[Value of histological activity in predicting endoscopic relapse among patients of ulcerative colitis in endoscopic remission].

Objective: To investigate the value of histological evaluation in predicting endoscopic relapse among patients with ulcerative colitis (UC) who were in endoscopic remission, and to compare the usefulness of various histological scoring systems. Methods: Histological sections from 61 patients with UC who were in endoscopic remission were retrospectively analyzed, at Peking University Third Hospital, Beijing, China from January 2015 to June 2021. They were subdivided into endoscopic persistent remission group (remission group, n=31, Mayo endoscopic score 0) and endoscopic relapse group (relapse group, n=30, Mayo endoscopic score≥1) according to the results of the first endoscopic reexamination after the biopsy. Histological evaluation was performed using the Geboes score (GS) and its simplified version (SGS), the Nancy index (NI) and the Robarts histopathological index (RHI). The median and maximum histological scores for each case in all biopsies were recorded. Univariate comparisons were performed using chi-squares and multivariate analysis using binary logistic regression. The values of four histological evaluation systems for predicting endoscopic relapse among UC patients in endoscopic remission were analyzed using receiver operating characteristic (ROC) curves. Results: Significant differences were observed between the remission and relapse groups. The differences were more pronounced in the maximum histological scores; the mean and highest results of area under the ROC curve scores (AUC) for GS, SGS, NI, and RHI were 0.657, 0.668, 0.682, 0.691, and 0.866, 0.863, 0.864, 0.869, respectively. The differences were statistically significant (P<0.05). The corresponding best cut-offs were GS≥2B.1, SGS≥2B.1, NI≥2, and RHI≥2.5, respectively, which meant mild active inflammation histologically, while there was no statistical difference of AUC among the four histological scoring indices (P>0.05). Univariate and multivariate analyses revealed statistically significant differences in the number of neutrophils in the epithelium and lamina propria (P<0.05). Conclusions: Biopsies from UC patients in endoscopic remission may still have histological active inflammation which appears to correlate with endoscopic relapse. Four commonly used histological scoring systems can be used to assess the risk of endoscopic relapse among UC patients in endoscopic remission. The patients who more likely have endoscopic relapse seem to have a histological score greater than the cut-off value (i.e., mild histological activity). The maximum histological scores can accurately predict the risk of endoscopic relapse, while the presence of epithelial and laminar propria neutrophil infiltrates can independently predict the endoscopic relapse in these patients. Considering the utility and convenience in routine practice, NI is recommended for evaluating histological inflammatory activity.

[Construction of TRAF6 ubiquitin site 331 mutant colorectal cancer cell stable line and its effect on biological behavior of colorectal cancer cells].

Objective: To investigate the effect of ubiquitin mutation at position 331 of tumor necrosis factor receptor related factor 6 (TRAF6) on the biological characteristics of colorectal cancer cells and its mechanism. Methods: lentivirus wild type (pCDH-3×FLAG-TRAF6) and mutation (pCDH-3×FLAG-TRAF6-331mut) of TRAF6 gene expression plasmid with green fluorescent protein tag were used to infect colorectal cancer cells SW480 and HCT116, respectively. The infection was observed by fluorescence microscope, and the expressions of TRAF6 and TRAF6-331mut in cells was detected by western blot. Cell counting kit-8 (CCK-8) and plate cloning test were used to detect the proliferation ability of colorectal cancer cells in TRAF6 group and TRAF6-331mut group, cell scratch test to detect cell migration, Transwell chamber test to detect cell migration and invasion, immunoprecipitation to detect the ubiquitination of TRAF6 and TRAF6-331mut with ubiquitinof lysine binding sites K48 and K63. Western blot was used to detect the effects of TRAF6 and TRAF6-331mut over expression on the nuclear factor kappa-B (NF-κB) and mitogen activated protein kinase mitogen-activated protein kinase (MAPK)/activating protein-1(AP-1) signal pathway. Results: The successful infection of colorectal cancer cells was observed under fluorescence microscope. Western blot detection showed that TRAF6 and TRAF6-331mut were successfully expressed in colorectal cancer cells. The results of CCK-8 assay showed that on the fourth day, the absorbance values of HCT116 and SW480 cells in TRAF6-331mut group were 1.89±0.39 and 1.88±0.24 respectively, which were lower than those in TRAF6 group (2.09±0.12 and 2.17±0.45, P=0.036 and P=0.011, respectively). The results of plate colony formation assay showed that the number of clones of HCT116 and SW480 cells in TRAF6-331mut group was 120±14 and 85±14 respectively, which was lower than those in TRAF6 group (190±21 and 125±13, P=0.001 and P=0.002, respectively). The results of cell scratch test showed that after 48 hours, the percentage of wound healing distance of HCT116 and SW480 cells in TRAF6-331mut group was (31±12)% and (33±14)%, respectively, which was lower than those in TRAF6 group [(43±13)% and (43±7)%, P=0.005 and 0.009, respectively]. The results of Transwell migration assay showed that the migration numbers of HCT116 and SW480 cells in TRAF6-331mut group were significantly lower than those in TRAF6 group (P<0.001 and P<0.002, respectively). The results of Transwell invasion assay showed that the number of membrane penetration of HCT116 and SW480 cells in TRAF6-331mut group was significantly lower than those in TRAF6 group (P=0.008 and P=0.009, respectively). The results of immunoprecipitation detection showed that the ubiquitin protein of K48 chain pulled by TRAF6-331mut was lower than that of wild type TRAF6 in 293T cells co-transfected with K48 (0.57±0.19), and the ubiquitin protein of K63 chain pulled down by TRAF6-331mut in 293T cells co-transfected with K63 was lower than that of wild type TRAF6 (0.89±0.08, P<0.001). Western blot assay showed that the protein expression levels of NF-κB, p-NF-κB and p-AP-1 in TRAF6-331mut-HCT116 cells were 0.63±0.08, 0.42±0.08 and 0.60±0.07 respectively, which were lower than those in TRAF6-HCT116 cells (P=0.002, P<0.001 and P<0.001, respectively). The expression level of AP-1 protein in TRAF6-HCT116 cells was 0.89±0.06, compared with that in TRAF6-HCT116 cells. The difference was not statistically significant (P>0.05). The protein expression levels of NF-κB, p-NF-κB and p-AP-1 in TRAF6-331mut-SW480 cells were 0.50±0.06, 0.51±0.04, 0.48±0.02, respectively, which were lower than those in TRAF6-SW480 cells (all P<0.001). There was no significant difference in AP-1 protein expression between TRAF6-331mut-SW480 cells and TRAF6-SW480 cells. Conclusion: The ubiquitin site mutation of TRAF6 gene at 331 may prevent the binding of TRAF6 and ubiquitin lysine sites K48 and K63, and then affect the expressions of proteins related to downstream NF-κB and MAPK/AP-1 signal pathways, and inhibit the proliferation, migration and invasion of colorectal cancer cells.

[A prevalence survey of cone-beam computed tomography use among endodontic practitioners].

OBJECTIVE: To investigate the clinical application of cone-beam computed tomography (CBCT) among endodontic practitioners, and to analyze the indications and reasonability of CBCT in the diagnosis and treatment of pulpal and periapical diseases. METHODS: The clinical data were collected from patients who visited the Department of Cariology and Endodontology, Peking University School and Hospital of Stomatology and underwent CBCT examination from January to December, 2021. The data with their complete clinical information (including clinical records, radiology request forms/reports, two-dimensional and three-dimensional imaging data) were included. Those who underwent CBCT examination for orthodontic or prosthodontics were excluded. The experience and training background of the endodontic specialists, the number of patients treated in the whole year, the objective and region of interest (ROI) of CBCT examination, technical parameters, such as machine type, field of view (FoV) and radiographic reports were collected and analyzed to evaluate the impact on diagnosis. Wilcoxon and Mann-Whitney tests were used to compare the distribution of CBCT ROI. Chi-squared test and pairwise comparison were used to compare the application of CBCT by endodontic specialists with different clinical experience (senior, middle and junior). RESULTS: In 2021, a total of 3 308 CBCT scans were prescribed by 61 endodontic specialists who treated 34 952 patients throughout the year. 3 218 patients (male ∶female about 1 ∶2) amounting for 10% of the patients treated in the whole year who received CBCT scans with an median age of 35 years (28, 49). Around 98% CBCT examinations were performed after clinical examination and two-dimensional periapical radiographs were taken. The FoV of CBCT scanning less than 10 cm×10 cm accounted for 96% of the total number of the images. Among the 3 308 CBCT scans, 83% of the ROI were in posterior teeth, with a higher number of anterior teeth (Z=-2.278, P < 0.05). Maxillary and mandibular first molars accounted for 35% of the examined teeth. The objectives of CBCT scanning included three aspects: clarifying clinical diagnosis, guiding surgical and non-surgical endodontic treatment (including management of endodontic complications), and outcome assessment, accounting for 1 111 (34%), 1 745 (54%), 311 (10%), respectively. and the others 2%. In the diagnosis process, CBCT was mainly used for the diagnosis of chronic periapical periodontitis, root fracture, root resorption and dental trauma. In the study, 353 CBCT were used in the diagnosis of root fracture, with a positive diagnosis rate of 35% (125/353). 846 CBCT used to reveal the anatomy of the root canal system, of which 297 cases were used to find missed/extra canals after treatment failure, and 58% (171/297) were used to confirm the missed/extra canals. In the management of complications or errors, CBCT was mainly used to assist the diagnosis of perforation and to locate the separated instruments. In the study, 311 CBCT scans were used for outcome assessment, including 240 cases related to non-surgical treatment and 71 cases related to surgical endodontic treatment for follow-up or presence of clinical symptoms, and persistent lesions on 2D films. Among the 61 endodontic specialists who used CBCT, 23 (45%) were with senior experience, 15 (30%) with middle experience, and 23 (25%) with junior experience. The proportion of senior or junior experience prescribing CBCT examination was 10%, higher than that of middle experience (8%, χ12=39.4, χ22=29.1, P < 0.001). The application rate of chief endodontists was 18%, which was higher than that of associate chief endodontists (9%, χ12=139.4, P < 0.001). 31% (1 109/3 308) cases of diagnosis or treatment plans were changed after CBCT was taken. CONCLUSION: Use of CBCT in endodontic practice could provide more clinical information, which is helpful for diagnosis, accurate treatment and prognosis evaluation.

[Treatment experience of cardiac rupture in patients with acute myocardial infarction].

Objective: To analyze the treatment results of cardiac rupture in patients with acute myocardial infarction (AMI) . Method: Clinical data of 6 with cardiac rupture after AMI, who were hospitalized in our hospital from June 2015 to June 2017, were retrospectively analyzed,and the clinical manifestations, methods of treatment and outcomes were investigated. Results: Cardiac function classification was Killip class Ⅱin all patients. There were 3 massive anterior wall myocardial infarction, 2 anterior wall myocardial infarction,and 1 inferior myocardial infarction. There were 4 patients with ventricular septal defect, 1 patient with rupture of papillary muscle,and 1 patient with left ventricular free wall rupture.All patients received continuous infusion of vasoactive medicines and treated with intra-aortic balloon pump(IABP), 2 patients (1 patient accepted operative treatment,and 1 patient received conservative treatment) were treated with extracorporeal membrane oxygenation (ECMO), mechanical ventilation,and continuous renal replacement therapy(CRRT).Three patients received surgical repair,1 case was supported by IABP, 1 case supported by ECMO,CRRT,and IABP,and 1 case did not use IABP or ECMO post operation. All 3 surgically treated patients recovered successfully and were discharged from hospital.Meanwhile, in the other 3 patients treated conservatively, 2 patients died in the hospital and 1 patient was discharged according to own will. Conclusion: On the basis of vasoactive medicines and IABP, surgery repair is a feasible option for cardiac rupture patients secondary to AMI,and ECMO may improve the perioperative state in these patients.

Evidence that activation of ASIC1a by acidosis increases osteoclast migration and adhesion by modulating integrin/Pyk2/Src signaling pathway.

Activated acid-sensing ion channel 1a (ASIC1a) is involved in acid-induced osteoclastogenesis by regulating activation of the transcription factor NFATc1. These results indicated that ASIC1a activation by extracellular acid may cause osteoclast migration and adhesion through Ca2+-dependent integrin/Pyk2/Src signaling pathway. INTRODUCTION: Osteoclast adhesion and migration are responsible for osteoporotic bone loss. Acidic conditions promote osteoclastogenesis. ASIC1a in osteoclasts is associated with acid-induced osteoclastogenesis through modulating transcription factor NFATc1 activation. However, the influence and the detailed mechanism of ASIC1a in regulating osteoclast adhesion and migration, in response to extracellular acid, are not well characterized. METHODS: In this study, knockdown of ASIC1a was achieved in bone marrow macrophage cells using small interfering RNA (siRNA). The adhesion and migration abilities of osteoclast precursors and osteoclasts were determined by adhesion and migration assays, in vitro. Bone resorption was performed to measure osteoclast function. Cytoskeletal changes were assessed by F-actin ring formation. αvß3 integrin expression in osteoclasts was measured by flow cytometry. Western blotting and co-immunoprecipitation were performed to measure alterations in integrin/Pyk2/Src signaling pathway. RESULTS: Our results showed that blockade of ASIC1a using ASIC1a-siRNA inhibited acid-induced osteoclast precursor migration and adhesion, as well as osteoclast adhesion and bone resorption; we also demonstrated that inhibition of ASIC1a decreased the cell surface αvß3 integrin and ß3 protein expression. Moreover, blocking of ASIC1a inhibited acidosis-induced actin ring formation and reduced Pyk2 and Src phosphorylation in osteoclasts and also inhibited the acid-induced association of the αvß3 integrin/Src/Pyk2. CONCLUSION: Together, these results highlight a key functional role of ASIC1a/αvß3 integrin/Pyk2/Src signaling pathway in migration and adhesion of osteoclasts.

Diagnostic value of cytological and microbiological methods in cryptococcal meningitis.

The aim of this study was to investigate diagnostic methods for cryptococcal meningitis (CM). A retrospective analysis was conducted for 31 patients with CM confirmed by etiologic detection of cerebrospinal fluid in our hospital in the past 5 years. Nineteen cases in 31 patients were confirmed with CM in the first diagnosis, with a misdiagnosis rate of 38.7%. The positive rates of cryptococcus detection in cerebrospinal fluid with May-Grünwald-Giemsa (MGG)-, ink-, and Alcian blue-staining methods were 86.9, 70.9, and 80.6%, respectively. The misdiagnosis rate of CM is high during the early stage of disease. The total positive rate of cryptococcus diagnosis using the MGG-staining method was significantly higher than that using the ink-staining method. These results are important for diagnosing CM.

Arthroscopic reconstruction of the anterior cruciate ligament with the LARS artificial ligament: thirty-six to fifty-two months follow-up study.

OBJECTIVES: This study aims to analyze the operating methods and fundamental clinical effects of the reconstruction of the anterior cruciate ligament (ACL) with the Ligament Advancement Reinforcement System (LARS) artificial ligaments using an arthroscopy. PATIENTS AND METHODS: Fifty-three patients with ACL rupture who were treated using LARS artificial ligaments were enrolled in this retrospective study. The mean age at the time of reconstruction was 31.2 y (range, 22-51y). Average time from injury to surgery was 18 d (range, 5-51 d). Average follow-up period was 45 mo (range 36-52 months). Follow-up examinations included the Lysholm Knee Score and the International Knee Documentation Committee (IKDC) score. RESULTS: The average Lysholm Knee Score was 53.1±5.8 preoperatively (range, 47-76) versus 93.2±3.4 three years after operation (range, 80-100). Fifty-one of 53 patents (96.2%) showed good or excellent results at final assessment. The final IKDC score 3 years after operation were normal in 28 patients (52.8%), nearly normal in 23 patients (43.4%), and abnormal in 2 patients (3.8%). No postoperative complications, such as infection, ligament rupture, or ligament cinch occurred. CONCLUSIONS: The results suggest that LARS artificial ligament appears to be an effective graft for ACL reconstruction leading to good knee function and stability. Long-term follow-up should be performed to confirm the durable stability of the knee and the tolerance of the knee to the LARS artificial ligament.

Effects of edaravone combined with Oxiracetam on neuronal apoptosis in rats with cerebral infarction through targeting SIRT1/NF-κB inflammatory pathway.

OBJECTIVE: The objective of this study was to investigate the effects of edaravone combined with oxiracetam on neuronal apoptosis in rats with cerebral infarction (CI) and to explore the potential molecular mechanism. MATERIALS AND METHODS: A total of 36 Sprague-Dawley rats were randomly divided into sham-operation group (n=12), model group (n=12) and treatment group (n=12). Only the external carotid artery was exposed in sham-operation group, while the models of CI were established using suture method in the other two groups. After modeling, the rats in sham-operation group and model group were intraperitoneally injected with normal saline, and those in treatment group were administered with edaravone and oxiracetam solutions via intraperitoneal injection. Then, the specimens were obtained at 2 weeks after intervention. The cognitive function of the rats was evaluated using a water maze, Nissl staining was applied to observe the neuronal morphology, and the relative protein expressions of silent information regulator 1 (SIRT1) and NF-κB were measured by means of Western blotting. Furthermore, quantitative polymerase chain reaction (qPCR) was performed to determine the messenger ribonucleic acid (mRNA) expressions of interleukin-1 beta (IL-1ß) and IL-6, the content of IL-1ß and IL-6 was detected by enzyme-linked immunosorbent assay (ELISA), and terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) assay was conducted to examine the cell apoptosis. RESULTS: Model group displayed a significantly longer escape latency and significantly fewer times of crossing the original platform than sham-operation group (p<0.05), whereas treatment group had a significantly shorter escape latency but significantly more times of crossing the original platform than model group (p<0.05). The relative protein expression level of SIRT1 was lowered significantly, while that of NF-κB was elevated significantly in model group in comparison with those in sham-operation group (p<0.05), and the opposite results were observed between model group and treatment group (p<0.05). Besides, the content of IL-1ß and IL-6 in brain tissues was increased significantly in model group compared with that in sham-operation group (p<0.05), but it was decreased significantly in treatment group in comparison with that in model group (p<0.05). The relative mRNA expression levels of IL-1ß and IL-6 were significantly higher in model group than those in sham-operation group (p<0.05). Moreover, model group exhibited more positive apoptotic cells and a significantly higher apoptosis rate than sham-operation group (p<0.05) and treatment group (p<0.05). No apparent abnormalities of neuronal morphology and structure were detected in sham-operation group, with many Nissl bodies. The neurons were damaged, with abnormal morphology and structure, and there were a small number of Nissl bodies in model group. The neurons were damaged in treatment group, but their morphology and structure were improved evidently compared with those in model group. CONCLUSIONS: Edaravone combined with oxiracetam can inhibit the neuronal apoptosis in CI rats by regulating the SIRT1/NF-κB signaling pathway, thereby exerting a neuroprotective effect.

Wnt10b promotes growth of hair follicles via a canonical Wnt signalling pathway.

BACKGROUND: Wnt10b (wingless-related mouse mammary tumour virus integration site 10b) plays various roles in a wide range of biological actions, including hair-follicle development. AIM: To assess the roles that Wnt10b plays in postnatal hair-follicle growth. METHODS: Adenovirus vectors AdWnt10b, AdGFP, AdGFP plus AdRFP, AdWnt10b plus AdFrzB, and AdWnt10b plus AdSimBC were co-cultured separately with vibrissae. In situ protein expression of Wnt10b, ß-catenin and Lef1 was determined by immunohistochemistry, and the proliferation status of the hair follicle was detected by 5-bromo-2-deoxyuridine (BrdU) labelling. The presence of Wnt signalling molecules in the three stages of hair-follicle growth was detected by PCR-based microarray. RESULTS: AdWnt10b-infected cells were able to secrete bioactive Wnt10b, and when this was added into the basal medium, the vibrissae grew faster than in control medium or in medium containing canonical Wnt signalling antagonists. The in situ protein expression of Wnt10b was consistent with that of ß-catenin and Lef1. The expression locus of Wnt10b was almost the same as the proliferating cells labelled by BrdU in the anagen hair follicle. CONCLUSIONS: Wnt10b may promote hair-follicle growth by inducing the switch from telogen to anagen via a canonical Wnt signalling pathway to promote the proliferation of matrix cells.

Serological investigation and genomic characterization of PCV2 isolates from different geographic regions of Zhejiang province in China.

Sera collected from 46 swine farms in Zhejiang province were evaluated for the presence of antibodies to PCV2 using an indirect-fluorescent antibody procedure. In addition PCV2 isolated from superficial inguinal lymph node samples collected from 40-to 90-day-old pigs with clinical signs of post-weaning multisystemic wasting syndrome (PMWS) using the PK-15 cell line were sequenced and compared. Overall seroprevalence of PCV2 antibody averaged 58.34% for all samples. Breakdown of serology by groups was as follows: 59.38% for sows, 57.41% for post-weaning piglets, 44.83% for Landrace sows and 64.28% for Landrace piglets. The seroprevalence of Landrace sows was higher than that of Yorkshire and Duroc sows, but non-significant (p > 0.05). Serological analysis also showed that seroprevalence of PCV2 antibody was a negative correlation to that of PRRSV antibody. The complete genomes of five PCV2 isolates identified in the herds with PMWS consisted of 1767nt, containing the 11 potential ORFs. Genome of the virus isolates shared 93.8% to 99.8% identity with PCV2 reference strains from GenBank, 76.6% to 77.9% identity with PCV1. Phylogenetic analysis indicated that there were two subgenotypes within PCV2: subgenotype I (1767 nt) and subgenotype II (1768 nt).

[Transplantation of peripheral nerves and their tissue constituents to repair axotomized retinal ganglion cells in adult mammals].

We focus on how peripheral nerves or their tissue constituents including Schwann cells, fibroblasts and neurotrophic factors are used to overcome the unfavorable extrinsic CNS environment and upregulate the intrinsic growth potential of injured neurons for the enhancement of neuronal survival and axonal regeneration of axotomized retinal ganglion cells in adult mammals.

Characterization of an avian infectious bronchitis virus isolated in China from chickens with nephritis.

One IBV isolate, SC021202, was isolated from the kidneys of the infected young chickens by inoculating embryonated eggs, and its morphology, physiochemical and haemagglutonating properties were detected. Virulence of the isolate SC021202 was determined with specific pathogen-free (SPF) chicken inoculation. Nucleotide acid sequence of S1 gene of the isolate SC021202 was further sequenced and analysed. The physiochemical and morphological properties of the isolate SC021202 were in accordance to that of typical infectious bronchitis virus (IBV). In a pathogenicity experiment, the clinical signs and related gross lesions resembling those of field outbreak were reproduced and the virus isolate SC021202 was re-isolated from the kidneys of the infected chicken. Sequence data demonstrated that the full length of the amplified S1 gene of the isolate SC021202 was composed of 1931 nucleotides, coding a polypeptide of 543 amino acid residues. Compared with IBV strains from GenBank, the nucleotide and deduced amino acid sequence of S1 gene of the isolate SC021202 shared 60.0-91.4% and 49.1-88.9% identities, respectively. A nucleotide fragment of 'CTTTTTAATTATACTAACGGA' was inserted at nucleotide site 208 in the S1 gene of the isolate. These results indicated that IBV isolate SC021202 was a new variant IBV isolate and responsible for field outbreak of nephritis.