N-Heterocyclic Carbene-Derived 1,3,5-Trimethylenebenzene: On-Surface Synthesis and Electronic Structure.

1,3,5-Trimethylenebenzene (1,3,5-TMB), a 3-fold-symmetric triradical with a high-spin ground state, is an attractive platform for investigating the unique spin properties of π-conjugated triangular triradicals. Here, we report the on-surface synthesis of N-heterocyclic carbene (NHC)-derived 1,3,5-TMB (N-TMB) via surface-assisted C-C and C-N coupling reactions on Au(111). The chemical and electronic structures of N-TMB on the Au(111) surface are revealed with atomic precision using scanning tunneling microscopy and noncontact atomic force microscopy, combined with density functional theory (DFT) calculations. It is demonstrated that there is substantial charge transfer between N-TMB and the substrate, resulting in a positively charged N-TMB on Au(111). DFT calculations at the UB3LYP/def2-TZVP level of theory and multireference method, e.g., CASSCF/NEVPT2, indicate that N-TMB possesses a doublet ground state with reduced Cs symmetry in the gas phase, contrasting the quartet ground state of 1,3,5-TMB with D3h symmetry, and exhibits a doublet-quartet energy gap of -0.80 eV. The incorporation of NHC structures and the extended π-conjugation promote the spin-orbital overlaps in N-TMB, leading to Jahn-Teller distortion and the formation of a robust doublet state. Our results not only demonstrate the fabrication of polyradicals based on NHC but also shed light on the effect of NHC and π-conjugation on the electronic structure and spin coupling, which opens up new possibilities for precisely regulating the spin-spin exchange coupling of organic polyradicals.

Silver Surface-Assisted Dehydrobrominative Cross-Coupling between Identical Aryl Bromides.

Cross-coupling reactions represent an indispensable tool in chemical synthesis. An intriguing challenge in this field is to achieve selective cross-coupling between two precursors with similar reactivity or, to the limit, the identical molecules. Here we report an unexpected dehydrobrominative cross-coupling between 1,3,5-tris(2-bromophenyl)benzene molecules on silver surfaces. Using scanning tunneling microscopy, we examine the reaction process at the single-molecular level, quantify the selectivity of the dehydrobrominative cross-coupling, and reveal the modulation of selectivity by substrate lattice-related catalytic activity or molecular assembly effect. Theoretical calculations indicate that the dehydrobrominative cross-coupling proceeds via regioselective C-H bond activation of debrominated TBPB and subsequent highly selective C-C coupling of the radical-based intermediates. The reaction kinetics plays an important role in the selectivity for the cross-coupling. This work not only expands the toolbox for chemical synthesis but also provides important mechanistic insights into the selectivity of coupling reactions on the surface.

Bt maize can provide non-chemical pest control and enhance food safety in China.

China is the world's second-largest maize producer and consumer. In recent years, the invasive fall armyworm Spodoptera frugiperda (J.E. Smith) has adversely affected maize productivity and compromised food security. To mitigate pest-inflicted food shortages, China's Government issued biosafety certificates for two genetically modified (GM) Bt maize hybrids, Bt-Cry1Ab DBN9936 and Bt-Cry1Ab/Cry2Aj Ruifeng 125, in 2019. Here, we quantitatively assess the impact of both Bt maize hybrids on pest feeding damage, crop yield and food safety throughout China's maize belt. Without a need to resort to synthetic insecticides, Bt maize could mitigate lepidopteran pest pressure by 61.9-97.3%, avoid yield loss by 16.4-21.3% (range -11.9-99.2%) and lower mycotoxin contamination by 85.5-95.5% as compared to the prevailing non-Bt hybrids. Yield loss avoidance varied considerably between experimental sites and years, as mediated by on-site infestation pressure and pest identity. For either seed mixtures or block refuge arrangements, pest pressure was kept below established thresholds at 90% Bt maize coverage in Yunnan (where S. frugiperda was the dominant species) and 70% Bt maize coverage in other sites dominated by Helicoverpa armigera (Hübner) and Ostrinia furnacalis (Guenée). Drawing on experiences from other crop/pest systems, Bt maize in se can provide area-wide pest management and thus, contribute to a progressive phase-down of chemical pesticide use. Hence, when consciously paired with agroecological and biodiversity-based measures, GM insecticidal crops can ensure food and nutrition security, contribute to the sustainable intensification of China's agriculture and reduce food systems' environmental footprint.

Sterility of Cydia pomonella by X ray irradiation as an alternative to gamma radiation for the sterile insect technique.

The codling moth Cydia pomonella is a major pest of global significance impacting pome fruits and walnuts. It threatens the apple industry in the Loess Plateau and Bohai Bay in China. Sterile insect technique (SIT) could overcome the limitations set by environmentally compatible area-wide integrated pest management (AW-IPM) approaches such as mating disruption and attract-kill that are difficult to suppress in a high-density pest population, as well as the development of insecticide resistance. In this study, we investigated the effects of X-ray irradiation (183, 366, 549 Gy) on the fecundity and fertility of a laboratory strain of C. pomonella, using a newly developed irradiator, to evaluate the possibility of X-rays as a replacement for Cobalt60 (60Co-γ) and the expanded future role of this approach in codling moth control. Results show that the 8th-day is the optimal age for irradiation of male pupae. The fecundity decreased significantly as the dosage of radiation increased. The mating ratio and mating number were not influenced. However, treated females were sub-sterile at a radiation dose of 183 Gy (20.93%), and were almost 100% sterile at a radiation dose of 366 Gy or higher. Although exposure to a radiation dose of 366 Gy resulted in a significant reduction in the mating competitiveness of male moths, our radiation biology results suggest that this new generation of X-ray irradiator has potential applications in SIT programs for future codling moth control.

Exposure to lambda-cyhalothrin and abamectin drives sublethal and transgenerational effects on the development and reproduction of Cydia pomonella.

The codling moth Cydia pomonella (Lepidoptera: Tortricidae) is a major invasive pest of pome fruits and walnuts worldwide. Lambda-cyhalothrin (LCT) and abamectin (AM) have been frequently used in C. pomonella control, but control of this pest is very difficult because shortly after hatching, larvae of this insect bore tunnels and hide inside host plant fruit. In this study, a simulated field spray bioassay method was developed against neonate larvae of C. pomonella and concentration-response bioassays were conducted to evaluate the susceptibility of the neonate larvae to LCT and AM. Exposure of neonate larvae to sublethal concentration (LC30) of LCT or AM significantly reduced the survival rate of larvae (4th and 5th instars), lowered the mean weight of larvae and pupae, and decreased the daily maximal number of eggs laid and the total number of eggs laid (fecundity) per female. The sublethal effects, including reduced body mass, mean fecundity and net reproductive rate, extended mean generation time, and shortened oviposition period, were also found in transgenerational offspring. Furthermore, the transgenerational maternal effects were more obvious for AM than LCT, in comparison to the control. Additionally, the estimated population size was decreased by exposure to LC30 of LCT and AM, and the observed reduction of fecundity and population size within and across generations was likely the result of the downregulation of the reproduction-related vitellogenin gene (CpVg) after exposure to LC30 of LCT and AM. These results provide a better understanding of the overall effects of LCT and AM on C. pomonella and the transgenerational effects which should be taken into consideration when using insecticides in order to control C. pomonella.

First report of tomato brown rugose fruit virus infecting Solanum lycopersicum in Northeast China.

Tomato (Solanum lycopersicum L.) is an important fruit and vegetable crop with high economic value due to its rich vitamins (Friedman. 2002). Over the past five years, due to tomato brown rugose fruit virus (ToBRFV) infection, the tomato production in many countries and regions in Asia, America and Europe have experienced declines in yield and quality (Salem et al. 2023). ToBRFV is a positive-sense single-stranded RNA virus of the genus Tobamovirus in the family Virgaviridae (Salem et al. 2016). In the field, ToBRFV mainly infects solanaceous crops, including tomato and pepper (Zhang et al. 2022). Symptoms on ToBRFV-infected tomato plants mainly include foliar mottle, vein necrosis, and brown mottled rugose fruit (Alfaro-Fernández et al. 2020, Hamborg et al. 2022, Ma et al. 2021). In April 2023, about 150 tomato plants showing leaf curl, brown patch, and rugose surface on fruits were found in a greenhouse grown with about 500 tomato plants in Huludao City, Liaoning province, China. Two leaves and eight fruits from each of 10 symptomatic tomato plants were sampled and subjected to dot enzyme-linked immunosorbent assay (Dot-ELISA) with an antibody against ToBRFV (LV BAO, Chengdu, China); and all samples tested positive. Sap inoculations were prepared from 0.1 g of ToBRFV-positive tomato leaves via homogenization with 0.01 mol·L-1 PBS (phosphate buffered saline, pH 7.2), which were then inoculated mechanically onto 10 tomato cv. Moneymaker and 10 Nicotiana benthamiana plants at four- to six-leaf stage, respectively. At 10 days post inoculation (dpi), the leaf curl symptoms of all tomato plants were shown, which were consistent with those on greenhouse-infected plants. At 5 dpi, the upper leaves of all N. benthamiana plants showed yellowing and curling symptoms. The results of Dot-ELISA assays revealed that these mechanically inoculated plants were positive for ToBRFV. Total RNAs of inoculated and greenhouse-collected samples were extracted using TRIzolTM reagent and analyzed by reverse-transcription (RT)-PCR with specific primers ToBRFV-FD (5' GTCCCGATGTCTGTAAGGCTTGC) and ToBRFV-RD (5' GCAGGTGCAGAGGACCATTGTAA) for ToBRFV detection, respectively. The results showed that a 680-bp fragment was obtained in all tested samples. Then, primers ToBRFV-F1 (5' GTGTATTTTTTACAACATATACC) and ToBRFV-R1 (5' AACCATTGACTCAGAACTC), ToBRFV-F2 (5' TAGCCAAGAATCACGCATG) and ToBRFV-R2 (5' AGCAGCAATAATCACCGTA), ToBRFV-F3 (GAAAGAGTGGGGACGTTACAACATTCATCGGTAAT) and ToBRFV-R3 (TGGGCCCCTACCGGGGGTTCCGGGGGAATTCGAAT) were used to amplify the full-length sequence of ToBRFV using field-collected samples. The methods of primer design are shown in supplemental file 1. The sequence obtained by Sanger sequencing showed 99.86% nucleotide (nt) identity with ToBRFV-SD isolate (accession no. MT018320.1) from Shandong province, China. The full-length sequence of ToBRFV was uploaded to GenBank database with the accession number OR437354. To our knowledge, this is the first report of ToBRFV infecting tomato in Northeast China.

Unique Catalytic Mechanism for Ru-Loaded Ternary Intermetallic Electrides for Ammonia Synthesis.

Intermetallic electrides have recently shown their priority as catalyst components in ammonia synthesis and CO2 activation. However, their function mechanism has been elusive since its inception, which hinders the further development of such catalysts. In this work, ternary intermetallic electrides La-TM-Si (TM = Co, Fe, and Mn) were synthesized as hosts of ruthenium (Ru) particles for ammonia synthesis catalysis. Although they have the same crystal structure and possess low work functions commonly, the promotion effects on Ru particles rather differ from each other. The catalytic activity follows the sequence of Ru/LaCoSi > Ru/LaFeSi > Ru/LaMnSi. Furthermore, Ru/LaCoSi exhibits much better catalytic durability than the other two. A combination of experiments and first-principles calculations shows that apparent N2 activation energy on each catalyst is much lower than that over conventional Ru-based catalysts, which suggests that N2 dissociation can be conspicuously promoted by the concerted actions of the specific electronic structure and atomic configuration of intermetallic electride-supported catalysts. The NHx formations proceeded on La are energetically favored, which makes it possible to bypass the scaling relations based on only Ru as the active site. The rate-determining step of Ru/La-TM-Si was identified to be NH2 formation. The transition metal (TM) in La-TM-Si electrides has a significant influence on the metal-support interaction of Ru and La-TM-Si. These findings provide a guide for the development of new and effective catalyst hosts for ammonia synthesis and other hydrogenation reactions.

Long non-coding RNA MALAT1 silencing elevates microRNA-26a-5p to ameliorate myocardial injury in sepsis by reducing regulator of calcineurin 2.

OBJECTIVE: Sepsis is a leading cause of morbidity and mortality after surgery. We aimed to explore the role of long non-coding RNA (lncRNA) metastasis-associated lung adenocarcinoma transcript 1 (MALAT1) sponging microRNA-26a-5p in sepsis-induced myocardial injury by regulating regulator of calcineurin 2 (Rcan2). METHODS: HL-1 cells were incubated with lipopolysaccharide (LPS) to induce in vitro cardiomyocyte injury models, which were then treated with silenced MALAT1 vector, miR-26a-5p mimic or Rcan2 overexpression vector. Next, inflammatory factor level and apoptosis of cells were determined. The in vivo mouse models were constructed by intraperitoneal injection of LPS. The modeled mice were injected with relative oligonucleotides and the pathology, apoptosis, and inflammation in mouse myocardial tissues were assessed. Expression of MALAT1, miR-26a-5p and Rcan2 in vivo and in vitro was evaluated. RESULTS: MALAT1 and Rcan2 were upregulated while miR-26a-5p was downregulated in LPS-treated HL-1 cells and mice. MALAT1 silencing or miR-26a-5p upregulation suppressed LPS-induced inflammation and apoptosis of cardiomyocytes in cellular and animal models. These effects of elevated miR-26a-5p could be reversed by upregulating Rcan2, and MALAT1 knockdown-induced ameliorative impacts could be reversed by miR-26a-5p downregulation. CONCLUSION: MALAT1 silencing elevated miR-26a-5p to ameliorate LPS-induced myocardial injury by reducing Rcan2. Our research may provide novel biomarkers for the treatment of sepsis.

Genome-wide identification, characterization, and expression profiling of ATP-binding cassette (ABC) transporter genes potentially associated with abamectin detoxification in Cydia pomonella.

The codling moth Cydia pomonella L. (Lepidoptera: Tortricidae) is one of the most notorious pests of pome fruits and walnuts worldwide, which has developed resistance to almost all classes of insecticides, including abamectin (ABM). ATP-binding cassette (ABC) transporters are thought to play a vital roles in insecticide detoxification by reducing the toxic concentrations of insecticides in an organism tissues. Despite the tremendous progress in understanding the detoxification mechanisms at the molecular level, the physiological functions of ABC transporters in insects have been poorly investigated. In this study, we found that the ABC inhibitor verapamil synergized significantly the toxicity of ABM, suggesting a potential role of ABC in detoxification. A total of 54 ABC genes were identified in the third-instar larvae of C. pomonella after treatment with sublethal doses (LD10 and LD30) of ABM. The expression profile of these genes in ABM-treated larvae at different time points (24, 48, 72 hr) using transcriptomic analysis (RNA-seq) was also investigated. The results showed that the expression of about 30 ABC genes was significantly co-upregulated after treatment. Several specific genes were up-regulated at 48 hr after treatment of larvae with LD10 ABM. Among these up-regulated genes, we found that the relative expression level of the CPOM19553 was 29.7-fold and 16.0-fold higher when larvae were exposed to ABM at the LD10 and LD30 doses compared to control, respectively. Unlike other ABC genes, only CPOM08323 exhibited significant expression levels in the head and cuticle of the third-instar larvae of C. pomonella exposed to the two sublethal doses of ABM, with no expression was observed in the detoxification tissues such as midgut and Malpighian tubule. This study suggests that these up-regulated genes may be involved in ABM resistance in C. pomonella. Our findings will provide an additional information required for further analysis of ABC transporter genes associated with xenobiotic metabolism in C. pomonella.

Site-Selective Deposition of Metal-Organic Frameworks on Gold Nanobipyramids for Surface-Enhanced Raman Scattering.

Site-selective deposition of metal-organic frameworks (MOFs) on metal nanocrystals has remained challenging because of the difficult control of the nucleation and growth of MOFs. Herein we report on a facile wet-chemistry approach for the selective deposition of zeolitic imidazolate framework-8 (ZIF-8) on anisotropic Au nanobipyramids (NBPs) and nanorods. ZIF-8 is selectively deposited at the ends and waist and around the entire surface of the elongated Au nanocrystals. The NBP-based nanostructures with end-deposited ZIF-8 exhibit the best surface-enhanced Raman scattering (SERS) performance, implying that molecules can be concentrated by ZIF-8 at the hot spots. In addition, the SERS signal exhibits good selectivity for small molecules because of the molecular sieving effect of ZIF-8. This study opens up a promising route for constructing plasmonic nanostructures with site selectively deposited ZIF-8, which hold enormous potential for molecular sensing, optical switching, and plasmonic catalysis.

Resveratrol improves the iron deficiency adaptation of Malus baccata seedlings by regulating iron absorption.

BACKGROUND: Resveratrol (Res), a phytoalexin, has been widely reported to participate in plant resistance to fungal infections. However, little information is available on its role in abiotic stress, especially in iron deficiency stress. Malus baccata is widely used as apple rootstock in China, but it is sensitive to iron deficiency. RESULTS: In this study, we investigated the role of exogenous Res in M. baccata seedings under iron deficiency stress. Results showed that applying 100 µM exogenous Res could alleviate iron deficiency stress. The seedlings treated with Res had a lower etiolation rate and higher chlorophyll content and photosynthetic rate compared with the apple seedlings without Res treatment. Exogenous Res increased the iron content in the roots and leaves by inducing the expression of MbAHA genes and improving the H+-ATPase activity. As a result, the rhizosphere pH decreased, iron solubility increased, the expression of MbFRO2 and MbIRT1 was induced, and the ferric-chelated reductase activity was enhanced to absorb large amounts of Fe2+ into the root cells under iron deficiency conditions. Moreover, exogenous Res application increased the contents of IAA, ABA, and GA3 and decreased the contents of DHZR and BL for responding to iron deficiency stress indirectly. In addition, Res functioned as an antioxidant that strengthened the activities of antioxidant enzymes and thus eliminated reactive oxygen species production induced by iron deficiency stress. CONCLUSION: Resveratrol improves the iron deficiency adaptation of M. baccata seedlings mainly by regulating iron absorption.

Transcriptional identification of differentially expressed genes during the prepupal-pupal transition in the oriental armyworm, Mythimna separata (Walker) (Lepidoptera: Noctuidae).

The oriental armyworm, Mythimna separata (Walker) is a serious pest of agriculture that does particular damage to Gramineae crops in Asia, Europe, and Oceania. Metamorphosis is a key developmental stage in insects, although the genes underlying the metamorphic transition in M. separata remain largely unknown. Here, we sequenced the transcriptomes of five stages; mature larvae (ML), wandering (W), and pupation (1, 5, and 10 days after pupation, designated P1, P5, and P10) to identify transition-associated genes. Four libraries were generated, with 22,884, 23,534, 26,643, and 33,238 differentially expressed genes (DEGs) for the ML-vs-W, W-vs-P1, P1-vs-P5, and P5-vs-P10, respectively. Gene ontology enrichment analysis of DEGs showed that genes regulating the biosynthesis of the membrane and integral components of the membrane, which includes the cuticular protein (CP), 20-hydroxyecdysone (20E), and juvenile hormone (JH) biosynthesis, were enriched. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis indicated that DEGs were enriched in the metabolic pathways. Of these DEGs, thirty CP, seventeen 20E, and seven JH genes were differentially expressed across the developmental stages. For transcriptome validation, ten CP, 20E, and JH-related genes were selected and verified by real-time PCR quantitative. Collectively, our results provided a basis for further studies of the molecular mechanism of metamorphosis in M. separata.

Insecticide resistance in the Cydia pomonella (L): Global status, mechanisms, and research directions.

The codling moth, Cydia pomonella (Lepidoptera: Tortricidae) is a major pest of pome fruit and walnuts worldwide. Although environmentally compatible integrated control strategies, such as mating disruption, attract-kill strategy, and sterile insect technique have been conducted for management of this notorious pest, effects to control of codling moth have mainly relied on insecticides. In consequence, different levels of insecticide resistance towards organophosphates, neonicotinoids, hydrazines, benzoylureas, pyrethroids, diamides, spinosyns, avermectins, JH mimics, carbamates, oxadiazines and C. pomonella granulovirus (CpGVs) have developed in codling moth in different countries and areas. Both metabolic and target-site mechanisms conferring resistance have been revealed in the codling moth. In this review, we summarize the current global status of insecticide resistance, the biochemical and molecular mechanisms involved, and the implications for resistance management.

Review on Structures of Pesticide Targets.

Molecular targets play important roles in agrochemical discovery. Numerous pesticides target the key proteins in pathogens, insect, or plants. Investigating ligand-binding pockets and/or active sites in the proteins' structures is usually the first step in designing new green pesticides. Thus, molecular target structures are extremely important for the discovery and development of such pesticides. In this manuscript, we present a review of the molecular target structures, including those of antiviral, fungicidal, bactericidal, insecticidal, herbicidal, and plant growth-regulator targets, currently used in agrochemical research. The data will be helpful in pesticide design and the discovery of new green pesticides.

The poly (ADP-ribose) polymerase inhibitor rucaparib suppresses proliferation and serves as an effective radiosensitizer in cervical cancer.

Objectives Our goal was to investigate the effects of rucaparib on the proliferation of cervical cancer cells and sensitivity to radiotherapy. Methods We used the human cervical cancer cell lines Hela and Siha and evaluated their viability and activity using various methods. Cellular proliferation was assessed by CCK-8 and clonogenic assays after treatment with rucaparib. Cell cycle analysis was performed using propidium iodide staining. Western immunoblotting analysis was used to detect the expression of cyclin D1 and CDK4. Immunofluorescence staining assay was performed to detect the expression of the DNA injury marker ×¥-H2AX after treatment with rucaparib and radiotherapy. Animal experiments were also performed to evaluate tumor size after treatment with rucaparib. Immunohistochemistry was performed to analyze the expression of Ki-67. Results Rucaparib suppressed proliferation, induced G2/M phase arrest, and reduced the expression of cyclin D1 and CDK4 in cervical cancer cells. When rucaparib was combined with radiotherapy in cervical cancer cells, clone formation decreased significantly and G2/M phase arrest was accentuated. The expression of the DNA-damage marker ×¥-H2AX was increased significantly, and rucaparib suppressed tumor growth in vivo. Conclusions Rucaparib exerts significant anti-proliferative effects and can serve as an effective radiosensitizer in cervical cancer, suggesting its candidacy in cervical cancer treatment and worthiness for further investigation.

2D Co-crystallization of molecular homologues promoted by size complementarity of the alkyl chains at the liquid/solid interface.

Co-crystallization of organic molecules is an important strategy for the fabrication of molecular materials. In this contribution, we investigated the mixing behavior of 5-(benzyloxy)-isophthalic acid homologues (BIC-Cn, n = 6, 8, 10, 12, and 14) at the liquid/solid interface using a scanning tunneling microscope. Deposition of the single component of BIC-Cn always results in typical honeycomb networks, whereas co-deposition of two BIC-Cn homologues leads to hybrid double-walled honeycomb networks or phase separation depending on the difference in the length of their alkyl chains. 2D co-crystallization can only be realized for BIC-C6/BIC-C10 or BIC-C8/BIC-C12 which have a four-methyl unit difference in their alkyl chains. The size complementarity of the alkyl chains in the two components suggests that it is responsible for the 2D co-crystallization, though hydrogen bonding contributes a lot both to the pristine honeycomb network and to the hybrid co-crystal. This result is of importance for understanding the role of van der Waals interaction and its interplay with hydrogen bonding in 2D co-crystallization.

LC50 of lambda-cyhalothrin stimulates reproduction on the moth Mythimna separata (Walker).

Lambda-cyhalothrin has long been recommended as an effective insecticide to control the oriental armyworm, Mythimna separata (Walker), a notorious migratory pest of agricultural plants. Previous researches have suggested that survival, development, and reproduction of insects are influenced by sublethal concentrations of insecticides. However, the effects of sublethal concentrations of lambda-cyhalothrin on M. separata are less known. In this study, we determined the toxicity and effects of LC20 and LC50 concentration of lambda-cyhalothrin on development and reproduction of M. separata. Results indicate that LC20 of lambda-cyhalothrin tends to decrease the life traits of M. separate, with a shortening larvae period of offspring and oviposition period, whereas LC50 of lambda-cyhalothrin stimulates daily maximal fecundity and forwards the oviposition peak, suggesting a stimulation of reproduction by LC50 of lambda-cyhalothrin. The M. separata population was increased by an LC50 concentration of lambda-cyhalothrin, resulting in a net reproductive rate (R0) and intrinsic rate of increase (rm) significantly higher than that of the control. Transcripts of vitellogenin (MsVg) and vitellogenin receptor (MsVgR) genes were suppressed at day 1 after emergence of moth which developed from the larvae exposed to LC20 and LC50 of lambda-cyhalothrin, but were significant induced when the moth begin to lay eggs (day 4), with a more remarkable induction by LC50 of lambda-cyhalothrin than those of LC20 of lambda-cyhalothrin. Our results indicate that the observed stimulation of reproduction is therefore the results of up-regulation of MsVg and MsVgR by LC50 of lambda-cyhalothrin.

Thermal Enhancement of Upconversion by Negative Lattice Expansion in Orthorhombic Yb2 W3 O12.

Thermal quenching of photoluminescence represents a significant obstacle to practical applications such as lighting, display, and photovoltaics. Herein, a novel strategy is established to enhance upconversion luminescence at elevated temperatures based on the use of negative thermal expansion host materials. Lanthanide-doped orthorhombic Yb2 W3 O12 crystals are synthesized and characterized by in situ X-ray diffraction and photoluminescence spectroscopy. The thermally induced contraction and distortion of the host lattice is demonstrated to enhance the collection of excitation energy by activator ions. When the temperature is increased from 303 to 573 K, a 29-fold enhancement of green upconversion luminescence in Er3+ activators is achieved. Moreover, the temperature dependence of the upconversion luminescence is reversible. The thermally enhanced upconversion is developed as a sensitive ratiometric thermometer by referring to a thermally quenched upconversion.

Synthesis of Mesoporous ZIF-8 Nanoribbons and their Conversion into Carbon Nanoribbons for High-Performance Supercapacitors.

ZIF-8 nanoribbons, with tunable morphology and pore structure, were synthesized by using the tri-block co-polymer Pluronic F127 as a soft template. The as-synthesized ZIF-8 nanoribbons were converted into carbon nanoribbons by thermal transformation with largely preserved morphology and porosity. The resulting carbon nanoribbons feature both micro- and meso-pores with high surface areas of over 1000 m2 g-1 . In addition, nitrogen-doping in the carbon nanoribbons was achieved, as confirmed by XPS and EELS measurements. The hybrid carbon nanoribbons provide pseudo-capacitance that promotes electrochemical performance, rendering a high specific capacitance of up to 297 F g-1 at a current density of 0.5 A g-1 in a three-electrode system. A long cycle life was also demonstrated by recording a 90.26 % preservation of capacitance after 10 000 cycles of charge-discharge at a current density of 4.0 A g-1 . Furthermore, a symmetrical supercapacitor is fabricated by employing the carbon nanoribbons, which shows good electrochemical performance with respect to energy, power and cycle life.

The influence of a hydrophobic carrier, reactant and product during H2O adsorption on Pd surface for the oxidative esterification of methacrolein to methyl methacrylate.

Taking the one-step oxidative esterification of methacrolein (MAL) to methyl methacrylate (MMA) as a model reaction and because H2O that was generated easily formed a film of water on the catalyst surface, which restricted the diffusion of the reactants to the active sites, the effects of the hydrophobic carrier styrene-divinylbenzene (SDB) copolymer, the reactant CH3OH and the product MMA during the adsorption of H2O on a Pd surface were investigated. For a Pd/SDB catalyst, the interactions between the active component and the carrier were first calculated using Pd4 clusters. The results implied that Pd4 clusters were chemisorbed on the SDB carrier. By comparing the adsorption energy of H2O molecules on Pd4 clusters with or without SDB, it was found that the adsorption energy of the former was reduced by about 50%, indicating that the hydrophobic carrier SDB reduced the adsorption of H2O on Pd4 clusters. This was also confirmed by the results for the partial density of states, differences in charge density and comparative Mulliken charge analysis. The influences of the reactant CH3OH and the product MMA on the adsorption of H2O were investigated using the Pd(111) surface. The results of co-adsorption simulations showed that some of the electrons on CH3OH molecules were transferred to H2O molecules that strengthened the electronic interaction between H2O molecules and the Pd surface and led to a change in the adsorption of isolated H2O molecules from physisorption to chemisorption. However, the product MMA when chemisorbed on the Pd surface had little effect on the adsorption of H2O molecules on the Pd(111) surface.