia-induced excess ROS causes impairment and apoptosis in porcine IPEC-J2 intestinal epithelial cells.

Ammonia is one of the most important toxic metabolites in the intestine of animals. It can cause intestinal damage and associated intestinal diseases through different endogenous or exogenous stimuli. However, the definition of harmful ammonia concentration and the molecular mechanism of ammonia - induced intestinal epithelial injury remain unclear. In this study, we found that the viability of porcine IPEC-J2 intestinal epithelial cells significantly decreased with the increase of NH4Cl dose (20-80 mM). Ammonia (40 mM NH4Cl) increased the expression level of ammonia transporter RHCG and disrupted the intestinal barrier function of IPEC-J2 cells by reducing the expression levels of the tight junction molecules ZO-1 and Claudin-1. Ammonia caused elevated levels of ROS and apoptosis in IPEC-J2 cells. This was manifested by decreased activity of antioxidant enzymes SOD and GPx, decreased mitochondrial membrane potential, and increased cytoplasmic Ca2+ concentration. In addition, the expression levels of apoptosis-related molecules Caspase-9, Caspase-3, Fas, Caspase-8, p53 and Bax were increased, the expression level of anti-apoptotic molecule Bcl-2 was decreased. Moreover, the antioxidant NAC (N-acetyl-L-cysteamine) effectively alleviated ammonia-induced cytotoxicity, reduced ROS level, Ca2+ concentration, and the apoptosis of IPEC-J2 cells. The results suggest that ammonia-induced excess ROS triggered apoptosis through mitochondrial pathway, death receptor pathway and DNA damage. This study can provide reference and theoretical basis for the definition of harmful ammonia concentration in pig intestine and the effect and mechanism of ammonia on pig intestinal health.

Occurrence of Leaf Spot Caused by Diaporthe phaseolorum on Bletilla striata in China.

Bletilla striata (Thunb.) Rchb. f. (Orchidaceae) is a traditional Chinese medicinal plant widely distributed in eastern and southern Asia. In April of 2020, a leaf spot disease on B. striata was observed in plant nurseries in Guilin, Guangxi Province, China. Disease incidence was estimated at approximately 20% (n = 150 plants) across the survey area (~ 0.3 ha). The initial symptoms were small, reddish to brown spots, circular or irregular in shape. Subsequently, they developed into large dark brown, irregular lesions. As the lesions coalesced, leaves withered and defoliated. To isolate the causal agent, eighteen small pieces (~ 5 mm2) were collected from the margin of the necrotic lesions on Chinese ground orchid, surface disinfected (2 min in 1% NaOCl, and rinsed three times in sterile water), and placed on potato dextrose agar (PDA) at 26°C for 3 days. Hyphal tips were transferred to PDA to obtain pure cultures. Twelve isolates were obtained, of which eight isolates had similar morphological characteristics. After 7 days growth on PDA, colonies were grayish-white, fluffy, with white aerial mycelium. After 3 weeks, colonies formed white aerial mycelial mats, and pycnidia developed. The α-conidia were abundant, hyaline, aseptate, ellipsoidal to fusiform, measuring 4.6 to 6.7 µm × 2.1 to 3.0 µm (n = 55), whereas the ß-conidia were hyaline, long, slender, straight or curved, measuring 10.3 to 17.2 µm × 0.9 to 1.8 µm (n = 59). Morphological features were similar to Diaporthe sp. (Santos et al. 2011, Udayanga et al. 2015). For further molecular identification, DNA was extracted from the mycelia of the representative isolate BJ26.3 following the CTAB (cetyltrimethylammonium bromide) method (Guo et al. 2000). The internal transcribed spacer (ITS) region, partial translational elongation factor subunit 1-α (EF-1α), calmodulin (CAL) , histone H3 (HIS3), ß-tubulin (TUB) genes were amplified and sequenced using the primer pairs ITS1/ITS4, EF1-728F/EF1-986R, CAL-228F/CAL-737R, CYLH3F/H3-1b, and Bt2a/Bt2b, respectively (White et al. 1990, Guarnaccia et al. 2018). The obtained sequences were deposited in NCBI GenBank under the following accession numbers: OK560457, OK539595, OK539592, OK506726, OK539598. BLAST analysis of the deposited sequences showed 99 to 100% identity with accession numbers KC343177 (563/566 bp), KC343903 (521/523 bp), KC343419 (423/427 bp), KC343661 (340/340 bp), KC344145 (658/662 bp) of D. phaseolorum CBS 127465 (Guarnaccia et al. 2018). In addition, a phylogenetic analysis using concatenated sequences confirmed BJ26.3 as D. phaseolorum. Furthermore, pathogenicity tests were carried out on 1.5-year-old B. striata plants. Healthy leaves on three plants (1 leaf per plant) were inoculated with 5 × 5 mm mycelial discs of strain BJ-26.3 from 3-day-old PDA cultures. Another three plants treated with sterile water served as the control. All plants were covered with transparent plastic bags and maintained in a greenhouse at 26°C with a 12 h photoperiod. Nine days post-inoculation, the inoculated leaves showed leaf spot symptoms, while the control plants remained healthy. The experiments repeated three times showed similar results. Finally, D. phaseolorum was consistently re-isolated from the infected leaves and confirmed by morphology and sequencing, fulfilling Koch's postulates. To our knowledge, this is the first report of D. phaseolorum causing leaf spot of B. striata worldwide. This study might provide important information for growers to manage this disease.

Identification of Neofusicoccum parvum as the causative agent of leaf spot disease on Bletilla striata in China.

Bletilla striata (Thunb.) Rchb. f. (Orchidaceae) is an essential traditional Chinese medicinal plant used to treat hemorrhage, swelling, inflammation, ulcers, and pulmonary diseases (Xu et al. 2019). In April of 2020, an unknown leaf spot disease was observed on B. striata in a plantation (~ 0.2 ha) in Nanning, Guangxi province, China. Disease incidence was estimated at approximately 25% (n = 150 plants). The initial symptoms were small brown circular spots, which then expanded into reddish to brown, circular to irregular lesions 5-10 mm in diameter. As the disease developed, the whole leaf became densely covered with lesions. Finally, the lesions coalesced, killing the leaf and resulting in defoliation. To isolate the causal agent, six symptomatic leaves were collected from individual plants. Small pieces (~ 5 mm2) were cut from the margin of the necrotic lesions (n = 18), disinfected in 1% NaOCl for 2 min before rinsing three times in sterile water, and placed on potato dextrose agar (PDA) at 26°C for 3 days. Hyphal tips from the resulting cultures were transferred to PDA to obtain pure cultures. Fifteen isolates were obtained, of which twelve isolates exhibited similar morphology. Colonies on PDA were initially white, then turned dark gray after 7 days. Pycnidia were produced on the surface of PDA after 50 days. Conidia were hyaline, aseptate, ellipsoidal to fusiform, externally smooth, thin-walled, and measuring 11.5 to 15.2 × 4.9 to 6.1 µm (mean ± SD: 13.4 ± 1.0 × 5.4 ± 0.3 µm, n = 60). Morphological features were similar to N. parvum (Phillips et al. 2013). For further molecular identification, the internal transcribed spacer (ITS) region, partial translational elongation factor subunit 1-α (EF-1α), ß-tubulin (TUB2) genes were amplified and sequenced using the primer pairs ITS1/ITS4 (White et al. 1990), EF1-728F (Carbone and Kohn 1999)/EF-2 (O'Donnell et al. 1998), and Bt2a/Bt2b (Glass and Donaldson 1995), respectively. Sequences of the two isolates BJ-111.1 and BJ-111.4 were deposited in NCBI GenBank under the following accession numbers: OM348509-10, OM397537-40. The obtained ITS, EF1-α, and TUB2 sequences showed 99% (514/516, and 513/516 bp), 99% (275/276, and 274/275 bp), and 99% (429/431, and 429/430 bp) homology with several GenBank sequences of the ex-type strain N. parvum CMW 9081 (AY236943, AY236888, and AY236917, respectively) (Zhang et al. 2017). In addition, a phylogenetic analysis confirmed the isolates as N. parvum. Therefore, the isolates were identified as N. parvum based on morphological and molecular evidence. Furthermore, pathogenicity tests were carried out on 1.5-year-old B. striata plants. Healthy leaves on six plants (1 leaf per plant) were inoculated with a 10-µl droplet of conidial suspensions (106 conidia/mL). Three plants treated with sterile water served as the control. All plants were covered with transparent plastic bags and incubated in a greenhouse at 26°C with a 12 h photoperiod. Six days post-inoculation, the inoculated leaves showed leaf spot symptoms, while the control plants remained healthy. The experiments repeated three times showed similar results. Finally, N. parvum was consistently re-isolated from the infected leaves and confirmed by morphology and sequencing, fulfilling Koch's postulates. No fungus was isolated from the controls. To our knowledge, this is the first report of N. parvum causing leaf spot of B. striata worldwide. This result will help develop disease management strategies against this pathogen.

Scenario prediction of public health emergencies using infectious disease dynamics model and dynamic Bayes.

This study was aimed to discuss the predictive value of infectious disease dynamics model (IDD model) and dynamic Bayesian network (DBN) for scenario deduction of public health emergencies (PHEs). Based on the evolution law of PHEs and the meta-scenario representation of basic knowledge, this study established a DBN scenario deduction model for scenario deduction and evolution path analysis of PHEs. At the same time, based on the average field dynamics model of the SIR network, the dimensionality reduction process was performed to calculate the epidemic scale and epidemic time based on the IDD model, so as to determine the calculation methods of threshold value and epidemic time under emergency measures (quarantine). The Corona Virus Disease (COVID) epidemic was undertaken as an example to analyze the results of DBN scenario deduction, and the infectious disease dynamics model was used to analyze the number of reproductive numbers, peak arrival time, epidemic time, and latency time of the COVID epidemic. It was found that after the M1 measure was used to process the S1 state, the state probability and the probability of being true (T) were the highest, which were 91.05 and 90.21, respectively. In the sixth stage of the development of the epidemic, the epidemic had developed to level 5, the number of infected people was about 26, and the estimated loss was about 220 million yuan. The comprehensive cumulative foreground (CF) values of O1  ∼  O3 schemes were -1.34, -1.21, and -0.77, respectively, and the final CF values were -1.35, 0.01, and -0.08, respectively. The final CF value of O2 was significantly higher than the other two options. The household infection probability was the highest, which was 0.37 and 0.35 in Wuhan and China, respectively. Under the measures of home quarantine, the numbers of confirmed cases of COVID in China and Wuhan were 1.503 (95% confidential interval (CI) = 1.328  ∼  1.518) and 1.729 (95% CI = 1.107  ∼  1.264), respectively, showing good fits with the real data. On the 21st day after the quarantine measures were taken, the number of COVID across the country had an obvious peak, with the confirmed cases of 24495, and the model prediction value was 24085 (95% CI = 23988  ∼  25056). The incubation period 1/q was shortened from 8 days to 3 days, and the number of confirmed cases showed an upward trend. The peak period of confirmed cases was advanced, shortening the overall epidemic time. It showed that the prediction results of scenario deduction based on DBN were basically consistent with the actual development scenario and development status of the epidemic. It could provide corresponding decisions for the prevention and control of COVID based on the relevant parameters of the infectious disease dynamic model, which verified the rationality and feasibility of the scenario deduction method proposed in this study.

Hemorrhagic shock caused by primary splenic pregnancy with spontaneous splenic rupture.

The subject, splenic pregnancy, is very rare and interesting with about a few cases reported to date. This case report describes a healthy 17-year-old girl admitted to our hospital who complained of amenorrhea for 30 days, intermittent abdominal pain for 3 days and worsening for 1 h. The serum human chorionic gonadotropin (hCG) was greater than 10000.0 IU/L. Pelvic ultrasonography showed a adnexal mass and empty uterine cavity. Due to consideration of "ectopic pregnancy," emergency laparoscopic surgery was performed. However, no clear lesions and bleeding points were detected during the operation. On postoperative day 2, hemoglobin level dropped sharply, meanwhile serum hCG increased significantly. Subsequent ultrasound showed a 4.4 × 4.1 × 2.6 cm gestational sac-like echo below the spleen. Laparotomy detected pregnancy tissues measured 4.0 × 3.5 cm next to the splenic hilum. Finally, the splenectomy was performed. Our case suggests that early diagnosis of splenic pregnancy is very difficult, especially when other conditions are combined. Despite this, we should still enrich ourself medical knowledge and clinical experience, and try to avoid the occurrence of splenic rupture.

Synthesis of IrO2 decorated core-shell PS@PPyNH2 microspheres for bio-interface application.

In this paper, an effective approach is demonstrated for the fabrication of IrO2-decorated polystyrene@functionalized polypyrrole (core@shell; PS@PPyNH2) microspheres. The synthesis begins with the preparation of monodispersive PS microspheres with a diameter of 490 nm, by a process of emulsifier-free emulsion polymerization, followed by a copolymerization process involving pyrrole and PyNH2 monomers in a PS microsphere aqueous suspension, to produce uniform PS@PPyNH2 microspheres with a diameter of 536 nm. The loading of 2 nm IrO2 nanoparticles onto the PS@PPyNH2 microspheres can be easily adjusted by tuning the pH value of the IrO2 colloidal solution and the PS@PPyNH2 suspension. At pH 4, we successfully obtain IrO2-decorated PS@PPyNH2 microspheres via electrostatic attraction and hydrogen bonding simultaneously between the negatively-charged IrO2 nanoparticles and the positively-charged PS@PPyNH2 microspheres. These IrO2-decorated PS@PPyNH2 microspheres exhibit a characteristic cyclic voltammetric profile, similar to that of an IrO2 thin film. The charge storage capacity is 5.19 mA cm-2, a value almost five times greater than that of PS@PPyNH2 microspheres. In addition, these IrO2-decorated PS@PPyNH2 microspheres exhibit excellent cell viability and biocompatibility.

Effects of polyvinyl chloride microplastics and benzylalkyldimethylethyl compounds on system performance, microbial community and resistance genes in sulfur autotrophic denitrification system.

Benzylalkyldimethylethyl ammonium compounds (BAC) and polyvinyl chloride microplastics (PVC MPs), as the frequently detected pollutants in wastewater treatment plants (WWTPs), have attracted more concerns on their ecosystem risks. Therefore, this study investigated how the sulfur autotrophic denitrification (SAD) system responded to the single and joint stress of PVC MPs (1, 10 and 100 mg/L) and BAC (0.5, 5 and 10 mg/L). After 100 days of operation, the presence of 10 mg/L BAC led to obviously inhibitory effects on system performance and microbial metabolic activity. And the additions of PVC MPs or/and BAC stimulated the proliferation of intracellular resistance genes (RGs), whereas exposure to BAC increased the abundances of extracellular RGs and free RGs in water more significantly. Compared to the joint stress, BAC single stress resulted in higher abundances of free RGs in water, which further increased the risk of RGs propagation. Moreover, the interaction between mobile genetic elements and extracellular polymeric substances further increased the spread of RGs. Pathogens might be the potential hosts of RGs and enriched in SAD system and plastisphere, thereby leading to more serious ecological risks. This study will broaden the understanding of the environmental hazards posed by PVC MPs and BAC in WWTPs.

Whatever does not kill them makes them stronger: Using quaternary ammonia antimicrobials to alleviate the inhibition of ammonia oxidation under perfluorooctanoic acid stress.

Perfluorooctanoic acid (PFOA), benzalkyl dimethylammonium compounds (BAC) and antibiotic resistance genes (ARGs) have negative effects on biological sewage treatment. The performance of nitrification systems under stress of PFOA (0.1-5 mg/L) or/and BAC (0.2-10 mg/L) was explored during 84-day experiments using four sequencing batch reactors, in this study. Low (0.1 mg/L) concentration PFOA had a positive influence on ammonia removal, while medium and high (2 and 5 mg/L) concentrations PFOA caused severe inhibition. Meanwhile, PFOA stress resulted in the enrichment of ARGs in water (w-ARGs). BAC (0-10 mg/L) had no obvious influence on ammonia removal. However, BAC promoted the reduction of ARGs and the bacterial community was the main participator (48.07%) for the spread of ARGs. Interestingly, the joint stress of PFOA and BAC increased the ammonia-oxidizing bacteria (AOB) activity from 5.81 ± 0.19 and 6.05 ± 0.79 mg N/(g MLSS·h) to 7.09 ± 0.87 and 7.23 ± 0.29 mg N/(g MLSS·h) in medium and high concentrations, compared to single stress of PFOA, which was observed for the first time. BAC could reduce bioavailability of PFOA through competitive adsorption and decreasing sludge hydrophobicity by the lower ß-Sheet and α-Helix in tightly bound protein. Furthermore, the joint stress of PFOA and BAC was able to intensify the proliferation of w-ARGs and extracellular ARGs in sludge, and developed the most active horizontal gene transfer mediated by intl1 compared to single stress of PFOA or BAC. The batch tests verified the detoxification capacity of BAC on nitrification under 2.5 mg/L PFOA (48 h exposing), and the maximum alleviation of AOB activity was achieved at BAC and PFOA mass ratio of 2:1. In summary, BAC could be used to alleviate the inhibition of PFOA on ammonia oxidation, providing an efficient and sustainable approach in wastewater treatment.

The synergistic effect of periodate/ferrate (VI) system on disinfection of antibiotic resistant bacteria and removal of antibiotic resistant genes: The dominance of Fe (IV)/Fe (V).

The proliferation of antibiotic resistant genes (ARGs) and antibiotic resistant bacteria (ARB) caused by antibiotic abuse has raised concerns about the global infectious-disease crisis. This study employed periodate (PI)/ferrate (VI) (Fe (VI)) system to disinfect Gram-negative ARB (Escherichia coli DH5α) and Gram-positive bacteria (Bacillus subtilis ATCC6633). The PI/Fe (VI) system could inactivate 1 × 108 CFU/mL of Gram-negative ARB and Gram-positive bacteria by 4.0 and 2.8 log in 30 min. Neutral and acidic pH, increase of PI dosage and Fe (VI) dosage had positive impacts on the inactivation efficiency of ARB, while alkaline solution and the coexistence of 10 mM Cl-, NO3-, SO42- and 20 mg/L humic acid had slightly negative impacts. The reactive species generated by PI/Fe (VI) system could disrupt the integrity of cell membrane and wall, leading to oxidative stress and lipid peroxidation. Intracellular hereditary substance, including DNA and ARGs (tetA), would leak into the external environment through damaged cells and be degraded. The electron spin resonance analysis and quenching experiments indicated that Fe (IV)/Fe (V) played a leading role in disinfection. Meanwhile, PI/Fe (VI) system also had an efficient removal effect on sulfadiazine, which was expected to inhibit the ARGs transmission from the source.

Natural pyrite and ascorbic acid co-enhance periodate activation for inactivation of antibiotic resistant bacteria and inhibition of resistance genes transmission: A green disinfection process dominated by singlet oxygen.

The transmission of antibiotic resistance genes (ARGs) and the propagation of antibiotic resistant bacteria (ARB) threaten public health security and human health, and greener and more efficient disinfection technologies are expected to be discovered for wastewater treatment. In this study, natural pyrite and ascorbic acid (AA) were proposed as environmental-friendly activator and reductant for periodate (PI) activation to inactivate ARB. The disinfection treatment of PI/pyrite/AA system could inactivate 5.62 log ARB within 30 min, and the lower pH and higher PI and natural pyrite dosage could further boost the disinfection efficiency. The 1O2 and SO4•- were demonstrated to be crucial for the inactivation of ARB in PI/pyrite/AA system. The disinfection process destroyed the morphological structure of ARB, inducing oxidative stress and stimulating the antioxidant system. The PI/pyrite/AA system effectively reduced the intracellular and extracellular DNA concentration and ARGs abundance, inhibiting the propagation of ARGs. The presence of AA facilitated the activation of PI with natural pyrite and significantly increased the concentration of Fe2+ in solution. The reusability of natural pyrite, the safety of the disinfection by-products and the inhibition of ARB regeneration indicated the application potential of PI/pyrite/AA system in wastewater disinfection.