Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 29
Filtrar
Más filtros

Bases de datos
País/Región como asunto
Tipo del documento
País de afiliación
Intervalo de año de publicación
1.
BMC Genomics ; 24(1): 599, 2023 Oct 09.
Artículo en Inglés | MEDLINE | ID: mdl-37814207

RESUMEN

BACKGROUND: MicroRNAs (miRNAs) and long non-coding RNAs (lncRNAs) are the two main types of non-coding RNAs that play crucial roles in plant growth and development. However, their specific roles in the fiber growth of ramie plant (Boehmeria nivea L. Gaud) remain largely unknown. METHODS: In this study, we performed miRNA and whole-transcriptome sequencing of two stem bark sections exhibiting different fiber growth stages to determine the expression profiles of miRNAs, lncRNAs, and protein-encoding genes. RESULTS: Among the identified 378 miRNAs and 6,839 lncRNAs, 88 miRNAs and 1,288 lncRNAs exhibited differential expression. Bioinformatics analysis revealed that 29 and 228 differentially expressed protein-encoding genes were targeted by differentially expressed miRNAs and lncRNAs, respectively, constituting eight putative competing endogenous RNA networks. lncR00022274 exhibited downregulated expression in barks with growing fibers. It also had an antisense overlap with the MYB gene, BntWG10016451, whose overexpression drastically increased the xylem fiber number and secondary wall thickness of fibers in the stems of transgenic Arabidopsis, suggesting the potential association of lncR00022274-BntWG10016451 expression with fiber growth. CONCLUSIONS: These findings provide insights into the roles of ncRNAs in the regulation of fiber growth in ramie, which can be used for the biotechnological improvement of its fiber yield and quality in the future.


Asunto(s)
Boehmeria , MicroARNs , ARN Largo no Codificante , Transcriptoma , Perfilación de la Expresión Génica , Boehmeria/genética , ARN Largo no Codificante/genética , ARN Largo no Codificante/metabolismo , MicroARNs/genética , MicroARNs/metabolismo , Raíces de Plantas/genética
2.
Plant Dis ; 2022 May 10.
Artículo en Inglés | MEDLINE | ID: mdl-35536213

RESUMEN

Cyperus difformis is a problematic annual weed in rice fields and is widely distributed throughout tropical to warm temperate regions of the world. In June 2019, many galls were observed on the roots of C. difformis growing in rice fields in Heshan District, Hengyang City, Hunan Province, China. The infected plants did not exhibit obvious aboveground symptoms. Females, males, eggs, and second-stage juveniles (J2s) of Meloidogyne spp. were found within galls after dissection. The perineal patterns of females were dorsoventrally oval shape with low and round dorsal archs, smooth striae, and lacking distinct lateral lines. Morphological measurements of females (n = 20) included body length (L) = 589.4 ± 64.7 (482.1 to 693.8) µm, body width (BW) = 362.2 ± 84.6 (267.6 to 505.9) µm, stylet = 11.7 ± 1.5 (9.7 to 14.4) µm, dorsal pharyngeal gland orifice to stylet base (DGO) = 3.8 ± 0.6 (3.3 to 5.0) µm, vulval slit length = 23.7 ± 4.4 (15.5 to 28.9) µm, vulval slit to anus distance = 16.8 ± 2.7 (13.1 to 19.4) µm. The J2s were vermiform and had a long and slender tail with tapering hyaline tail terminus. Measurements of J2s (n = 20) were L = 464.4 ± 31.7 (415.0 to 508.3) µm, BW = 16.9 ±1.7 (14.1 to 19.7) µm, stylet = 13.2 ± 0.6 (12.5 to 14.9) µm, DGO = 3.3 ± 0.5 (2.6 to 4.4) µm, tail = 71.6 ± 5.5 (65.1 to 82.0) µm, hyaline tail length = 19.4 ± 2.6 (15.3 to 23.9) µm. These morphological characteristics were similar to those previously described for M. graminicola (Golden and Birchfield 1965). Genomic DNA extracted from a single J2 was used for molecular identification. The ITS rRNA gene and the mtDNA COII-16S rRNA region were amplified using primers 18s/26s (TTGATTACGT CCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) and C2F3/1108 (GGTCAATGT TCAGAAATTTGTGG/TACCTTTGACCAATCACGCT), respectively (Powers and Harris 1993; Vrain et al. 1992). Both the ITS rRNA gene sequence (790 bp, GenBank accession no. MZ656127) and the mtDNA COII-16S rRNA region sequence (531 bp, OM161973) showed 100% identity with sequences of M. graminicola (e.g., MN647593, MG773553, MF320126; MG356945, MH332687, JN241939). Furthermore, species identification was also further validated using the M. graminicola-specific primers SCAR-MgFW/SCAR-MgRev (GGGGAAGACATTTAATTGATGATCAAC/GGTACCGAAACTTAGGGAAAG) (Bellafiore et al. 2015). The PCR products yielded the expected fragment size of 640 bp, which was identical to that previously reported for M. graminicola (Bellafiore et al. 2015). To verify the pathogenicity of this nematode, 15 30-day-old C. difformis seedlings planted in pots with sterilized soil were inoculated with 400 freshly hatched J2s from the original population of M. graminicola per plant, and five non-inoculated seedlings were used as controls. All plants were grown in a greenhouse at 26 to 28 °C with a 16 h light/8 h dark photoperiod. At 30 days after inoculation, all inoculated plants showed gall symptoms on the roots identical to those observed in the fields. The nematode reproduction factor (final population/initial population) was 12.6. No symptoms were observed on non-inoculated plants. These results confirmed the pathogenicity of M. graminicola on C. difformis. To our knowledge, this is the first report of M. graminicola naturally infecting C. difformis in China. C. difformis is an alternative host of M. graminicola and could serve as a potential reservoir for M. graminicola in field. Therefore, weed management could be an effective way to reduce the disease by eliminating source of infection of M. graminicola.

3.
Plant Dis ; 105(9): 2697-2703, 2021 Sep.
Artículo en Inglés | MEDLINE | ID: mdl-33267643

RESUMEN

The northern root-knot nematode, Meloidogyne hapla, is a biotrophic parasite that infects many crops and causes severe economic losses worldwide. Rapid and accurate detection of M. hapla is crucial for disease forecasting and control. We developed a recombinase polymerase amplification combined with a lateral flow dipstick (RPA-LFD) assay for rapid detection of M. hapla. The primers and probe were designed based on the effector gene 16D10 sequence and were highly specific to M. hapla. The RPA reaction was performed at a wide range of temperatures from 25 to 45°C within 5 to 25 min, and the amplicon was visualized directly on the LFD within 5 min. The detection limits of the RPA-LFD assay were 10-3 females and 10-2 second-stage juveniles/0.5 g of soil, which was 10 times more sensitive than the conventional PCR assay. In addition, the RPA-LFD assay can detect M. hapla from infested plant roots and soil samples, and the entire detection process can be completed within 1.5 h. These results indicate that the RPA-LFD assay is a simple, rapid, specific, sensitive, and visual method that can be used for rapid detection of M. hapla in the field and in resource-limited conditions.


Asunto(s)
Recombinasas , Tylenchoidea , Animales , Técnicas de Amplificación de Ácido Nucleico , Reacción en Cadena de la Polimerasa , Recombinasas/genética , Sensibilidad y Especificidad , Tylenchoidea/genética
4.
Eur Neurol ; 79(5-6): 325-332, 2018.
Artículo en Inglés | MEDLINE | ID: mdl-29986342

RESUMEN

BACKGROUND: Drug-resistant epilepsy (DRE) is a common and serious consequence of convulsive status epilepticus (CSE). Little is known on the early prediction of DRE development after CSE. Our aim was to identify independent DRE predictors in patients with CSE. METHODS: One hundred and forty consecutive patients identified with CSE in a tertiary academic hospital between March 2008 and January 2015 were reviewed. Demographics, clinical features, serum albumin neuroimaging, and electroencephalogram characteristics were collected and analyzed. Independent predictors of DRE were identified using multivariate logistic regression. The receiver operating characteristic (ROC) curve was used to quantify the predictive validity of all the risk factors. RESULTS: After a median 62-month observation period, 91 patients were enrolled into this study. Thirty-seven (40.7%) patients did not have DRE, 22 (24.2%) developed DRE, and 32 (35.2%) were dead. History of epilepsy (OR 9.17, 95% CI 1.77-49.22, p = 0.010), status epilepticus duration ≥24 h (OR 4.82, 95% CI 1.04-22.37, p = 0.044), and cortical or hippocampal abnormalities on neuroimaging (OR 9.49, 95% CI 1.90-47.50, p = 0.006) were independent predictors of DRE after CSE. A combination of these 3 variables yielded an area under the ROC curve of 0.77 (0.65-0.89). CONCLUSIONS: History of epilepsy, longer SE duration, and cortical or hippocampal abnormalities on neuroimaging are early predictors for the development of DRE after CSE. Further studies are needed to assess whether a more aggressive treatment will reduce the likelihood of DRE development in these high-risk patients.


Asunto(s)
Epilepsia Refractaria/etiología , Estado Epiléptico/complicaciones , Adulto , Corteza Cerebral/anomalías , Corteza Cerebral/diagnóstico por imagen , Femenino , Hipocampo/anomalías , Hipocampo/diagnóstico por imagen , Humanos , Modelos Logísticos , Masculino , Persona de Mediana Edad , Neuroimagen , Factores de Riesgo , Albúmina Sérica , Adulto Joven
5.
J Clin Microbiol ; 55(4): 1193-1204, 2017 04.
Artículo en Inglés | MEDLINE | ID: mdl-28179405

RESUMEN

Accurate diagnosis of bacterial meningitis (BM) relies on cerebrospinal fluid (CSF) Gram staining and bacterial culture, which often present high false-negative rates because of antibiotic abuse. Thus, a novel and reliable diagnostic biomarker is required. Procalcitonin (PCT) has been well demonstrated to be specifically produced from peripheral tissues by bacterial infection, which makes it a potential diagnostic biomarker candidate. Here, we performed a prospective clinical study comprising a total of 143 patients to investigate the diagnostic value of CSF PCT, serum PCT, and other conventional biomarkers for BM. Patients were assigned to the BM (n = 49), tuberculous meningitis (TBM) (n = 25), viral meningitis/encephalitis (VM/E) (n = 34), autoimmune encephalitis (AIE) (n = 15), or noninflammatory nervous system diseases (NINSD) group (n = 20). Empirical antibiotic pretreatment was not an exclusion criterion. Our results show that the CSF PCT level was significantly (P < 0.01) higher in patients with BM (median, 0.22 ng/ml; range, 0.13 to 0.54 ng/ml) than in those with TBM (median, 0.12 ng/ml; range, 0.07 to 0.16 ng/ml), VM/E (median, 0.09 ng/ml; range, 0.07 to 0.11 ng/ml), AIE (median, 0.06 ng/ml; range, 0.05 to 0.10 ng/ml), or NINSD (median, 0.07 ng/ml; range, 0.06 to 0.08 ng/ml). Among the assessed biomarkers, CSF PCT exhibited the largest area under the receiver operating characteristic curve (0.881; 95% confidence interval, 0.810 to 0.932; cutoff value, 0.15 ng/ml; sensitivity, 69.39%; specificity, 91.49%). Our study sheds light upon the diagnostic dilemma of BM due to antibiotic abuse. (This study has been registered at ClinicalTrials.gov under registration no. NCT02278016.).


Asunto(s)
Antibacterianos/uso terapéutico , Biomarcadores/líquido cefalorraquídeo , Calcitonina/líquido cefalorraquídeo , Líquido Cefalorraquídeo/química , Meningitis Bacterianas/diagnóstico , Adolescente , Adulto , Anciano , Anciano de 80 o más Años , Biomarcadores/sangre , Calcitonina/sangre , Femenino , Humanos , Masculino , Meningitis Bacterianas/tratamiento farmacológico , Meningitis Bacterianas/patología , Persona de Mediana Edad , Estudios Prospectivos , Curva ROC , Sensibilidad y Especificidad , Suero/química , Adulto Joven
6.
J Stroke Cerebrovasc Dis ; 26(1): 125-131, 2017 Jan.
Artículo en Inglés | MEDLINE | ID: mdl-27645612

RESUMEN

BACKGROUND: Anticoagulation therapy has been recommended by major guidelines to reduce the risk of recurrent stroke in patients with atrial fibrillation-associated ischemic stroke (AFAIS). However, in real-world clinical practice, oral anticoagulants with either vitamin K antagonists or nonvitamin K antagonists are often underused for these patients. Here, we sought to investigate the current status of oral anticoagulant use in patients with AFAIS in northwestern China. METHODS: We reviewed medical records of consecutive patients with AFAIS discharged from 14 hospitals in northwestern China between January 2012 and May 2015. RESULTS: A total of 1014 cases were included in this study. The mean age of the patients was 70.3 ± 10.8 years. Fifty-four percent were female. Among all participants, only 20.0% received anticoagulants (19.4% warfarin and .6% nonvitamin K antagonist oral anticoagulants), whereas 57.5% took antiplatelet drugs and 22.5% received neither anticoagulant nor antiplatelet treatment. Anticoagulant use decreased with increasing age and CHA2DS2-VASc scores. The proportions of anticoagulant use at discharge in patients younger than 65 years, 65-74 years, and 75 years or older were 28.5%, 20.7%, and 13.9%, respectively. Nonvalvular atrial fibrillation patients with CHA2DS2-VASc scores of 2, 3, 4, 5, 6, and 7 had anticoagulant use rates at discharge of 19.2%, 24.8%, 20.3%, 13.7%, 8.1%, and 8.0%, respectively. CONCLUSIONS: In northwestern China, oral anticoagulants are substantially underutilized in patients with AFAIS, especially in patients at higher risk of stroke, suggesting a large treatment gap in the secondary prevention management in patients with AFAIS.


Asunto(s)
Anticoagulantes/administración & dosificación , Fibrilación Atrial/complicaciones , Fibrilación Atrial/tratamiento farmacológico , Accidente Cerebrovascular/complicaciones , Accidente Cerebrovascular/prevención & control , Administración Oral , Factores de Edad , Anciano , Anciano de 80 o más Años , Isquemia Encefálica/complicaciones , China/epidemiología , Femenino , Encuestas Epidemiológicas , Humanos , Masculino , Persona de Mediana Edad , Estudios Retrospectivos , Prevención Secundaria , Estadísticas no Paramétricas , Accidente Cerebrovascular/etiología
7.
Molecules ; 22(2)2017 Feb 01.
Artículo en Inglés | MEDLINE | ID: mdl-28157159

RESUMEN

In this study, magnetic graphene oxide (MGO) nanomaterials were synthesized based on covalent binding of amino Fe3O4 nanoparticles onto the graphene oxide (GO), and the prepared MGO was successfully applied as support for the immobilization of laccase. The MGO-laccase was characterized by transmission electron microscopy (TEM) and a vibrating sample magnetometer (VSM). Compared with free laccase, the MGO-laccase exhibited better pH and thermal stabilities. The optimum pH and temperature were confirmed as pH 3.0 and 35 °C. Moreover, the MGO-laccase exhibited sufficient magnetic response and satisfied reusability after being retained by magnetic separation. The MGO-laccase maintained 59.8% activity after ten uses. MGO-laccase were finally utilized in the decolorization of dye solutions and the decolorization rate of crystal violet (CV), malachite green (MG), and brilliant green (BG) reached 94.7% of CV, 95.6% of MG, and 91.4% of BG respectively. The experimental results indicated the MGO-laccase nanomaterials had a good catalysis ability to decolorize dyes in aqueous solution. Compared with the free enzyme, the employment of MGO as enzyme immobilization support could efficiently enhance the availability and facilitate the application of laccase.


Asunto(s)
Colorantes/química , Enzimas Inmovilizadas , Grafito/química , Lacasa/química , Nanopartículas de Magnetita/química , Óxidos/química , Adsorción , Catálisis , Activación Enzimática , Concentración de Iones de Hidrógeno , Nanopartículas de Magnetita/ultraestructura , Temperatura
8.
Molecules ; 21(11)2016 Nov 05.
Artículo en Inglés | MEDLINE | ID: mdl-27827956

RESUMEN

Radix astragali is widely used either as a single herb or as a collection of herbs in a complex prescription in China. In this study, bovine serum albumin functionalized magnetic nanoparticles (BSA-MN) coupled with high performance liquid chromatography-mass spectrometry (HPLC-MS) were used to screen and identify bound ligands from the n-butanol part of a Radix astragali extract. The prepared BSA-MN showed sufficient magnetic response for the separation with an ordinary magnet and satisfied reusability. Fundamental parameters affecting the preparation of BSA-MN and the screening efficiency were studied and optimized. Under the optimum conditions, four bound ligands were screened out from the n-butanol part of a Radix astragali extract and identified as genistin (1), calycosin-7-O-ß-d-glucoside (2), ononin (3) and formononetin (4). This effective method could be widely applied for rapid screening and identification of active compounds from complex mixtures without the need for preparative isolation.


Asunto(s)
Medicamentos Herbarios Chinos/química , Medicamentos Herbarios Chinos/aislamiento & purificación , Nanopartículas de Magnetita/química , 1-Butanol/química , 1-Butanol/aislamiento & purificación , Astragalus propinquus , Cromatografía Líquida de Alta Presión , Glucósidos/química , Glucósidos/aislamiento & purificación , Isoflavonas/química , Isoflavonas/aislamiento & purificación , Ligandos , Espectrometría de Masas , Albúmina Sérica Bovina/química
9.
Int J Biol Macromol ; 269(Pt 2): 132103, 2024 Jun.
Artículo en Inglés | MEDLINE | ID: mdl-38719011

RESUMEN

Rhodotorula spp. has been studied as one powerful source for a novel cell factory with fast growth and its high added-value biomolecules. However, its inadequate genome and genomic annotation have hindered its widespread use in cosmetics and food industries. Rhodotorula glutinis QYH-2023, was isolated from rice rhizosphere soil, and the highest quality of the genome of the strain was obtained at chromosome level (18 chromosomes) than ever before in red yeast in this study. Comparative genomics analysis revealed that there are more key gene copies of carotenoids biosynthesis in R. glutinis QYH-2023 than other species of Rhodotorula spp. Integrated transcriptome and metabolome analysis revealed that lipids and carotenoids biosynthesis was significantly enriched during fermentation. Subsequent investigation revealed that the over-expression of the strain three genes related to carotenoids biosynthesis in Komagataella phaffii significantly promoted the carotenoid production. Furthermore, in vitro tests initially confirmed that the longer the fermentation period, the synthesized metabolites controlled by R. glutinis QYH-2023 genome had the stronger anti-inflammatory properties. All of the findings revealed a high-quality reference genome which highlight the potential of R. glutinis strains to be employed as chassis cells for biosynthesizing carotenoids and other active chemicals.


Asunto(s)
Carotenoides , Genoma Fúngico , Rhodotorula , Carotenoides/metabolismo , Rhodotorula/genética , Rhodotorula/metabolismo , Antiinflamatorios/farmacología , Fermentación , Cromosomas Fúngicos/genética , Genómica/métodos , Transcriptoma
10.
ACS Nano ; 17(21): 21662-21677, 2023 11 14.
Artículo en Inglés | MEDLINE | ID: mdl-37906569

RESUMEN

Natural plant nanocrystalline cellulose (NCC), exhibiting a number of exceptional performance characteristics, is widely used in food fields. However, little is known about the relationship between NCC and the antiviral effect in animals. Here, we tested the function of NCC in antiviral methods utilizing honey bees as the model organism employing Israeli acute paralysis virus (IAPV), a typical RNA virus of honey bees. In both the lab and the field, we fed the IAPV-infected bees various doses of jute NCC (JNCC) under carefully controlled conditions. We found that JNCC can reduce IAPV proliferation and improve gut health. The metagenome profiling suggested that IAPV infection significantly decreased the abundance of gut core bacteria, while JNCC therapy considerably increased the abundance of the gut core bacteria Snodgrassella alvi and Lactobacillus Firm-4. Subsequent metabolome analysis further revealed that JNCC promoted the biosynthesis of fatty acids and unsaturated fatty acids, accelerated the purine metabolism, and then increased the expression of antimicrobial peptides (AMPs) and the genes involved in the Wnt and apoptosis signaling pathways against IAPV infection. Our results highlighted that JNCC could be considered as a prospective candidate agent against a viral infection.


Asunto(s)
Corchorus , Dicistroviridae , Microbioma Gastrointestinal , Abejas , Animales , Celulosa/farmacología , Corchorus/genética , Antivirales/farmacología
11.
Nanoscale Adv ; 5(23): 6435-6448, 2023 Nov 21.
Artículo en Inglés | MEDLINE | ID: mdl-38024324

RESUMEN

Antibiotics can cure diseases caused by bacterial infections, but their widespread use can have some side effects, such as probiotic reduction. There is an urgent need for such agents that can not only alleviate the damage caused by antibiotics, but also maintain the balance of the gut microbiota. In this study, we first characterized the nanocrystalline cellulose (NCC) extracted from plant jute (Corchorus olitorius L.) leaves. Next, we evaluated the protective effect of jute NCC and cellulose on human model gut bacteria (Lacticaseibacillus rhamnosus and Escherichia coli) under antibiotic stress by measuring bacterial growth and colony forming units. We found that NCC is more effective than cellulose in adsorbing antibiotics and defending the gut bacteria E. coli. Interestingly, the low-dose jute NCC clearly maintained the balance of key gut bacteria like Snodgrassella alvi and Lactobacillus Firm-4 in bees treated with tetracycline and reduced the toxicity caused by antibiotics. It also showed a more significant protective effect on human gut bacteria, especially L. rhamnosus, than cellulose. This study first demonstrated that low-dose NCC performed satisfactorily as a specific probiotic to mitigate the adverse effects of antibiotics on gut bacteria.

12.
Front Cell Neurosci ; 17: 1279032, 2023.
Artículo en Inglés | MEDLINE | ID: mdl-38259503

RESUMEN

The theory of engrams, proposed several years ago, is highly crucial to understanding the progress of memory. Although it significantly contributes to identifying new treatments for cognitive disorders, it is limited by a lack of technology. Several scientists have attempted to validate this theory but failed. With the increasing availability of activity-dependent tools, several researchers have found traces of engram cells. Activity-dependent tools are based on the mechanisms underlying neuronal activity and use a combination of emerging molecular biological and genetic technology. Scientists have used these tools to tag and manipulate engram neurons and identified numerous internal connections between engram neurons and memory. In this review, we provide the background, principles, and selected examples of applications of existing activity-dependent tools. Using a combination of traditional definitions and concepts of engram cells, we discuss the applications and limitations of these tools and propose certain developmental directions to further explore the functions of engram cells.

13.
Front Plant Sci ; 13: 890052, 2022.
Artículo en Inglés | MEDLINE | ID: mdl-35498719

RESUMEN

GRAS transcription factors play crucial roles in plant growth and development and have been widely explored in many plant species. Garlic (Allium sativum L.) is an important crop owing to its edible and medicinal properties. However, no GRAS transcription factors have been identified in this crop. In this study, 46 garlic GRAS genes were identified and assigned to 16 subfamilies using the GRAS members of Arabidopsis thaliana, Oryza sativa, and Amborella trichopoda as reference queries. Expression analysis revealed that garlic GRAS genes showed distinct differences in various garlic tissues, as well as during different growth stages of the bulbs. Five of these 46 genes were identified as DELLA-like protein-encoding genes and three of which, Asa2G00237.1/Asa2G00240.1 and Asa4G02090.1, responded to exogenous GA3 treatment, and showed a significant association between their transcription abundance and bulb traits in 102 garlic accessions, thereby indicating their role in regulating the growth of garlic bulbs. These results will lay a useful foundation for further investigation of the biological functions of GRAS genes and guiding the genetic breeding of garlic in the future.

14.
Front Plant Sci ; 13: 969820, 2022.
Artículo en Inglés | MEDLINE | ID: mdl-36267946

RESUMEN

Ramie (Boehmeria nivea L.) is a perennial plant with vigorously vegetative growth and high nutritive value that is an excellent source of green feed in China. Crude protein and fiber content are the most important traits associated with ramie forage quality; however, their genetic basis remains largely unknown. In this study, we investigated the genetic architecture of these two traits using an F2 population derived from cultivated Zhongsizhu 1 (ZSZ1) and wild Boehmeria nivea var. tenacissima (tenacissima). Linkage mapping identified eight quantitative trait loci (QTLs) in crude fiber and one QTL in crude protein. Of these, five were further validated by association analysis. Then, two major QTLs for crude fiber content, CF7 and CF13, were further identified using bulked segregant analysis (BSA) sequencing, and their exact physical intervals were determined via genotype analysis of F2 progenies with extremely low crude fiber content. In total, 10 genes in the CF7 and CF13 regions showed differential expression in ZSZ1 and tenacissima leaves, including an MYB gene whole_GLEAN_10016511 from the CF13 region. Wide variation was observed in the promoter regions of whole_GLEAN_10016511, likely responsible for its downregulated expression in tenacissima. Interestingly, more fiber cells were observed in Arabidopsis with overexpression of whole_GLEAN_10016511, indicating that the downregulated expression of this gene could have an association with the relatively low fiber content in wild tenacissima. These results provided evidence that whole_GLEAN_10016511 is a logical candidate for CF13. This study provides important insights into the genetic basis underlying ramie crude protein and fiber content, and it presents genetic loci for improving the forage quality of ramie using marker-assisted selection.

15.
Genome Biol ; 23(1): 188, 2022 09 07.
Artículo en Inglés | MEDLINE | ID: mdl-36071507

RESUMEN

BACKGROUND: Garlic is an entirely sterile crop with important value as a vegetable, condiment, and medicine. However, the evolutionary history of garlic remains largely unknown. RESULTS: Here we report a comprehensive map of garlic genomic variation, consisting of amazingly 129.4 million variations. Evolutionary analysis indicates that the garlic population diverged at least 100,000 years ago, and the two groups cultivated in China were domesticated from two independent routes. Consequently, 15.0 and 17.5% of genes underwent an expression change in two cultivated groups, causing a reshaping of their transcriptomic architecture. Furthermore, we find independent domestication leads to few overlaps of deleterious substitutions in these two groups due to separate accumulation and selection-based removal. By analysis of selective sweeps, genome-wide trait associations and associated transcriptomic analysis, we uncover differential selections for the bulb traits in these two garlic groups during their domestication. CONCLUSIONS: This study provides valuable resources for garlic genomics-based breeding, and comprehensive insights into the evolutionary history of this clonal-propagated crop.


Asunto(s)
Ajo , Ajo/genética , Genoma de Planta , Genómica , Fitomejoramiento , Polimorfismo de Nucleótido Simple
16.
EClinicalMedicine ; 53: 101666, 2022 Nov.
Artículo en Inglés | MEDLINE | ID: mdl-36177443

RESUMEN

Background: Glibenclamide is a promising agent for treating brain oedema, but whether it improves clinical outcomes in patients with intracerebral haemorrhage (ICH) remains unclear. In this study, we aimed to explore the efficacy and safety of glibenclamide treatment in patients with acute ICH. Methods: The Glibenclamide Advantage in Treating Oedema after Intracerebral Haemorrhage (GATE-ICH) study was a randomised controlled phase 2 clinical trial conducted in 26 hospitals in the northwest of China, recruiting patients with acute ganglia ICH no more than 72 h after onset from Dec 12, 2018 to Sept 23, 2020. During the first 7 days after enrolment, patients randomly assigned to the glibenclamide group were given glibenclamide orally (1.25 mg, 3/day) and standard care, while patients randomly assigned to the control group were given standard care alone. The computer-generated randomisation sequence was prepared by a statistician not involved in the rest of the study. Randomisation was computer-generated with a block size of four. The allocation results were unblinded to participants and investigators. The primary outcome was the percentage of patients with poor outcome (defined as modified Rankin Scale [mRS] score of ≥3) at day 90. The trial was registered at ClinicalTrials.gov (NCT03741530). Findings: 220 participants were randomised and 200 participants (mean [standard deviation] age, 56 [11] years; sex, 128 [64.0%] male and 72 [36.0%] female) were included in the final analysis, with 101 participants randomly assigned to the control group and 99 to the glibenclamide group. The incidence of poor outcome at day 90 was 20/99 (20.2%) in glibenclamide group and 30/101 (29.7%) in control group (absolute difference, 9.5%; 95% confidence interval [CI], -3.2%-21.8%; P = 0.121) with adjusted odds ratios of 0.54 (95% CI, 0.24-1.20; P = 0.129). No significant difference was found in the overall rates of adverse events or serious adverse events between groups. However, the incidence of asymptomatic hypoglycaemia was significantly higher in glibenclamide group than control group (15/99 [15.2%] vs 0/101 [0.0%]; absolute difference, 15.2%; 95% CI, 7.5%-24.1%; P < 0.001). Interpretation: Our study provides no evidence that glibenclamide (1.25 mg, 3/day) significantly reduces the proportion of poor outcome at day 90 after ICH. In addition, glibenclamide could result in higher incidence of hypoglycaemia. Larger trials of glibenclamide with optimised medication regimen are warranted. Funding: Shaanxi Province Key Research and Development Project (2017DCXL-SF-02-02) and Shaanxi Province Special Support Program for Leading Talents in Scientific and Technological Innovation (tzjhjw).

17.
Front Neurol ; 12: 656520, 2021.
Artículo en Inglés | MEDLINE | ID: mdl-33986719

RESUMEN

Introduction: Brain edema after acute intracerebral hemorrhage (ICH) plays a critical role in the secondary injury of ICH and may heighten the potential for a poor outcome. This trial aims to explore the efficacy of small doses of oral glibenclamide in perihematomal edema (PHE) and the prognosis of patients with ICH. Methods and Analysis: The GATE-ICH trial is a multicenter randomized, controlled, assessor-blinded trial. A total of 220 adult patients with acute primary ICH in 28 study centers in China will be randomized to the glibenclamide group (glibenclamide plus guideline-recommended ICH management) or the control group (guideline-recommended ICH management). Multivariate logistic regression will be used to analyze the relationship between the treatments and primary outcome. Study Outcomes: The primary efficacy outcome is the proportion of poor functional outcomes (modified Rankin Scale ≥3) at 90 days after enrollment. The secondary efficacy outcomes include changes in the volume of ICH and PHE between the baseline and follow-up computed tomography scans as well as the clinical scores between the baseline and follow-up assessments. Discussion: The GATE-ICH trial will assess the effects of small doses of oral glibenclamide in reducing the PHE after ICH and improving the 90-day prognosis of patients. Clinical Trial Registration: www.clinicaltrials.gov., NCT03741530. Registered on November 8, 2018. Trial Status: Protocol version: May 6, 2019, Version 5. Recruitment and follow-up of patients is currently ongoing. This trial will be end in the second quarter of 2021.

18.
3 Biotech ; 10(4): 158, 2020 Apr.
Artículo en Inglés | MEDLINE | ID: mdl-32181120

RESUMEN

A bacterial strain named XHY-12 was isolated from corn soil samples and identified as Burkholderia sp. based on 16S rDNA sequencing, it displayed high antagonistic activity against 12 fungal pathogens and the common fungal contaminant in grain Aspergillus flavus. Plate experiment showed that XHY-12 fermentation broth reduced the incidence of S. sclerotiorum on detached rape leaves (Brassica campestris L.) by 100%, and a greenhouse experiment showed that it could promote the growth of rape seedlings with significant increases in plant height, root length, and fresh weight. Furthermore, a novel funding was the reduction of aflatoxin B1 and B2 by over 85% in 60 h, and the decomposition enzymes should be extracellular. The results suggest that XHY-12 has a potential for commercial applications as biocontrol, mycotoxin detoxification agent or biofertilizer.

19.
Sleep Med ; 69: 204-212, 2020 05.
Artículo en Inglés | MEDLINE | ID: mdl-32143064

RESUMEN

OBJECTIVE: To investigate the potential prognostic value of sleep electroencephalography (EEG) pattern and serum circadian rhythm biomarkers in the recovery of consciousness in patients at the acute stage of coma. METHODS: A prospective observational study which included 75 patients with coma was conducted. Twenty-four-hour continuous polysomnography (PSG) was performed to determine the sleep EEG pattern according to the modified Valente's Grade (mVG) that we proposed. Serum levels of melatonin and orexin-A at four consecutive time points during the PSG were examined. Patients were then followed for one month to determine their level of consciousness. Multivariate logistic regression analysis was performed to examine associations between demographics, aetiology, baseline clinical features (pupillary and corneal reflex, and neuron-specific enolase [NSE]), clinical scores (Glasgow Coma Scale-Motor Response [GCS-M], Full Outline of Unresponsiveness [FOUR] scale, Acute Physiology and Chronic Health Evaluation II [APACHE II] scale), mVG, serum circadian biomarkers, and recovery of consciousness within one month. RESULTS: Within one month of enrolment, 34 patients regained consciousness and 36 patients remained non-conscious. Spearman rank correlation revealed a significant association between mVG and state of consciousness after one month. Significant variation in serum melatonin or orexin-A was not detected in either the conscious or non-conscious groups. Hypoxic aetiology, APACHE II, and mVG were independently associated with recovery of consciousness within one month. CONCLUSION: Sleep EEG structure, hypoxic aetiology, and APACHE II can independently predict recovery of consciousness in patients with acute coma. Taken together, we encourage neurologists to use sleep elements to assess patients with acute coma.


Asunto(s)
Biomarcadores/sangre , Ritmo Circadiano/fisiología , Coma/complicaciones , Estado de Conciencia/fisiología , Electroencefalografía , Pronóstico , Femenino , Escala de Coma de Glasgow , Humanos , Masculino , Persona de Mediana Edad , Polisomnografía , Estudios Prospectivos , Sueño/fisiología
20.
CNS Neurosci Ther ; 26(1): 21-29, 2020 01.
Artículo en Inglés | MEDLINE | ID: mdl-30968580

RESUMEN

AIMS: To develop and validate a novel score for prediction of 3-month functional outcome in neurocritically ill patients. METHODS: The development of the novel score was based on two widely used scores for general critical illnesses (Acute Physiology and Chronic Health Evaluation II, APACHE II; Simplified Acute Physiology Score II, SAPS II) and consideration of the characteristics of neurocritical illness. Data from consecutive patients admitted to neurological ICU (N-ICU) between January 2013 and June 2016 were used for the validation. The modified Rankin Scale (mRS) was used to evaluate 3-month functional outcomes. APACHE II scores, SAPS II scores, and our novel scores at 24 hours and 72 hours in N-ICU were obtained. We compared the prognostic performance of our score with APACHE II and SAPS II. RESULTS: We developed a 44-point scoring system named the INCNS score, and it includes 19 items which were categorized into five parts: inflammation (I), nutrition (N), consciousness (C), neurological function (N), and systemic function (S). We validated the INCNS score with a cohort of 941 N-ICU patients. The 72-hours INCNS score achieved an area under the receiver operating characteristic curve (AUC) of 0.828 (95% CI: 0.802-0.854), and the 24-hours INCNS score achieved an AUC of 0.788 (95% CI: 0.759-0.817). The INCNS score exhibited significantly better discriminative and prognostic performance than APACHE II and SAPS II at both 24 hours and 72 hours in N-ICU. CONCLUSION: We developed an INCNS score with superior predictive power for functional outcome of neurocritically ill patients.


Asunto(s)
Enfermedad Crítica , Enfermedades del Sistema Nervioso/terapia , APACHE , Adulto , Anciano , Anciano de 80 o más Años , Área Bajo la Curva , Estado de Conciencia , Cuidados Críticos , Femenino , Humanos , Inflamación/patología , Masculino , Persona de Mediana Edad , Estado Nutricional , Pronóstico , Recuperación de la Función , Reproducibilidad de los Resultados , Puntuación Fisiológica Simplificada Aguda , Resultado del Tratamiento
SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA