Notch is an alternative splicing gene in brown planthopper, Nilaparvata lugens.

Much research has assumed that Notch codes one protein. Then the protein will be cleaved into two parts and regenerates a heterodimers receptor to construct Notch signal pathways to regulate development in the past three decades. Here, we show that Notch in brown planthopper is a complex alternatively spliced gene has at least three transcriptional start sites, four exon skips, and 21 transcriptional endpoints that uses these to form variants and codes a series of proteins. When used dsRNAs to suppression different regions of the full-length variant NlNF resulted in a similar phenotype. Insects were molting after treatment, sensation circles on antennas near to root decayed, bristles on wings shortened, thickened or disappeared, accompanied by thickening veins and blades of fore-wing apex regions thickened. These results suggested that Notch influenced developmental of sensation circles, bristles, veins, and blades in nymph late periods. This study has deepened our understanding of Notch.

MiR-126-5p Promotes Tumor Cell Proliferation, Metastasis and Invasion by Targeting TDO2 in Hepatocellular Carcinoma.

TDO2 is a key enzyme in the kynurenine metabolic pathway, which is the most important pathway of tryptophan metabolism. It has been shown that miRNAs are involved in cell metastasis through interaction with target mRNAs. In this study, we found 645 miRNAs that could be immunoprecipitated with TDO2 through the RNA-immunoprecipitation experiment. miR-126-5p was selected as the research target, which was also confirmed by dual-luciferase reporter assay. Through qRT-PCR analysis, it was verified that the overexpression of miR-126-5p promoted the expression of TDO2, PI3K/AKT and WNT1. Meanwhile, it was verified that overexpression of miR-126-5p can promote intracellular tryptophan metabolism by HPLC. We also verified the effects of miR-126-5p on cell proliferation, migration, and invasion by cck-8, cell colony formation and trans-well assay in both HCCLM3 cells and HepG2 cells. In vivo experiments were also conducted to verify that miR-126-5p promoted tumor formation and growth via immunohistochemical detection of cell infiltration and proliferation to generate markers Ki-67, BAX, and VEGF. In conclusion, our results suggest that miR-126-5p is a biomarker and a potential new treatment target in the progression of HCC via promoting the expression of TDO2.

A multiplex real-time PCR quantitation of human herpesvirus-6, 7, 8 viruses: application in blood transfusions.

BACKGROUND: In recent years, fluorescent quantitative polymerase chain reaction assays for detecting viral DNA are in widespread use throughout the world. However, considering the wide distribution of new herpesvirus among the population, we constructed a method to detect HHV-6, 7, and 8 simultaneously. METHODS: The blood samples of 74 blood donors and 45 pityriasis rosea patients were collected. The recombinant plasmids containing U67, U36, and orf65 were constructed to optimize the PCR reaction system. The forward and reverse primers and probe sequences of HHV-6 were as follows: TAAATATCGATGCCGCTCTG, ACGTTCTAGCCATCTTCTTTG, CGCAAACGACAAAGCCA. The forward and reverse primers and probe sequences of HHV-7 were as follows: TTAGACATCTTACACGACAGC, CAGCTTTTCGAACTTGTCAC, TTCATCGGGTACGTCCA. The forward and reverse primers and probe sequences of HHV-8 were as follows: GCGACATATTTCCCTGATCC, CCAACTTTAAGGTGAGAGACC, CATGCGAGCCACCAG. Through the detection of housekeeping genes, DNA sequencing, and optimization of the PCR reaction system, the triple fluorescent quantitative PCR detection system was constructed. Blood samples of blood transfusion staff and pityriasis rosea patients were detected. RESULTS: The correlations of HHV-6, 7, and 8 between single and multiplex PCR are 0.980, 0.987, 0.965, respectively. In 74 blood donor samples, 16.2% of HHV-6 and 55% of HHV-7 were positive (viral load > 3 log10 copies/ml) according to multiplex real-time PCR. In 45 patients suspected of pityriasis rosea (PR) infection, 40% HHV-6, 73.3% positive cases are found. CONCLUSION: With the safety of blood transfusion being a major concern of the public, this method will show good specificity and sensitivity in blood transfusion screening.

Acute and Subchronic Toxicities and Safety Pharmacology Studies of a Bacillus Subtilisin in Dogs.

Subtilisin NAT, a Bacillus subtilisin, is widely applied as a functional food and considered to be one of the most exploitable potential oral thrombolytic agents. Subtilisin QK, another Bacillus subtilisin, is a serine protease fermented by Bacillus subtilis 02 and has a better thrombolytic effect. Therefore, subtilisin QK is typically used for evaluating the safety of Bacillus subtilisins. Here, we conduct several good laboratory practice (GLP)-compliant studies in non-rodent animal, i.e., in Beagle dogs, including acute toxicity, subchronic toxicity, and safety pharmacology studies. No adverse effects were evident in the acute and 28-d subchronic toxicity studies at doses up to 40000 FU/kg and 16000 FU/kg/d, respectively. In evaluating the pharmacological safety of up to 2000FU/kg subtilisin QK, we found no significant differences between the electrocardiograms, blood pressures, and respiration of beagle dogs. These findings suggest the safety of Bacillus subtilisin, providing reliable pharmacological and toxicological data for its development and popularization as a functional food and drug.

Tryptophan Side-Chain Oxidase Enzyme Suppresses Hepatocellular Carcinoma Growth through Degradation of Tryptophan.

Tryptophan metabolism plays a role in the occurrence and development of hepatocellular carcinoma cells. By degrading certain amino acids, tumor growth can be limited while maintaining the body's normal nutritional requirements. Tryptophan side-chain oxidase (TSO) enzyme can degrade tryptophan, and its inhibitory effect on hepatocellular carcinoma cells is worthy of further study. To investigate the degradation effect on tryptophan, TSO was isolated and purified from qq Pseudomonas. The reaction products were identified with high performance liquid chromatography (HPLC) and high-performance liquid chromatography tandem mass spectrometry (HPLC-MS). De novo sequencing provided the complete amino acid sequence of TSO. The results of CCK-8, colony formation, transwell, and qPCR confirmed that TSO had inhibitory effects on the proliferation and migration of HCCLM3 (human hepatocarcinoma cell line) and HepG2 cells. The results of flow cytometry confirmed its apoptotic activity. In animal experiments, we found that the tumor-suppressive effect was better in the oncotherapy group than the intraperitoneal injection group. The results of immunohistochemistry also suggested that TSO could inhibit proliferation and promote apoptosis. In conclusion, a specific enzyme that can degrade tryptophan and inhibit the growth of hepatoma cells was authenticated, and its basic information was obtained by extraction/purification and amino acid sequencing.

Increased cerebellar-default-mode network connectivity at rest in obsessive-compulsive disorder.

Abnormalities of the cerebellum and default-mode network (DMN) in patients with obsessive-compulsive disorder (OCD) have been widely reported. However, alterations of reciprocal functional connections between the cerebellum and DMN at rest in OCD remain unclear. Forty patients with OCD and 38 gender-, age-, and education-matched healthy controls (HCs) underwent resting-state functional magnetic resonance imaging scan. Seed-based functional connectivity (FC) and support vector machine (SVM) were applied to analyze the imaging data. Compared with HCs, patients with OCD exhibited increased FCs between the left Crus I-left superior medial prefrontal cortex (MPFC) and between the right Crus I-left superior MPFC, left middle MPFC, and left middle temporal gyrus (MTG). A significantly negative correlation was observed between the right Crus I-left MTG connectivity and the Yale-Brown Obsessive-Compulsive Scale compulsion subscale scores in the OCD group (r = - 0.476, p = 0.002, Bonferroni corrected). SVM classification analysis indicated that a combination of the left Crus I-left superior MPFC connectivity and the right Crus I-left middle MPFC connectivity can be used to discriminate patients with OCD from HCs with a sensitivity of 85.00%, specificity of 68.42%, and accuracy of 76.92%. Our study highlights the contribution of the cerebellar-DMN connectivity in OCD pathophysiology and provides new findings to OCD research.

Integral membrane protein 2A inhibits cell growth in human breast cancer via enhancing autophagy induction.

BACKGROUND: Breast cancer is a life-threatening disease in females and the leading cause of mortality among the female population, presenting huge challenges for prognosis and treatment. ITM2A is a member of the BRICHOS superfamily, which are thought to have a chaperone function. ITM2A has been identified to related to ovarian cancer progress recently. However, the biological role of ITM2A in breast cancer remains largely unclear. METHODS: Quantitative real-time polymerase chain reaction (qRT-PCR), western blotting assay and immunohistochemistry staining were used to analyzed the expression level of ITM2A. The patient overall survival versus ITM2A expression level was evaluated by Kaplan-Meier analysis. MTT assay, EdU incorporation assay and colony formation assay were used to evaluated the role of ITM2A on breast cancer cell proliferation. Autophagy was explored through autophagic flux detection using a confocal microscope and autophagic vacuoles investigation under a transmission electron microscopy (TEM). In vitro kinase assay was used to investigated the phosphorylation modification of ITM2A by HUNK. RESULTS: Our data showed that the expression of integral membrane protein 2A (ITM2A) was significantly down-regulated in human breast cancer tissues and cell lines. Kaplan-Meier analysis indicated that patients presenting with reduced ITM2A expression exhibited poor overall survival, and expression significantly correlated with age, progesterone receptor status, TNM classification and tumor stage. ITM2A overexpression significantly inhibited the proliferation of breast cancer cells. By studying several autophagic markers and events in human breast cancer SKBR-3 cells, we further demonstrated that ITM2A is a novel positive regulator of autophagy through an mTOR-dependent manner. Moreover, we found that ITM2A was phosphorylated at T35 by HUNK, a serine/threonine kinase significantly correlated with human breast cancer overall survival and HER2-induced mammary tumorigenesis. CONCLUSION: Our study provided evidence that ITM2A functions as a novel prognostic marker and represents a potential therapeutic target.

Insulin and its single-chain analogue.

Insulin therapy remains the most effective method to treat diabetes mellitus (DM), and the demand for this valuable hormone has exceeded that of any other protein-based medicine as a result of the dramatic increase in the number of diabetic patients worldwide. Understanding the structure of insulin and the interaction with its receptor is important for developing proper formulations. As a result of the relatively low thermal stability of native insulin and its two-chain analogues, the application of single-chain insulin (SCI) analogues, which can be obtained relatively easily by recombinant DNA technology or chemical synthetic methods, represents a promising alternative approach. In this review, the basic knowledge of insulin (discovery, biosynthesis, and structure) and the current model of the interaction with its receptor are outlined. Furthermore, we outline the strategies for the design and production of various SCI analogues and their reported applications.

Secretory expression and surface display of a new and biologically active single-chain insulin (SCI-59) analog by lactic acid bacteria.

Insulin plays an important role in drug therapies for diabetes mellitus and as the main route of insulin delivery, subcutaneous injection may cause local discomfort, hypoglycemia, hyperinsulinemia, and patient non-compliance. Therefore, oral delivery of insulin is more preferred. However, there is a low bioavailability due to insulin degradation by proteolytic enzymes and severe pH conditions along the gastrointestinal tract. In order to use the food-grade bacteria lactic acid bacteria (LAB) as oral delivery vehicles, a new and bioactive single-chain insulin (SCI-59) analog, containing the insulin B- and A-chains connected by an eight-residue linker (RSRGLPFR), was secretory expressed in Lactococcus lactis NZ3900 without using an antibiotic resistance gene and displayed onto the surface of various non-viable bacteria (NVBs) without genetic modification. Both the free SCI-59 and SCI-59 displayed on the surface of NVBs are biologically active as assayed by their ability to stimulate Akt signaling in differentiated 3T3-L1 adipocytes. Modification of the pH of the medium by NaOH addition at early time during induction can enhance the bioactivity of SCI-59. The C-terminal fused anchoring domain, three LysM repeats, does not affect the formation of disulfide bonds and/or the folding of SCI-59, and SCI-59 could be exposed properly and fully when SCI-59-3LysM bound to the surface of NVBs. Compared to the free form SCI-59, SCI-59 displayed on the surface of NVBs is more stable in simulate gastric juice. It may open new prospects for possible oral treatments of diabetes using live LAB secreting or NVBs carrying bioactive SCI analogs.

Subtilisin QK-2: secretory expression in Lactococcus lactis and surface display onto gram-positive enhancer matrix (GEM) particles.

BACKGROUND: Purified from the supernatant of Bacillus subtilis QK02 culture broth, Subtilisin QK-2 is a type of effective thrombolytic reagent that has great exploitable potential. However, the unbearable flavor that occurs with fermentation and the complicated methods that are required to obtain pure products limit the application of this enzyme. Lactic acid bacteria (LAB)-based delivery vehicles are promising as cheap and safe options for medicinal compounds. The secretory expression and surface display using LAB may popularize Subtilisin QK-2 more easily and conveniently with minimal adverse effects. RESULTS: Subtilisin QK-2 was expressed successfully in two forms using lactic acid bacteria. For the secretory expression in Lactococcus lactis, Subtilisin QK-2 was efficiently secreted into the culture using the promoter P nisA and signal peptide SPUsp. The expression levels were not different in L. lactis NZ9000 and NZ3900 without the effect of different selection markers. However, leaky expression was only detected in L. lactis NZ3900. The biological activity of this secreted Subtilisin QK-2 was enhanced by modulating the pH of medium to slightly alkaline during induction and by codon optimization of either the entire gene sequence (qk') or only the propeptide gene sequence (qkpro'). For surface display onto gram-positive enhancer matrix (GEM) particles, n LysM repeats from the C-terminal region of the major autolysin AcmA of L. lactis were fused to either the C-terminus (n = 1, 3, 5) or the N-terminus (n = 1) of the Subtilisin QK-2. These fusion proteins were secreted into the culture medium, and the QK-3LysM was able to bind to the surface of various LAB GEM particles without a loss of fibrinolytic activity. Furthermore, the binding capacity significantly increased with a higher concentration of QK-3LysM. Compared to the free-form Subtilisin QK-2, the QK-3LysM displayed on the surface of GEM particles was more stable in the simulated gastric juice. CONCLUSIONS: Combined with the safety and popularity of LAB, Subtilisin QK-2 may be easily applied worldwide to prevent and control thrombosis diseases.

Surface display on lactic acid bacteria without genetic modification: strategies and applications.

Microbial cell surface display has attracted greater attention than ever and has numerous potential applications in biotechnology. With the safety and probiotic properties, lactic acid bacteria (LAB) have been used widely in food and industrial applications. In order to circumvent using genetically modified microorganisms which face low public acceptance and severe regulatory scrutiny, surface-engineered LAB without genetical modification are more preferred. According to the way used to obtain the fusion protein containing the passenger molecule and anchoring domain, the genetic or chemical approaches can be used to construct these surface-engineered LAB. In addition to the viable wide-type LAB, non-living bacterial-like particles (BLP) can be attached by these fusion proteins added from outside. Compared to the living LAB, BLP have a higher binding capacity and less anticarrier response. Mucosal vaccines are the predominant application of these surface-engineered LAB with no genetical modification.

Expression and immunogenic characterization of recombinant gp350 for developing a subunit vaccine against Epstein-Barr virus.

Epstein-Barr virus (EBV) is a ubiquitous human herpesvirus that is linked to the development of various malignancies. There is an urgent need for effective vaccines against EBV. EBV envelope glycoprotein gp350 is an attractive candidate for a prophylactic vaccine. This study was undertaken to produce the truncated (codons 1-443) gp350 protein (gp350(1-443)) in Pichia pastoris and evaluate its immunogenicity. The gp350(1-443) protein was expressed as a secretory protein with an N-terminal His-tag in P. pastoris and purified through Ni-NTA chromatography. Immunization with the recombinant gp350(1-443) could elicit high levels of gp350(1-443)-specific antibodies in mice. Moreover, gp350(1-443)-immunized mice developed strong lymphoproliferative and Th1/Th2 cytokine responses. Furthermore, the recombinant gp350(1-443) could stimulate CD4(+) and CD8(+) T cell responses in vaccinated mice. Collectively, these findings demonstrated that the yeast-expressed gp350(1-443) retained strong immunogenicity. This study will provide a useful source for developing EBV subunit vaccine candidates.

Efficient Tailoring of Upconversion Selectivity by Engineering Local Structure of Lanthanides in Na(x)REF(3+x) Nanocrystals.

Efficient tailoring of upconversion emissions in lanthanide-doped nanocrystals is of great significance for extended optical applications. Here, we present a facile and highly effective method to tailor the upconversion selectivity by engineering the local structure of lanthanides in Na(x)REF(3+x) nanocrystals. The local structure engineering was achieved through precisely tuning the composition of nanocrystals, with different [Na]/[RE] ([F]/[RE]) ratio. It was found that the lattice parameter as well as the coordination number and local symmetry of lanthanides changed with the composition. A significant difference in the red to green emission ratio, which varied from 1.9 to 71 and 1.6 to 116, was observed for Na(x)YF(3+x):Yb,Er and Na(x)GdF(3+x):Yb,Er nanocrystals, respectively. Moreover, the local structure-dependent upconversion selectivity has been verified for Na(x)YF(3+x):Yb,Tm nanocrystals. In addition, the local structure induced upconversion emission from Er(3+) enhanced 9 times, and the CaF2 shell grown epitaxially over the nanocrystals further promoted the red emission by 450 times, which makes it superior as biomarkers for in vivo bioimaging. These exciting findings in the local structure-dependent upconversion selectivity not only offer a general approach to tailoring lanthanide related upconversion emissions but also benefit multicolor displays and imaging.

Paradigms and challenges for bioapplication of rare earth upconversion luminescent nanoparticles: small size and tunable emission/excitation spectra.

Rare earth (RE) materials, which are excited in the ultraviolet and emit in the visible light spectrum, are widely used as phosphors for lamps and displays. In the 1960's, researchers reported an abnormal emission phenomenon where photons emitted from a RE element carried more energy than those absorbed, owing to the sequential energy transfer between two RE ions--Yb(3+)-sensitized Er(3+) or Tm(3+)--in the solid state. After further study, researchers named this abnormal emission phenomenon upconversion (UC) emission. More recent approaches take advantage of solution-based synthesis, which allows creation of homogenous RE nanoparticles (NPs) with controlled size and structure that are capable of UC emission. Such nanoparticles are useful for many applications, especially in biology. For these applications, researchers seek small NPs with high upconversion emission intensity. These UCNPs have the potential to have multicolor and tunable emissions via various activators. A vast potential for future development remains by developing molecular antennas and energy transfer within RE ions. We expect UCNPs with optimized spectra behavior to meet the increasing demand of potential applications in bioimaging, biological detection, and light conversion. This Account focuses on efforts to control the size and modulate the spectra of UCNPs. We first review efforts in size control. One method is careful control of the synthesis conditions to manipulate particle nucleation and growth, but more recently researchers have learned that the doping conditions can affect the size of UCNPs. In addition, constructing homogeneous core/shell structures can control nanoparticle size by adjusting the shell thickness. After reviewing size control, we consider how diverse applications impose different requirements on excitation and/or emission photons and review recent developments on tuning of UC spectral profiles, especially the extension of excitation/emission wavelengths and the adjustment and purification of emission colors. We describe strategies that employ various dopants and others that build rationally designed nanostructures and nanocomposites to meet these goals. As the understanding of the energy transfer in the UC process has improved, core/shell structures have been proved useful for simultaneous tuning of excitation and emission wavelengths. Finally, we present a number of typical examples to highlight the upconverted emission in various applications, including imaging, detection, and sensing. We believe that with deeper understanding of emission phenomena and the ability to tune spectral profiles, UCNPs could play an important role in light conversion studies and applications.

Recombinant VP1 protein expressed in Pichia pastoris induces protective immune responses against EV71 in mice.

Human enterovirus 71 (EV71) is one of the major causative agents of hand, foot and mouth disease and is also associated with serious neurological diseases in children. Currently, there are no effective antiviral drugs or vaccines against EV71 infection. VP1, one of the major immunogenic capsid proteins of EV71, is widely considered to be the candidate antigen for an EV71 vaccine. In this study, VP1 of EV71 was expressed as a secretory protein with an N-terminal histidine tag in the methylotrophic yeast Pichia pastoris, and purified by Ni-NTA affinity chromatography. Immunogenicity and vaccine efficacy of the recombinant VP1 were assessed in mouse models. The results showed that the recombinant VP1 could efficiently induce anti-VP1 antibodies in BALB/c mice, which were able to neutralize EV71 viruses in an in vitro neutralization assay. Passive protection of neonatal mice further confirmed the prophylactic efficacy of the antisera from VP1 vaccinated mice. Furthermore, VP1 vaccination induced strong lymphoproliferative and Th1 cytokine responses. Taken together, our study demonstrated that the yeast-expressed VP1 protein retained good immunogenicity and was a potent EV71 vaccine candidate.

Expression, purification, and immunogenic characterization of Epstein-Barr virus recombinant EBNA1 protein in Pichia pastoris.

Epstein-Barr virus (EBV) is a ubiquitous human herpesvirus associated with the development of both lymphoid and epithelial tumors. EBNA1 is the only viral protein expressed in all EBV-associated malignancies and plays important roles in EBV latency. Thus, EBNA1 is thought to be a promising antigen for immunotherapy of all EBV-associated malignancies. This study was undertaken to produce recombinant EBNA1 protein in Pichia pastoris and evaluate its immunogenicity. The truncated EBNA1 (E1ΔGA, codons 390-641) was expressed as a secretory protein with an N-terminal histidine tag in the methylotrophic yeast P. pastoris and purified by Ni-NTA affinity chromatography. The purified proteins were then used as antigens to immunize BALB/c mice for production of polyclonal antibodies. Western blot analysis showed that the polyclonal antibodies specifically recognized the EBNA1 protein in B95-8 cell lysates. The recombinant E1ΔGA also induced strong lymphoproliferative and Th1 cytokine responses in mice. Furthermore, mice immunized with E1ΔGA developed CD4+ and CD8+ T cell responses. These findings showed that the yeast-expressed E1ΔGA retained good immunogenicity and might be a promising vaccine candidate against EBV-associated malignancies.

Visual detection and evaluation of latent and lytic gene expression during Epstein-Barr virus infection using one-step reverse transcription loop-mediated isothermal amplification.

Epstein-Barr virus (EBV)-associated disease exhibits distinct gene expression patterns characterized by the transcription of EBV nuclear antigen (EBNA) 1, EBNA2, latent membrane protein (LMP) 1, LMP2A, and BZLF1 (Zebra). A series of visual reverse transcript loop-mediated isothermal amplification (RT-LAMP) assays were performed to examine the expression of EBNA1, EBNA2, LMP1, LMP2A and BZLF1. The sensitivity of RT-LAMP for these transcripts was approximately equivalent to real-time RT-PCR (RT-qPCR), which was developed to quantify relative levels of EBV transcripts, and 10 to 100-fold more sensitive than conventional RT-PCR. Cross-reactions to other viruses were not observed upon examination of cell lines infected with herpes simplex viruses-1 and -2 (HSV-1 and -2), varicella zoster virus (VZV), human cytomegalovirus (HCMV) or Kaposi's sarcoma-associated herpesvirus. When applied to 146 specimens, RT-LAMP exhibited high clinical sensitivity and specificity, with an excellent agreement (κ > 0.92) compared to RT-qPCR. These assays are convenient for rapid early diagnosis and for surveillance of EBV-infected individuals by evaluating the EBV transcriptional profile, because the results can be visualized with the naked eye. These assays may be employed in further investigations because they can aid the design of improved therapeutic regimens and can be used specifically in resource-poor settings.

Quantitative analysis of chest MRI images for benign malignant diagnosis of pulmonary solid nodules.

Background: In this study, we developed and validated machine learning (ML) models by combining radiomic features extracted from magnetic resonance imaging (MRI) with clinicopathological factors to assess pulmonary nodule classification for benign malignant diagnosis. Methods: A total of 333 consecutive patients with pulmonary nodules (233 in the training cohort and 100 in the validation cohort) were enrolled. A total of 2,824 radiomic features were extracted from the MRI images (CE T1w and T2w). Logistic regression (LR), Naïve Bayes (NB), support vector machine (SVM), random forest (RF), and extreme gradient boosting (XGBoost) classifiers were used to build the predictive models, and a radiomics score (Rad-score) was obtained for each patient after applying the best prediction model. Clinical factors and Rad-scores were used jointly to build a nomogram model based on multivariate logistic regression analysis, and the diagnostic performance of the five prediction models was evaluated using the area under the receiver operating characteristic curve (AUC). Results: A total of 161 women (48.35%) and 172 men (51.65%) with pulmonary nodules were enrolled. Six important features were selected from the 2,145 radiomic features extracted from CE T1w and T2w images. The XGBoost classifier model achieved the highest discrimination performance with AUCs of 0.901, 0.906, and 0.851 in the training, validation, and test cohorts, respectively. The nomogram model improved the performance with AUC values of 0.918, 0.912, and 0.877 in the training, validation, and test cohorts, respectively. Conclusion: MRI radiomic ML models demonstrated good nodule classification performance with XGBoost, which was superior to that of the other four models. The nomogram model achieved higher performance with the addition of clinical information.

Oral delivery of bi-autoantigens by bacterium-like particles (BLPs) against autoimmune diabetes in NOD mice.

Induction of oral tolerance by vaccination with type 1 diabetes mellitus (T1DM)-associated autoantigens exhibits great potential in preventing and treating this autoimmune disease. However, antigen degradation in the gastrointestinal tract (GIT) limits the delivery efficiency of oral antigens. Previously, bacterium-like particles (BLPs) have been used to deliver a single-chain insulin (SCI-59) analog (BLPs-SCI-59) or the intracellular domain of insulinoma-associated protein 2 (IA-2ic) (BLPs-IA-2ic). Both monovalent BLPs vaccines can suppress T1DM in NOD mice by stimulating the corresponding antigen-specific oral tolerance, respectively. Here, we constructed two bivalent BLPs vaccines which simultaneously deliver SCI-59 and IA-2ic (Bivalent vaccine-mix or Bivalent vaccine-SA), and evaluated whether there is an additive beneficial effect on tolerance induction and suppression of T1DM by treatment with BLPs-delivered bi-autoantigens. Compared to the monovalent BLPs vaccines, oral administration of the Bivalent vaccine-mix could significantly reduce morbidity and mortality in T1DM. Treatment with the bivalent BLPs vaccines (especially Bivalent vaccine-mix) endowed the mice with a stronger ability to regulate blood glucose and protect the integrity and function of pancreatic islets than the monovalent BLPs vaccines treatment. This additive effect of BLPs-delivered bi-autoantigens on T1DM prevention may be related to that SCI-59- and IA-2-specific Th2-like immune responses could be induced, which was more beneficial for the correction of Th1/Th2 imbalance. In addition, more CD4+CD25+Foxp3+ regulatory T cells (Tregs) were induced by treatment with the bivalent BLPs vaccines than did the monovalent BLPs vaccines. Therefore, multiple autoantigens delivered by BLPs maybe a promising strategy to prevent T1DM by efficiently inducing antigen-specific immune tolerance.

Comprehensive analysis of the prevalence of hepatitis B virus escape mutations in the major hydrophilic region of surface antigen.

Escape mutations in the major hydrophilic region (MHR) of hepatitis B surface antigen (HBsAg) are reported widely worldwide; these mutations lead to diagnostic problems, emergence of vaccine-escape mutants, and hepatitis B immunoglobulin (HBIG) therapy failure. However, the prevalence of these mutations in different genotypes remains to be studied systematically. In the current study, 11,221 non-redundant hepatitis B virus (HBV) sequences of 8 genotypes (from A to H), obtained from the National Center for Biotechnology Information (NCBI), were analyzed to determine the prevalence of HBsAg escape mutations that were previously described. Eight important mutations associated with diagnostic failure, P120T, T126S, Q129H, G130N, S143L, D144A, and G145A/R, were prevalent in one or more genotypes, with the frequency of no less than 1%. With regard to escape variants that evade vaccine or immunoglobulin therapy, mutations were located mainly at positions 120, 126, 129, 130, 133, 134, 137, 140, 143, 144, and 145. The majority of such mutations showed genotypic heterogeneity, indicating the different distribution of the escape mutations. Most of the escape mutations clustered in the "a" determinant, indicating that this region was more likely to be affected by immune selection or antiviral therapy than other regions. Understanding the prevalence and heterogeneity of escape mutations could provide useful guidance for the improvement of diagnostic assays, design of new vaccines, and prevention of failure of HBIG therapy.