Hydrogen isotope fractionation is controlled by CO2 in coccolithophore lipids.

Hydrogen isotope ratios (δ2H) represent an important natural tracer of metabolic processes, but quantitative models of processes controlling H-fractionation in aquatic photosynthetic organisms are lacking. Here, we elucidate the underlying physiological controls of 2H/1H fractionation in algal lipids by systematically manipulating temperature, light, and CO2(aq) in continuous cultures of the haptophyte Gephyrocapsa oceanica. We analyze the hydrogen isotope fractionation in alkenones (αalkenone), a class of acyl lipids specific to this species and other haptophyte algae. We find a strong decrease in the αalkenone with increasing CO2(aq) and confirm αalkenone correlates with temperature and light. Based on the known biosynthesis pathways, we develop a cellular model of the δ2H of algal acyl lipids to evaluate processes contributing to these controls on fractionation. Simulations show that longer residence times of NADPH in the chloroplast favor a greater exchange of NADPH with 2H-richer intracellular water, increasing αalkenone. Higher chloroplast CO2(aq) and temperature shorten NADPH residence time by enhancing the carbon fixation and lipid synthesis rates. The inverse correlation of αalkenone to CO2(aq) in our cultures suggests that carbon concentrating mechanisms (CCM) do not achieve a constant saturation of CO2 at the Rubisco site, but rather that chloroplast CO2 varies with external CO2(aq). The pervasive inverse correlation of αalkenone with CO2(aq) in the modern and preindustrial ocean also suggests that natural populations may not attain a constant saturation of Rubisco with the CCM. Rather than reconstructing growth water, αalkenone may be a powerful tool to elucidate the carbon limitation of photosynthesis.

Clamping enables enhanced electromechanical responses in antiferroelectric thin films.

Thin-film materials with large electromechanical responses are fundamental enablers of next-generation micro-/nano-electromechanical applications. Conventional electromechanical materials (for example, ferroelectrics and relaxors), however, exhibit severely degraded responses when scaled down to submicrometre-thick films due to substrate constraints (clamping). This limitation is overcome, and substantial electromechanical responses in antiferroelectric thin films are achieved through an unconventional coupling of the field-induced antiferroelectric-to-ferroelectric phase transition and the substrate constraints. A detilting of the oxygen octahedra and lattice-volume expansion in all dimensions are observed commensurate with the phase transition using operando electron microscopy, such that the in-plane clamping further enhances the out-of-plane expansion, as rationalized using first-principles calculations. In turn, a non-traditional thickness scaling is realized wherein an electromechanical strain (1.7%) is produced from a model antiferroelectric PbZrO3 film that is just 100 nm thick. The high performance and understanding of the mechanism provide a promising pathway to develop high-performance micro-/nano-electromechanical systems.

Manipulating chiral spin transport with ferroelectric polarization.

A magnon is a collective excitation of the spin structure in a magnetic insulator and can transmit spin angular momentum with negligible dissipation. This quantum of a spin wave has always been manipulated through magnetic dipoles (that is, by breaking time-reversal symmetry). Here we report the experimental observation of chiral spin transport in multiferroic BiFeO3 and its control by reversing the ferroelectric polarization (that is, by breaking spatial inversion symmetry). The ferroelectrically controlled magnons show up to 18% modulation at room temperature. The spin torque that the magnons in BiFeO3 carry can be used to efficiently switch the magnetization of adjacent magnets, with a spin-torque efficiency comparable to the spin Hall effect in heavy metals. Utilizing such controllable magnon generation and transmission in BiFeO3, an all-oxide, energy-scalable logic is demonstrated composed of spin-orbit injection, detection and magnetoelectric control. Our observations open a new chapter of multiferroic magnons and pave another path towards low-dissipation nanoelectronics.

miR-486-5p Attenuates Steroid-Induced Adipogenesis and Osteonecrosis of the Femoral Head Via TBX2/P21 Axis.

Enhanced adipogenic differentiation of mesenchymal stem cells (MSCs) is considered as a major risk factor for steroid-induced osteonecrosis of the femoral head (SOFNH). The role of microRNAs during this process has sparked interest. miR-486-5p expression was down-regulated significantly in femoral head bone tissues of both SONFH patients and rat models. The purpose of this study was to reveal the role of miR-486-5p on MSCs adipogenesis and SONFH progression. The present study showed that miR-486-5p could significantly inhibit adipogenesis of 3T3-L1 cells by suppressing mitotic clonal expansion (MCE). And upregulated expression of P21, which was caused by miR-486-5p mediated TBX2 decrease, was responsible for inhibited MCE. Further, miR-486-5p was demonstrated to effectively inhibit steroid-induced fat formation in the femoral head and prevented SONFH progression in a rat model. Considering the potent effects of miR-486-5p on attenuating adipogenesis, it seems to be a promising target for the treatment of SONFH.

Screening Allergenic Potencies of Skin-Contact Products Using the Human-Derived THP-1 Cell Activation Test.

With the prevalence of allergic contact dermatitis (ACD) from the usage of skin-contact products, like wearable, skin care, and hair care products, screening their skin sensitizing potential is necessary, for the sake of alleviating the consequent public health impact. In the present study, a total of 77 skin-contact products classified by four categories, watch bands (WBs), skin care products (SCPs), hair care products (HCPs), and rubber gloves (RGs), were investigated, using an optimized in vitro assay of human cell line activation test (h-CLAT). Extracting the products using neutral artificial sweat simulated well the practical usage scenarios, and testing the extracts showed that 26 of them were allergy test positive, including nine WBs, six SCPs, two HCPs, and nine RGs. The allergenic response was mainly characterized by the induction of CD54 expression, and diverse paradigms of CD54 and CD86 levels were observed by analyzing dose-response curves, which could also be influenced by the compromised viability of the THP-1 cells. The data implicated the intricate regulation by different contributors to suspicious ingredients in the test samples. Altogether, a promising methodology for testing skin allergy potential was well established for commonly used commodities by neutral artificial sweat extraction coupled with h-CLAT screening. The findings would be of great help in tracing the potential allergens in practical products and improving their qualities.

RNAi efficiency is enhanced through knockdown of double-stranded RNA-degrading enzymes in butterfly Papilio xuthus.

The efficiency of RNA interference (RNAi) has always limited the research on the phenotype innovation of Lepidoptera insects. Previous studies have found that double-stranded RNA-degrading enzyme (dsRNase) is an important factor in RNAi efficiency, but there have been no relevant reports in butterflies (Papilionoidea). Papilio xuthus is one of the important models in butterflies with an extensive experimental application value. To explore the effect of dsRNase in the RNAi efficiency on butterflies, six dsRNase genes (PxdsRNase 1-6) were identified in P. xuthus genome, and their dsRNA-degrading activities were subsequently detected by ex vivo assays. The result shows that the dsRNA-degrading ability of gut content (<1 h) was higher than hemolymph content (>12 h). We then investigated the expression patterns of these PxdsRNase genes during different tissues and developmental stages, and related RNAi experiments were carried out. Our results show that different PxdsRNase genes had different expression levels at different developmental stages and tissues. The expression of PxdsRNase2, PxdsRNase3, and PxdsRNase6 were upregulated significantly through dsGFP injection, and PxdsRNase genes can be silenced effectively by injecting their corresponding dsRNA. RNAi-of-RNAi studies with PxEbony, which acts as a reporter gene, observed that silencing PxdsRNase genes can increase RNAi efficiency significantly. These results confirm that silencing dsRNase genes can improve RNAi efficiency in P. xuthus significantly, providing a reference for the functional study of insects such as butterflies with low RNAi efficiency.

MiR-601-induced BMSCs senescence accelerates steroid-induced osteonecrosis of the femoral head progression by targeting SIRT1.

BACKGROUND: The imbalance between osteogenic and adipogenic differentiation of bone marrow mesenchymal stem cells (BMSCs) is not only the primary pathological feature but also a major contributor to the pathogenesis of steroid-induced osteonecrosis of the femoral head (SONFH). Cellular senescence is one of the main causes of imbalanced BMSCs differentiation. The purpose of this study was to reveal whether cellular senescence could participate in the progression of SONFH and the related mechanisms. METHODS: The rat SONFH model was constructed, and rat BMSCs were extracted. Aging-related indicators were detected by SA-ß-Gal staining, qRT-PCR and Western Blot experiments. Using H2O2 to construct a senescent cell model, and overexpressing and knocking down miR-601 and SIRT1 in hBMSCs, the effect on BMSCs differentiation was explored by qRT-PCR, Western Blot experiment, oil red O staining (ORO), alizarin red staining (ARS), and luciferase reporter gene experiment. A rat SONFH model was established to test the effects of miR-601 and metformin in vivo. RESULTS: The current study showed that glucocorticoids (GCs)-induced BMSCs senescence, which caused imbalanced osteogenesis and adipogenesis of BMSCs, was responsible for the SONFH progression. Further, elevated miR-601 caused by GCs was demonstrated to contribute to BMSCs senescence through targeting SIRT1. In addition, the anti-aging drug metformin was shown to be able to alleviate GCs-induced BMSCs senescence and SONFH progression. CONCLUSIONS: Considering the role of BMSCs aging in the progression of SONFH, this provides a new idea for the prevention and treatment of SONFH.

Triptolide induces PANoptosis in macrophages and causes organ injury in mice.

Macrophages represent the first lines of innate defense against pathogenic infections and are poised to undergo multiple forms of regulated cell death (RCD) upon infections or toxic stimuli, leading to multiple organ injury. Triptolide, an active compound isolated from Tripterygium wilfordii Hook F., possesses various pharmacological activities including anti-tumor and anti-inflammatory effects, but its applications have been hampered by toxic adverse effects. It remains unknown whether and how triptolide induces different forms of RCD in macrophages. In this study, we showed that triptolide exhibited significant cytotoxicity on cultured macrophages in vitro, which was associated with multiple forms of lytic cell death that could not be fully suppressed by any one specific inhibitor for a single form of RCD. Consistently, triptolide induced the simultaneous activation of pyroptotic, apoptotic and necroptotic hallmarks, which was accompanied by the co-localization of ASC specks respectively with RIPK3 or caspase-8 as well as their interaction with each other, indicating the formation of PANoptosome and thus the induction of PANoptosis. Triptolide-induced PANoptosis was associated with mitochondrial dysfunction and ROS production. PANoptosis was also induced by triptolide in mouse peritoneal macrophages in vivo. Furthermore, triptolide caused kidney and liver injury, which was associated with systemic inflammatory responses and the activation of hallmarks for PANoptosis in vivo. Collectively, our data reveal that triptolide induces PANoptosis in macrophages in vitro and exhibits nephrotoxicity and hepatotoxicity associated with induction of PANoptosis in vivo, suggesting a new avenue to alleviate triptolide's toxicity by harnessing PANoptosis.

Insight into Interfacial Polarization for Enhancing Piezoelectricity in Ferroelectric Nanocomposites.

The interfacial effect is widely used to optimize the properties of ferroelectric nanocomposites, however, there is still a lack of direct evidence to understand its underlying mechanisms limited by the nano size and complex structures. Here, taking piezoelectricity, for example, the mechanism of interfacial polarization in barium titanate/poly(vinylidene fluoride-ran-trifluoroethylene) (BTO/P(VDF-TrFE)) nanocomposite is revealed at multiple scales by combining Kelvin probe force microscope (KPFM) with theoretical stimulation. The results prove that the mismatch of permittivity between matrix and filler leads to the accumulation of charges, which in turn induces local polarization in the interfacial region, and thus can promote piezoelectricity independently. Furthermore, the strategy of interfacial polarization to enhance piezoelectricity is extended and validated in other two similar nanocomposites. This work uncovers the mechanism of interfacial polarization and paves newfangled insights to boost performances in ferroelectric nanocomposites.

Phylogenomics and taxon-rich phylogenies of new and historical specimens shed light on the systematics of Hypnea (Cystocloniaceae, Rhodophyta).

Cystocloniacae is a highly diverse family of Rhodophyta, including species of ecological and economic importance, whose phylogeny remains largely unresolved. Species delimitation is unclear, particularly in the most speciose genus, Hypnea, and cryptic diversity has been revealed by recent molecular assessments, especially in the tropics. Here, we carried out the first phylogenomic investigation of Cystocloniaceae, focused on the genus Hypnea, inferred from chloroplast and mitochondrial genomes including taxa sampled from new and historical collections. In this work, molecular synapomorphies (gene losses, InDels and gene inversions) were identified to better characterize clades in our congruent organellar phylogenies. We also present taxon-rich phylogenies based on plastid and mitochondrial markers. Molecular and morphological comparisons of historic collections with contemporary specimens revealed the need for taxonomic updates in Hypnea, the synonymization of H. marchantiae to a later heterotypic synonym of H. cervicornis and the description of three new species: H. davisiana sp. nov., H. djamilae sp. nov. and H. evaristoae sp. nov.

Dimethyl fumarate inhibits necroptosis and alleviates systemic inflammatory response syndrome by blocking the RIPK1-RIPK3-MLKL axis.

Necroptosis has been implicated in various inflammatory diseases including tumor-necrosis factor-α (TNF-α)-induced systemic inflammatory response syndrome (SIRS). Dimethyl fumarate (DMF), a first-line drug for treating relapsing-remitting multiple sclerosis (RRMS), has been shown to be effective against various inflammatory diseases. However, it is still unclear whether DMF can inhibit necroptosis and confer protection against SIRS. In this study, we found that DMF significantly inhibited necroptotic cell death in macrophages induced by different necroptotic stimulations. Both the autophosphorylation of receptor-interacting serine/threonine kinase 1 (RIPK1) and RIPK3 and the downstream phosphorylation and oligomerization of MLKL were robustly suppressed by DMF. Accompanying the suppression of necroptotic signaling, DMF blocked the mitochondrial reverse electron transport (RET) induced by necroptotic stimulation, which was associated with its electrophilic property. Several well-known anti-RET reagents also markedly inhibited the activation of the RIPK1-RIPK3-MLKL axis accompanied by decreased necrotic cell death, indicating a critical role of RET in necroptotic signaling. DMF and other anti-RET reagents suppressed the ubiquitination of RIPK1 and RIPK3, and they attenuated the formation of necrosome. Moreover, oral administration of DMF significantly alleviated the severity of TNF-α-induced SIRS in mice. Consistent with this, DMF mitigated TNF-α-induced cecal, uterine, and lung damage accompanied by diminished RIPK3-MLKL signaling. Collectively, DMF represents a new necroptosis inhibitor that suppresses the RIPK1-RIPK3-MLKL axis through blocking mitochondrial RET. Our study highlights DMF's potential therapeutic applications for treating SIRS-associated diseases.

Theaflavin mitigates acute gouty peritonitis and septic organ injury in mice by suppressing NLRP3 inflammasome assembly.

Activation of NLR family pyrin domain-containing 3 (NLRP3) inflammasome plays important role in defending against infections, but its aberrant activation is causally linked to many inflammatory diseases, thus being a therapeutic target for these diseases. Theaflavin, one major ingredient of black tea, exhibits potent anti-inflammatory and anti-oxidative activities. In this study, we investigated the therapeutic effects of theaflavin against NLRP3 inflammasome activation in macrophages in vitro and in animal models of related diseases. We showed that theaflavin (50, 100, 200 µM) dose-dependently inhibited NLRP3 inflammasome activation in LPS-primed macrophages stimulated with ATP, nigericin or monosodium urate crystals (MSU), evidenced by reduced release of caspase-1p10 and mature interleukin-1ß (IL-1ß). Theaflavin treatment also inhibited pyroptosis as shown by decreased generation of N-terminal fragment of gasdermin D (GSDMD-NT) and propidium iodide incorporation. Consistent with these, theaflavin treatment suppressed ASC speck formation and oligomerization in macrophages stimulated with ATP or nigericin, suggesting reduced inflammasome assembly. We revealed that theaflavin-induced inhibition on NLRP3 inflammasome assembly and pyroptosis resulted from ameliorated mitochondrial dysfunction and reduced mitochondrial ROS production, thereby suppressing interaction between NLRP3 and NEK7 downstream of ROS. Moreover, we showed that oral administration of theaflavin significantly attenuated MSU-induced mouse peritonitis and improved the survival of mice with bacterial sepsis. Consistently, theaflavin administration significantly reduced serum levels of inflammatory cytokines including IL-1ß and attenuated liver inflammation and renal injury of mice with sepsis, concomitant with reduced generation of caspase-1p10 and GSDMD-NT in the liver and kidney. Together, we demonstrate that theaflavin suppresses NLRP3 inflammasome activation and pyroptosis by protecting mitochondrial function, thus mitigating acute gouty peritonitis and bacterial sepsis in mice, highlighting a potential application in treating NLRP3 inflammasome-related diseases.

Association of cesarean section with asthma in children/adolescents: a systematic review and meta-analysis based on cohort studies.

BACKGROUND: Whether cesarean section (CS) is a risk factor for asthma in offspring is controversial. The purpose of this study was to investigate the association between CS and asthma in children/adolescents. METHODS: Pubmed, Embase, Web of Science, and Cochrane Library electronic databases were searched for cohort studies on the relationship between mode of delivery and asthma in children/adolescents up to February 2023. Birth via CS was considered an exposure factor. Asthma incidence was taken as a result. RESULTS: Thirty-five cohort studies (thirteen prospective and twenty-two retrospective cohort studies) were included. The results showed that the incidence of asthma was higher in CS offspring (odds ratio (OR) = 1.18, P < 0.001) than in the vaginal delivery (VD) group. Partial subgroup analyses showed a higher incidence of asthma in female offspring born via CS (OR = 1.26, P < 0.001) compared with the VD group, while there was no difference in males (OR = 1.07, P = 0.325). Asthma incidence was higher in CS offspring than in the VD group in Europe (OR = 1.20, P < 0.001), North America (OR = 1.15, P < 0.001), and Oceania (OR = 1.06, P = 0.008). This trend was not found in the Asian population (OR = 1.17, P = 0.102). The incidence of atopic asthma was higher in offspring born via CS (OR = 1.14, P < 0.001) compared to the VD group. The CS group had a higher incidence of persistent asthma, but the difference did not reach statistical significance (OR = 1.15, P = 0.063). CONCLUSION: In this meta-analysis, CS may be a risk factor for asthma in offspring children/adolescents compared with VD. The relationship between CS and asthma was influenced by sex and region.

Design and Verification of Deep Submergence Rescue Vehicle Motion Control System.

A six degree-of-freedom (DOF) motion control system for docking with a deep submergence rescue vehicle (DSRV) test platform was the focus of this study. The existing control methods can meet the general requirements of underwater operations, but the complex structures or multiple parameters of some methods have prevented them from widespread use. The majority of the existing methods assume the heeling effect to be negligible and ignore it, achieving motion control in only four or five DOFs. In view of the demanding requirements regarding positions and inclinations in six DOFs during the docking process, the software and hardware architectures of the DSRV platform were constructed, and then sparse filtering technology was introduced for data smoothing. Based on the adaptive control strategy and with a consideration of residual static loads, an improved S-plane control method was developed. By converting the force (moment) calculated by the controller to the body coordinate system, the complexity of thrust allocation was effectively reduced, and the challenge of thrust allocation in the case of a high inclination during dynamic positioning was solved accordingly. The automatic control of the trimming angle and heeling angle was realized with the linkage system of the ballast tank and pump valve. A PID method based on an intelligent integral was proposed, which not only dealt with the integral "saturation" problem, but also reduced the steady-state error and overshooting. Water pool experiments and sea trials were carried out in the presence of water currents for six-DOF motion control. The responsiveness and precision of the control system were verified by the pool experiment and sea trial results and could meet the control requirements in engineering practice. The reliability and operational stability of the proposed control system were also verified in a long-distance cruise.

Amplifying Dendritic Cell Activation by Bioinspired Nanometal Organic Frameworks for Synergistic Sonoimmunotherapy.

Despite recent advancements of sonodynamic therapy (SDT) in cancer immunotherapy, challenges have yet to be surmounted to further boost its immunotherapeutic efficacy due to the low-level tumor antigens presentation of dendritic cells (DCs). Cell membrane camouflaged-nanoparticles can integrate the neoantigens of the cancer cell membrane with the multifunctionalities of synthetic nanocores. Herein, sono-responsive nanoparticles coated with DC-targeted antibody chimeric cancer cell membrane are investigated for multimodal therapy. The nanometal organic frameworks (MOFs) that respond to ultrasound are loaded successfully inside the vesicles displaying an anti-DEC205 antibody. The anti-DEC205 chimeric vesicles can directly target and activate DCs, promote tumor antigens cross-presentation, and then produce a cascade amplified T-cell immune response. Upon deep tissue-penetrating sonication, AMR-MOF@AuPt generates large amounts of reactive oxygen species that directly kill cancer cells, further initiating an anti-cancer T cell immune response. Such synergistic sono-immunotherapies effectually inhibit tumor growth and induce strong systemic and long-term immune memory against cancer recurrence and distant metastasis. The authors findings provide DCs and tumor cells of a dual active-targeting cell membrane-coated sono-immunotherapeutic nanoplatform for cancer therapy.

Pervasive beyond Room-Temperature Ferromagnetism in a Doped van der Waals Magnet.

The existence of long-range magnetic order in low-dimensional magnetic systems, such as the quasi-two-dimensional van der Waals (vdW) magnets, has attracted intensive studies of new physical phenomena. The vdW Fe_{N}GeTe_{2} (N=3, 4, 5; FGT) family is exceptional, owing to its vast tunability of magnetic properties. In particular, a ferromagnetic ordering temperature (T_{C}) above room temperature at N=5 (F5GT) is observed. Here, our study shows that, by nickel (Ni) substitution of iron in F5GT, a record high T_{C}=478(6) K is achieved. Importantly, pervasive, beyond room-temperature ferromagnetism exists in almost the entire doping range of the phase diagram of Ni-F5GT. We argue that this striking observation in Ni-F5GT can be possibly due to several contributing factors, including increased 3D magnetic couplings due to the structural alterations.

Nonvolatile Electric Field Control of Thermal Magnons in the Absence of an Applied Magnetic Field.

Spin transport through magnetic insulators has been demonstrated in a variety of materials and is an emerging pathway for next-generation spin-based computing. To modulate spin transport in these systems, one typically applies a sufficiently strong magnetic field to allow for deterministic control of magnetic order. Here, we make use of the well-known multiferroic magnetoelectric, BiFeO_{3}, to demonstrate nonvolatile, hysteretic, electric-field control of thermally excited magnon current in the absence of an applied magnetic field. These findings are an important step toward magnon-based devices, where electric-field-only control is highly desirable.

Discovery of novel microtubule stabilizers targeting taxane binding site by applying molecular docking, molecular dynamics simulation, and anticancer activity testing.

Disruption of the dynamic equilibrium of microtubules can induce cell cycle arrest in G2/M phase and apoptosis. Hence, discovery of novel tubulin polymerization inhibitors is very necessary and an important task in drug research and development for treatment of various tumors. In this investigation, 50 compounds were screened as microtubule stabilizers targeting the taxane site by combination of molecular docking methods. Among these hits, hits 19 and 38 with novel scaffolds exhibited the highest anti-proliferative activity with IC50 ranging from 9.50 to 13.81 µM in four cancer cell lines. The molecular dynamics simulations confirmed that tubulin and two hits could form stable systems. Meanwhile, the mechanism of the interactions between tubulin and two hits at simulated physiological conditions were probed. The in vitro tubulin polymerization assay revealed hits 19 and 38 were able to promote tubulin polymerization in a dose-dependent manner. Further, the immunofluorescence assay suggested that hits 19 and 38 could accelerate microtubule assembly in A549 and HeLa cells. Finally, studies on antitumor activity indicated that hits 19 and 38 induced G2/M phase cell cycle arrest and apoptosis, and inhibited cancer cell motility and migration in A549 and HeLa cells. Importantly, hit38 exhibited better anti-tubulin and anti-cancer activity than hit19 in A549 and HeLa cells. Therefore, these results suggest that hit38 represents a promising microtubule stabilizer for treating cancer and deserves further investigation.

Positive regulation of the MarR-type regulator slnO and improvement of salinomycin production by Streptomyces albus by multiple transcriptional regulation.

The purpose of this study was to explore the function of the MarR family regulator slnO. Additionally, a high-yield strain of salinomycin was constructed using combined regulation strategies. First, the slnO gene overexpression strain (GO) was constructed in Streptomyces albus. Compared to the wild-type (WT) strain, salinomycin production in the GO strain increased by approximately 28%. Electrophoretic mobility gel shift assays (EMSAs) confirmed that the SlnO protein can bind specifically to the intergenic regions of slnN-slnO, slnQ-slnA1, and slnF-slnT. qRT-PCR experiments also showed that slnA1, slnF, and slnT1 were significantly upregulated, whereas the expression level of the slnN gene was downregulated in the GO strain. Second, the slnN gene deletion strain (slnNDM) was used as the starting strain, and the pathway-specific gene slnR in the salinomycin gene cluster was overexpressed in slnNDM. This new strain was named ZJUS01. The yield of salinomycin in the ZJUS01 strain was 25% and 56% higher than those in the slnNDM and WT strains, respectively. The above results indicate that the slnO gene has a positive regulatory effect on the biosynthesis of salinomycin. Meanwhile, the yield of salinomycin can be greatly increased by manipulating multiple transcriptional regulations.

First report of the root-knot nematode Meloidogyne incognita on Salvia miltiorrhiza Bunge in Henan Province, China.

Salvia miltiorrhiza Bunge is an important Chinese herbal medicine, mainly used to treat cardiovascular disease. At present, the planting area of S. miltiorrhiza is near 20,000 hectares in China, mainly in Shandong, Henan, Shanxi, Shaanxi and Sichuan provinces. Root-knot nematode (Meloidogyne spp.) is one of the most devastating pathogens on S. miltiorrhiza. In November 2020, we observed that some S. miltiorrhiza plants grew poorly with smaller, fewer and chlorotic leaves and even necrosis on some middle and lower ones in a Chinese herbal medicine planting base (34° 4' 11.52'' N; 113° 25' 51.40'' E) in Yuzhou City, Henan Province, China. Furthermore, the galls and egg masses were visible on the roots of S. miltiorrhiza, which were the typical symptoms caused by root-knot nematodes. Ten samples of galled roots and rhizosphere soils were collected, bagged and taken to the lab for tests. Females and J2s were extracted from these samples. White, pear-shaped females were observed in the roots, and the average number of second-stage juveniles (J2s) was 121.5 ± 10.8 per 100 ml of soil. The perineal patterns of females showed a high dorsal arch, which was either square or trapezoid with either smooth or wavy striae and without obvious lateral lines. The main morphometrics of females (n=20, mean ± SE; range) were as follows: body length (L)  = 609.0  ±â€¯ 62.5 µm (492.4 to 716.4 µm); maximum body width (W) = 377.0  ±â€¯ 28.6 µm (329.7 to 436.1 µm); stylet length  =  17.0  ±â€¯ 1.8 µm (14.2 to 20.5 µm); and distance from dorsal esophageal gland orifice to stylet knobs (DGO) =  3.3  ±â€¯ 0.3 µm (2.8 to 3.9 µm). The J2s were in vermiform, and stylet knobs were prominent and rounded. The tail of J2s possessed a transparent area with an obtuse tip. J2s (n  =  20) were measured (mean ± SD; range) as follows: L  =  401.2  ±â€¯ 29.3 µm (358.2 to 456.1 µm); W = 14.1 ± 1.1 µm (12.5 to 16.0 µm); L/W  = 28.6  ±â€¯ 1.0 (26.7 to 30.4); stylet length =  10.3  ±â€¯ 0.6 µm (9.1 to 11.2 µm); DGO  =  2.4  ±â€¯ 0.1 µm (2.1 to 2.6 µm); and tail length  =  49.3  ± 2.8 µm (45.2 to 54.7 µm). All the key morphometrics were similar to those of the M. incognita population described by Song et al. (2019). The PCR amplifications of rDNA-internal transcribed spacer (ITS) fragments generated an amplicon of 544 bp from a single female or/and J2s (n = 22) using the universal primers M18S (5'-AACCTGCTGCTGGATCATTAC-3') and M28S (5'-GTATGCTTAAGTTCAGCG-3') (Feng et al. 2010). The PCR amplifications were repeated five times for each sample, and the products were purified and sequenced. The obtained sequnce was deposited in GenBank with Acc. No. OM304617.1. The amplified ITS region sequence was identical to those of M. incognita from India (KT869139.1) and China (MT490926.1 and MT071559.1). For confirmation, the primers species-specific for M. incognita (Inc-K14-F, 5'- GGGATGTGTAAATGCTCCTG -3' and Inc-K14-R, 5'- CCCGCTACACCCTCAACTTC -3') were further used for amplification. Expected PCR amplicon of 399 bp was acquired, which was consistent with previous report for M. incognita (Randig et al. 2002). Pathogenicity and reproduction of this M. incognita population on S. miltiorrhiza was confirmed and examined. Seeds of S. miltiorrhiza were sown in the pots filled with 200 ml of autoclaved soil mixture (loamy soil/sand, 1:1). Two weeks later, a total of 12 plants were inoculated each with 400 J2s, which were hatched from a field-derived M. incognita population. Four plants without nematode inoculation were used as the control. The plants grew in a chamber at 25/30 °C under 12-h dark/12-h light conditions. The parasitic J2s, J3s, J4s and females in roots were observed under a stereomicroscope at 5, 15 and 30 days post inoculation (dpi). At 35 dpi, an average of 98.3 ± 15.7 galls and 23.8 ± 6.9 egg masses per S. miltiorrhiza plant were counted, and the root gall index reached 6 according to the 0-10 RKN rating scale (Poudyal et al. 2005). Nematodes were re-isolated from the roots and their morphological and molecular characteristics were identical to the nematodes obtained from the original samples. Furthermore, all the inoculated S. miltiorrhiza roots showed typical RKN galls with the same symptoms as those initially observed in the field. No symptoms were developed on the non-inoculated control plants, and from which no nematodes were isolated. The nematode on S. miltiorrhiza was therefore certified as M. incognita. Han et al. (2019) isolated and morphologically identified M. incognita from the roots of S. miltiorrhiza and Trichosanthes kirilowii Maximin in Changqing area of Shandong Province, China, but did not perform the Koch's Rule. To our knowledge, this is the first formal report of M. incognita infecting S. miltiorrhiza in Henan Province, China. With the increase of Chinese herbal medicine planting area, plant parasitic nematodes are becoming more and more serious and have become an limiting factor on medicinal plant production, and the yield losses can be as high as 70%. This finding provides important and solid information for growers of Chinese medicinal plants, based on which suitable management action should be taken.