Somatic and germline mutations in the tumor suppressor gene PARK2 impair PINK1/Parkin-mediated mitophagy in lung cancer cells.

PARK2, which encodes Parkin, is a disease-causing gene for both neurodegenerative disorders and cancer. Parkin can function as a neuroprotector that plays a crucial role in the regulation of mitophagy, and germline mutations in PARK2 are associated with Parkinson's disease (PD). Intriguingly, recent studies suggest that Parkin can also function as a tumor suppressor and that somatic and germline mutations in PARK2 are associated with various human cancers, including lung cancer. However, it is presently unknown how the tumor suppressor activity of Parkin is affected by these mutations and whether it is associated with mitophagy. Herein, we show that wild-type (WT) Parkin can rapidly translocate onto mitochondria following mitochondrial damage and that Parkin promotes mitophagic clearance of mitochondria in lung cancer cells. However, lung cancer-linked mutations inhibit the mitochondrial translocation and ubiquitin-associated activity of Parkin. Among all lung cancer-linked mutants that we tested, A46T Parkin failed to translocate onto mitochondria and could not recruit downstream mitophagic regulators, including optineurin (OPTN) and TFEB, whereas N254S and R275W Parkin displayed slower mitochondrial translocation than WT Parkin. Moreover, we found that deferiprone (DFP), an iron chelator that can induce mitophagy, greatly increased the death of A46T Parkin-expressing lung cancer cells. Taken together, our results reveal a novel mitophagic mechanism in lung cancer, suggesting that lung cancer-linked mutations in PARK2 are associated with impaired mitophagy and identifying DFP as a novel therapeutic agent for PARK2-linked lung cancer and possibly other types of cancers driven by mitophagic dysregulation.

Astrocytic N-Myc Downstream-regulated Gene-2 Is Involved in Nuclear Transcription Factor κB-mediated Inflammation Induced by Global Cerebral Ischemia.

BACKGROUND: Inflammation is a key element in the pathophysiology of cerebral ischemia. This study investigated the role of N-Myc downstream-regulated gene-2 in nuclear transcription factor κB-mediated inflammation in ischemia models. METHODS: Mice (n = 6 to 12) with or without nuclear transcription factor κB inhibitor pyrrolidinedithiocarbamate pretreatment were subjected to global cerebral ischemia for 20 min. Pure astrocyte cultures or astrocyte-neuron cocultures (n = 6) with or without pyrrolidinedithiocarbamate pretreatment were exposed to oxygen-glucose deprivation for 4 h or 2 h. Astrocytic nuclear transcription factor κB and N-Myc downstream-regulated gene-2 expression, proinflammatory cytokine secretion, neuronal apoptosis and survival, and memory function were analyzed at different time points after reperfusion or reoxygenation. Proinflammatory cytokine secretion was also studied in lentivirus-transfected astrocyte lines after reoxygenation. RESULTS: Astrocytic nuclear transcription factor κB and N-Myc downstream-regulated gene-2 expression and proinflammatory cytokine secretion increased after reperfusion or reoxygenation. Pyrrolidinedithiocarbamate pretreatment significantly reduced N-Myc downstream-regulated gene-2 expression and proinflammatory cytokine secretion in vivo and in vitro, reduced neuronal apoptosis induced by global cerebral ischemia/reperfusion (from 65 ± 4% to 47 ± 4%, P = 0.0375) and oxygen-glucose deprivation/reoxygenation (from 45.6 ± 0.2% to 22.0 ± 4.0%, P < 0.001), and improved memory function in comparison to vehicle-treated control animals subjected to global cerebral ischemia/reperfusion. N-Myc downstream-regulated gene-2 lentiviral knockdown reduced the oxygen-glucose deprivation-induced secretion of proinflammatory cytokines. CONCLUSIONS: Astrocytic N-Myc downstream-regulated gene-2 is up-regulated after cerebral ischemia and is involved in nuclear transcription factor κB-mediated inflammation. Pyrrolidinedithiocarbamate alleviates ischemia-induced neuronal injury and hippocampal-dependent cognitive impairment by inhibiting increases in N-Myc downstream-regulated gene-2 expression and N-Myc downstream-regulated gene-2-mediated inflammation.

1α,25(OH)2D3 Suppresses the Migration of Ovarian Cancer SKOV-3 Cells through the Inhibition of Epithelial-Mesenchymal Transition.

Ovarian cancer is the most lethal gynecological malignancy due to its high metastatic ability. Epithelial-mesenchymal transition (EMT) is essential during both follicular rupture and epithelium regeneration. However, it may also accelerate the progression of ovarian carcinomas. Experimental studies have found that 1α,25-dihydroxyvitamin-D3 [1α,25(OH)2D3] can inhibit the proliferation of ovarian cancer cells. In this study, we investigated whether 1α,25(OH)2D3 could inhibit the migration of ovarian cancer cells via regulating EMT. We established a model of transient transforming growth factor-ß1(TGF-ß1)-induced EMT in human ovarian adenocarcinoma cell line SKOV-3 cells. Results showed that, compared with control, 1α,25(OH)2D3 not only inhibited the migration and the invasion of SKOV-3 cells, but also promoted the acquisition of an epithelial phenotype of SKOV-3 cells treated with TGF-ß1. We discovered that 1α,25(OH)2D3 increased the expression of epithelial marker E-cadherin and decreased the level of mesenchymal marker, Vimentin, which was associated with the elevated expression of VDR. Moreover, 1α,25(OH)2D3 reduced the expression level of transcription factors of EMT, such as slug, snail, and ß-catenin. These results indicate that 1α,25(OH)2D3 suppresses the migration and invasion of ovarian cancer cells by inhibiting EMT, implying that 1α,25(OH)2D3 might be a potential therapeutic agent for the treatment of ovarian cancer.

Circulating 25-hydroxyvitamin D and risk of lung cancer: a dose-response meta-analysis.

BACKGROUND: Mounting experimental evidence supports a protective effect of high 25-hydroxyvitamin D (25[OH]D), a good indicator of vitamin D status, on risk of various cancers including lung cancer. However, prospective observational studies examining the 25(OH)D-lung cancer association reported inconsistent findings. A dose-response meta-analysis was carried out to elucidate the subject. METHODS: Potentially eligible studies were identified by searching PubMed and EMBASE databases, and by carefully reviewing the bibliographies of retrieved publications. The summary relative risks (RRs) with 95% confidence intervals (CIs) were calculated using the random-effects model. RESULTS: Thirteen reports from ten prospective studies were included, totaling 2,227 lung cancer events. Results of the meta-analysis showed a significant 5% (RR 0.95, 95% CI 0.91-0.99) reduction in the risk of lung cancer for each 10 nmol/L increment in 25(OH)D concentrations. This inverse association was not significantly modified by area, study duration, sex, methods for 25(OH)D measurement, baseline 25(OH)D levels, or quality score of included studies. There was evidence of a nonlinear relationship between 25(OH)D and risk of lung cancer (p-nonlinearity = 0.02), with the greatest reductions in risk observed at 25(OH)D of nearly 53 nmol/L, and remained protective until approximately 90 nmol/L. Further increases showed no significant association with cancer risk, but scanty data were included in the analyses of high-level 25(OH)D. There was no evidence of publication bias. CONCLUSION: This dose-response meta-analysis of prospective studies suggests that 25(OH)D may be associated with reduced risk of lung cancer, in particular among subjects with vitamin D deficiencies.

GPR50 regulates neuronal development as a mitophagy receptor.

Neurons rely heavily on high mitochondrial metabolism to provide sufficient energy for proper development. However, it remains unclear how neurons maintain high oxidative phosphorylation (OXPHOS) during development. Mitophagy plays a pivotal role in maintaining mitochondrial quality and quantity. We herein describe that G protein-coupled receptor 50 (GPR50) is a novel mitophagy receptor, which harbors the LC3-interacting region (LIR) and is required in mitophagy under stress conditions. Although it does not localize in mitochondria under normal culturing conditions, GPR50 is recruited to the depolarized mitochondrial membrane upon mitophagy stress, which marks the mitochondrial portion and recruits the assembling autophagosomes, eventually facilitating the mitochondrial fragments to be engulfed by the autophagosomes. Mutations Δ502-505 and T532A attenuate GPR50-mediated mitophagy by disrupting the binding of GPR50 to LC3 and the mitochondrial recruitment of GPR50. Deficiency of GPR50 causes the accumulation of damaged mitochondria and disrupts OXPHOS, resulting in insufficient ATP production and excessive ROS generation, eventually impairing neuronal development. GPR50-deficient mice exhibit impaired social recognition, which is rescued by prenatal treatment with mitoQ, a mitochondrially antioxidant. The present study identifies GPR50 as a novel mitophagy receptor that is required to maintain mitochondrial OXPHOS in developing neurons.

Effects of high-protein diets on body weight, glycaemic control, blood lipids and blood pressure in type 2 diabetes: meta-analysis of randomised controlled trials.

High-protein diets are popular for weight management, but the health effects of such diets in diabetic persons are inconclusive. The aim of the present meta-analysis was to examine the effects of high-protein diets on body weight and metabolic risk factors in patients with type 2 diabetes. We searched the PubMed and Cochrane Library databases for relevant randomised trials up to August 2012. Either a fixed- or a random-effects model was used to combine the net changes in each outcome from baseline to the end of the intervention. Overall, nine trials including a total of 418 diabetic patients met our inclusion criteria. The study duration ranged from 4 to 24 weeks. The actual intake of dietary protein ranged from 25 to 32% of total energy in the intervention groups and from 15 to 20% in the control groups. Compared with the control diets, high-protein diets resulted in more weight loss (pooled mean difference: 22.08, 95% CI 23.25, 20.90 kg). High-protein diets significantly decreased glycated Hb A1C (HbA1C) levels by 0.52 (95% CI 20.90, 20.14) %, but did not affect the fasting blood glucose levels. There were no differences in lipid profiles. The pooled net changes in systolic and diastolic blood pressure were 23.13 (95% CI 26.58, 0.32)mmHg and 21.86 (95% CI 24.26, 0.56) mmHg, respectively. However, two studies reported a large influence on weight loss and HbA1C levels, respectively. In summary, high-protein diets (within 6 months) may have some beneficial effects on weight loss, HbA1C levels and blood pressure in patients with type 2 diabetes. However, further investigations are still required to draw a conclusion.

[Effect of soluble PD-L1 released by lung cancer cells in regulating the function of T lymphocytes].

OBJECTIVE: To explore the expression of soluble programmed death ligand-1 on lung cancer cells and to clarify its biological function through PD-1/PD-L1 pathway in regulating the function of T lymphocytes. METHODS: Labeled monoclonal antibody and flow cytometry were used to analyze the expression of PD-L1 and its receptor PD-l on lung cancer cells and human T lymphocytes, respectively. The level of sPD-L1 in the supernatant of lung cancer cells was determined with an ELISA kit. The inhibition of proliferation of T lymphocytes by mPD-L1 and sPD-L1 was studied using CCK-8 incorporation. RESULTS: Low or no expression [(16.08 ± 2.28)%] of PD-1 was found on resting T lymphocytes from human peripheral blood with flow cytometry, but up-regulated expression of PD-1 [(78.06 ± 7.21)%] was found on the surface of activated T lymphocytes. Soluble PD-L1 was found in supernatant of some lung cancer cell lines, such as H1299, HO8910, SPCA-1, H460, H446 cells, with PD-L1 expressing on their cell surface [(78.34 ± 10.25)%, (68.17 ± 11.56)%, (45.32 ± 7.98)%, (47.52 ± 9.62)% and (40.95 ± 8.56)%, respectively], but very low expression on A549 cells [(16.02 ± 6.28)%]. The level of mPD-L1 on H1299 cells was highest [(78.34 ± 10.25)%], compared with HO8910 cells (68.17 ± 11.56)%, SPCA-1 cells (45.32 ± 7.98)%, H446 cells (40.95 ± 8.56)%, and H460 cells (47.52 ± 9.62)%. At the same time, the sPD-L1 level on H1299 cells was low [(0.17 ± 0.01) ng/ml], compared with HO8910 cells (0.30 ± 0.03) ng/ml, SPCA-1cells (0.59 ± 0.03) ng/ml, H446 cells (0.34 ± 0.02) ng/ml, and H460 cells (0.57 ± 0.03) ng/ml, but not expressed on A549 cells. PD-L1 expressing H1299 cells inhibited the proliferation of T lymphocytes in the co-culture system. Supernatant of the cultured PD-L1(+) lung cancer cells also inhibited T cell proliferation. Anti-human PD-L1 blocking antibody could partly restore the proliferation capacity of T lymphocytes. CONCLUSIONS: Membrane-bound PD-L1 and soluble PD-L1 released from lung cancer cells can effectively inhibit the proliferation of T lymphocytes in mixed culture system and down-regulate cell-mediated immunity in vitro. This may lead to inactivation of tumor antigen-specific T cells and immune escape of lung cancer cells.

Early surgical treatment of closed reduction and internal fixation for a 30-day old intertrochanteric fracture with hemiplegia after acute stroke: A case report.

RATIONALE: Currently, there are no clear guidelines to determine whether and when to perform surgical hip repair in patients with acute stroke and hip fracture. PATIENT CONCERNS: In this case report, we report a case of 75-year-old woman admitted with left hip pain and limited mobility for 1 month. DIAGNOSES: Patient had a history of acute cerebral infarction 42 days ago, and diagnosed with a left intertrochanteric fracture at another hospital 30 days ago. INTERVENTION: Patient was treated with closed reduction and internal fixation with proximal femoral nail anti-rotation. OUTCOMES: At 2-year follow-up, the patient's basic function was restored. The fracture healed well, and the Harris hip score was 75. LESSONS: Without consistent guidelines, individualized treatment strategies including surgical methods and timing of surgery should be made to weigh the risks and benefits for patients with acute stroke and intertrochanteric fractures.

Dietary fats and serum lipids in relation to the risk of ovarian cancer: a meta-analysis of observational studies.

Although numerous epidemiological studies investigated the association between dietary fat intakes or serum lipid levels and ovarian cancer risk, a consistent and explicit conclusion for specific dietary fats or serum lipids that increase the risk of ovarian cancer is not available. In this study, a systematic review and meta-analysis were conducted to assess the key dietary fats and serum lipids that increased the risk of ovarian cancer. Databases such as PubMed, Web of Science, and EMBASE were searched for observational studies. A total of 41 studies met the inclusion criteria, including 18 cohort and 23 case-control studies (109,507 patients with ovarian cancer and 2,558,182 control/non-ovarian cancer participants). Higher dietary intakes of total fat (RR = 1.19, 95% CI = 1.06-1.33, I2 = 60.3%), cholesterol (RR = 1.14, 95% CI = 1.03-1.26, I2 = 19.4%), saturated fat (RR = 1.13, 95% CI = 1.04-1.22, I2 = 13.4%), and animal fat (RR = 1.21, 95% CI = 1.01-1.43, I2 = 70.5%) were significantly associated with a higher risk of ovarian cancer. A higher level of serum triglycerides was accompanied by a higher risk of ovarian cancer (RR = 1.33, 95% CI = 1.02-1.72, I2 = 89.3%). This meta-analysis indicated that a higher daily intake of total fat, saturated fat, animal fat, and cholesterol and higher levels of serum triglycerides were significantly associated with an increased risk of ovarian cancer.

Effect of vitamin D3 supplementation in winter on physical performance of university students: a one-month randomized controlled trial.

BACKGROUND: There is epidemiological evidence which suggests an association between 25-hydroxyvitamin D [25(OH)D] levels and bone and muscle function; however, it is unclear whether vitamin D supplementation has an added benefit beyond bone health. Here, we investigated the effects of vitamin D3 supplementation (1 month) on physical performance in Chinese university students in winter. METHODS: One hundred and seventeen eligible subjects with 25(OH)D (19.2 ± 7.8 ng/mL) were randomly assigned to either vitamin D3 supplement (N = 56; 1000 IU/day) or the control (N = 61) group for 1 month. Pre- and post-measurements included: 1) serum levels of 25(OH)D; 2) musculoskeletal and pulmonary function [vertical jump height (VJH) and right handgrip strength (RHS), forced vital capacity (FVC), and forced expiratory volume at 1s (FEV1)]; 3) bone turnover markers [parathyroid hormone (PTH), n-terminal osteocalcin (N-MID), and calcium]; 4) hemoglobin-related parameters [hemoglobin (Hb), hematocrit (HCT), red blood cells (RBC), and red cell distribution width (RDW)]; 5) lipid parameters [total triglycerides (TG), total cholesterol (TC), high-density lipoprotein cholesterol (HDL-C), and low-density lipoprotein cholesterol (LDL-C)]; 6) Fatigue-related indicators [serum creatine kinase (CK), lactate dehydrogenase (LDH), and total testosterone (T)]. In addition, aerobic capacity was assessed by measuring maximal oxygen uptake (VO2max) at baseline. RESULTS: During wintertime, supplementation with 1000 IU/d of vitamin D3 significantly increased serum 25(OH)D levels (from 18.85 ± 7.04 to 26.98 ± 5.88 ng/mL, p < 0.05), accompanied by a decrease of PTH (p < 0.05). However, vitamin D3 supplementation did not significantly impact the physical performance, serum lipid parameters, and bone turnover markers of students. Furthermore, 25(OH)D was found to be positively correlated with VJH and negatively correlated with PTH and TC at the beginning and end of the study (p < 0.05). In addition, the multiple linear regression analysis showed that 25(OH)D combined with athletic, gender, height, weight, Hb, and FVC could account for 84.0% of the VO2max value. CONCLUSIONS: The study demonstrated that one-month of 1000 IU/d of vitamin D3 supplementation during the winter had beneficial effects on 25(OH)D status and PTH. However, vitamin D3 intervention was not sufficient to improve physical performance. Furthermore, 25(OH)D levels combined with athletic, Hb and FVC could be a predictor of VO2max.

[The effect of ferric ion on the differentiation of osteoclast and bone resorption].

OBJECTIVE: To explore the effects of ferric ion on the differentiation from both RAW264.7 and bone marrow macrophages to osteoclast in vitro and bone resorption in vivo. METHODS: In the presence of 50 ng/ml receptor activator of nuclear factor kappa-B ligand (RANKL), RAW264.7 was treated with ferric ammonium citrate (FAC). The formation of osteoclast was observed by staining of tartrate-resistant acid phosphatase (TRAP) and the TRAP positive cell counted. The expression levels of TRAP, cathepsin-K, nuclear factor of activated T cells c1 (NFATc1) and (receptor activator of NF-κB) RANK were measured by reverse transcription-polymerase chain reaction (RT-PCR).The control and iron overload groups were established by the intraperitoneal injection of normal saline and FAC. In vivo imaging system was employed to determine the bone density of femoral midportion and the fourth lumbar vertebra. After that, the bone marrow cells of femurs were used for osteoclast culture. The serum levels of ferritin, TRAP-5b, RANKL, osteoprotegerin (OPG) and C-terminal cross-linking telopeptide (CTX) were measured by enzyme-linked immunosorbent assay (ELISA). RESULTS: Ferric ion could stimulate the formation of TRAP positive cells in a dose-dependent manner. The expression levels of TRAP, cathepsin-K and NFATc1 in the FAC treated group were significantly higher those of the control group (P < 0.05) while the expression of RANK showed no statistical difference among these groups (P = 0.967). The bone marrow density of femoral midportion and the fourth lumbar vertebra of the iron-overload group decreased significantly versus the control group. The concentrations of ferritin, TRAP-5b, RANKL and CTX of the iron overload group were markedly higher than those of the control group (P < 0.05). Moreover, the concentration of ferritin showed a positive correlation with TRAP-5b and CTX respectively in the iron-overload group (r = 0.65, r = 0.76, P < 0.05). But no significant differences existed in the concentration of OPG for two groups (P > 0.05). CONCLUSION: Ferric ion may enhance the differentiation of osteoclast in vitro as well as bone resorption in vivo.

[The level of soluble programmed death-1 in peripheral blood of patients with lung cancer and its clinical implications].

OBJECTIVE: To analyze the expression of soluble programmed death-1 ligand 1 (sPD-L1) in the serum of patients with lung cancer and to explore its biological and clinical implications. METHODS: Fifty-five male and twenty-six female lung cancer patients ages 34 to 87 years (mean age 65 ± 6) were selected from the Department of Respiratory Diseases in The Second Affiliated Hospital of Soochow University from June 2009 to March 2011. All lung cancer patients were newly-diagnosed, treatment-free and confirmed by histopathology or cytopathology. Eight-eight healthy volunteers matching in sex and age from the Healthcare Center of the hospital were also enrolled as controls. The sPD-L1 protein expression in serum was determined by Western blot and self-developed ELISA kit. Fluorescence-labeled monoclonal antibody and cytometry were used to examine changes in lymphocyte subsets in the peripheral blood of lung cancer patients and healthy controls. RESULTS: A higher level of sPD-L1 level in the lung cancer patients [1.6 (0.7 - 7.8) µg/L] was found compared to the control group [0.9 (0.4 - 3.7) µg/L] (P < 0.001). High expression of sPD-L1 in the lung cancer patients was closely correlated to lymph node metastasis and the extent of distant metastasis (χ(2) = 5.636, P < 0.05; χ(2) = 4.601, P < 0.05). The sPD-L1 level in lung cancer patients with objective response to treatment (complete response + partial response) was 2.7 (1.6 - 7.0) µg/L and 1.1 (0.8 - 1.7) µg/L before and after treatment, respectively (P < 0.01). The level of sPD-L1 with progression disease was 1.9 (1.3 - 8.5 µg/L) which was significantly increased compared to the baseline level 1.4 (0.8 - 2.2) µg/L (P < 0.01). Additionally, abnormal changes of T and B lymphocytes and their subsets were found, with a significant decrease of CD(8)(+) T lymphocytes (P < 0.05) and a rise in CD(4)/CD(8) ratio (P < 0.05). Further double-labeling study showed increased percentages of CD(4)(+)PD-1(+) T lymphocytes and CD(8)(+)PD-1(+) T lymphocytes (P < 0.05). CONCLUSIONS: The elevated expression of sPD-L1 in lung cancer patients was closely related to lung cancer staging, metastasis and clinical response. sPD-L1 may become a predictive marker and an important anti-tumor target in individualized treatment of lung cancer.

Partial rescue of the phenotype in 1α-hydroxylase gene knockout mice by vitamin D3 injection.

OBJECTIVE: To investigate whether 25-hydroxyvitamin D [25(OH)D] can mediate effects without being converted to 1α,25-dihydroxyvitamin D [1,25(OH)2D]. METHODS: Vitamin D3 (VD3) was injected intramuscularly to 25-hydroxyvitamin D-1α-hydroxylase [1α(OH)ase] gene knockout (KO) male mice with a dose of 10,000 IU per week for 4 weeks. Skeleton Parameters and Serum biochemistry in mice were assayed. RESULTS: Serum 25(OH)D3 levels increased from 41 to 212 ng/mL in KO mice injected with VD3. Our results show that VD3 injections significantly increased the body weight of KO mice and there were no significant differences in body weight at 7 weeks of age between VD3-treated KO mice and wildtype (WT) mice. After 1 month injection, serum calcium and phosphorus levels of the KO mice were found indistinguishable from those of their WT littermates. Serum parathyroid hormone level declined significantly, but remained higher in treated KO mice. The dry weight, percentage ash weight, and calcium content of femur were returned to normal levels in VD3-treated KO mice whereas the femoral length, although increased significantly, remained significantly smaller than that of WT mice. VD3 injections also normalized the growth plate of KO mice within normal width. CONCLUSIONS: Our results demonstrate that high-dose VD3 injections can partially rescue the phenotype in 1α-hydroxylase gene KO mice. 25-Hydroxyvitamin D can mediate effects in the absence of conversion to 1α,25-dihydroxyvitamin D was confirmed in this study.

Genome-wide association study reveals novel loci for adult type 1 diabetes in a 5-year nested case-control study.

BACKGROUND: Type 1 diabetes (T1D) is a severe and prevalent metabolic disease. Due to its high heredity, an increasing number of genome-wide association studies have been performed, most of which were from hospital-based case-control studies with a relatively small sample size. The association of single nucleotide polymorphisms (SNPs) and T1D has been less studied and is less understood in natural cohorts. AIM: To investigate the significant variants of T1D, which could be potential biomarkers for T1D prediction or even therapy. METHODS: A genome-wide association study (GWAS) of adult T1D was performed in a nested case-control study (785 cases vs 804 controls) from a larger 5-year cohort study in Suzhou, China. Potential harmful or protective SNPs were evaluated for T1D. Subsequent expression and splicing quantitative trait loci (eQTL and sQTL) analyses were carried out to identify target genes modulated by these SNPs. RESULTS: A harmful SNP for T1D, rs3117017 [odds ratio (OR) = 3.202, 95% confidence interval (CI): 2.296-4.466, P = 9.33 × 10-4] and three protective SNPs rs55846421 (0.113, 0.081-0.156, 1.76 × 10-9), rs75836320 (0.283, 0.205-0.392, 1.07 × 10-4), rs362071 (0.568, 0.495-0.651, 1.66 × 10-4) were identified. Twenty-two genes were further identified as potential candidates for T1D onset. CONCLUSION: We identified a potential genetic basis of T1D, both protective and harmful, using a GWAS in a larger nested case-control study of a Chinese population.

[Analysis of expression profiles of some tumor growth-related genes after silencing of pleiotrophin in human small cell lung cancer H446 cells].

OBJECTIVE: To investigate the changes in expression profiles of angiomotin (Amot), schlafen5 (Slfn5), metalloproteinase-9 (MMP-9) and vascular endothelial cell growth factor (VEGF), which are genes associated with angiogenesis, tumor growth and invasion, after gene silencing of pleiotrophin (PTN) in human small cell lung cancer H446 cells. METHODS: PTN expression in H446 cells was determined by RT-PCR and Western blot. After constructing a lentiviral vector interfering PTN expression, it was packaged into virus in 293T cells. Then the virus was used to infect human small cell lung cancer H446 cells. The expressions of Amot, Slfn5, MMP-9 and VEGF were detected by RT-PCR in normal non-interference group, negative control group, PTN-interference group and group combining PTN interference and chemotherapy. RESULTS: The results of RT-PCR and Western blot test showed that PTN expression in H446 cells was high. The interference efficiency of constructed ShRNA sequences (GCAGCTGTGGATACTGCTGAA) targeting PTN was as high as 72.1% and 59.2% at the mRNA and protein levels, respectively, in H446 cells. Compared with the negative control group, the expressions of Slfn5 and MMP-9 in H446 cells were increased by 165.1% and 47.3%, while the ones of Amot and VEGF were down-regulated by 33.1% and 26.6%, respectively, after gene silencing of PTN. The changes of gene expression profile became more evident when chemotherapy was superimposed on PTN interference. CONCLUSION: Gene silencing of PTN using siRNA lentiviral expressing vector can influence the expression of proliferation and metastasis-related genes in human small cell lung cancer H446 cells.

The effects of dimethylformamide exposure on liver and kidney function in the elderly population: A cross-sectional study.

Dimethylformamide (DMF) is widely used as a solvent in the production of synthetic leather. Previous studies have focused on workers exposed to DMF in leather factories; however, little attention has been paid to the general population. This study was conducted to examine the effects of DMF exposure on elderly residents living near synthetic leather factories. A total of 962 subjects over 60 years of age in proximity to these factories (monitoring points) were enrolled as the exposure group, and 1924 permanent residents living distant from the factories were enrolled as the control group. The exposure group was divided into 3 groups according to their distance from the monitoring points. Physical examination, routine blood tests, and liver and renal function data were collected, and the DMF concentration in the air was analyzed by gas chromatography-mass spectroscopy. The prevalence of abnormal heart rhythm, electrocardiogram and B-mode ultrasound results in the exposure group was significantly greater than in the control group. Aspartate transaminase (AST), alanine transaminase (ALT), and blood urea nitrogen (BUN) levels in the exposure group also were higher than those in the control group (P < .01). There was an effect of distance from leather factories on liver and kidney dysfunction in the 3 exposure groups. Compared with the exposure group at >3 km distance from the source, the prevalence of increased AST, ALT, and BUN in the exposure group at <1 km was significantly greater (P < .001). It was concluded that DMF exposure was related to an increased risk of a cardiac injury and liver and kidney dysfunction.

1α,25(OH)2D3 Radiosensitizes Cancer Cells by Activating the NADPH/ROS Pathway.

The radioresistance of tumors affect the outcome of radiotherapy. Accumulating data suggest that 1α,25(OH)2D3 is a potential anti-oncogenic molecule in various cancers. In the present study, we investigated the radiosensitive effects and underlying mechanisms of 1α,25(OH)2D3 in vitro and in vivo. We found that 1α,25(OH)2D3 enhanced the radiosensitivity of lung cancer and ovarian cancer cells by promoting the NADPH oxidase-ROS-apoptosis axis. Compared to the group that only received radiation, the survival fraction and self-renewal capacity of cancer cells treated with a combination of 1α,25(OH)2D3 and radiation were decreased. Both apoptosis and ROS were significantly increased in the combination group compared with the radiation only group. Moreover, N-acetyl-L-cysteine, a scavenger of intracellular ROS, reversed the apoptosis and ROS induced by 1α,25(OH)2D3, indicating that 1α,25(OH)2D3 enhanced the radiosensitivity of cancer cells in vitro by promoting ROS-induced apoptosis. Moreover, our results demonstrated that 1α,25(OH)2D3 promoted the ROS level via activating NADPH oxidase complexes, NOX4, p22phox, and p47phox. In addition, knockdown of the vitamin D receptor (VDR) abolished the radiosensitization of 1α,25(OH)2D3, which confirmed that 1α,25(OH)2D3 radiosensitized tumor cells that depend on VDR. Similarly, our study also evidenced that vitamin D3 enhanced the radiosensitivity of cancer cells in vivo and extended the overall survival of mice with tumors. In summary, these results demonstrate that 1α,25(OH)2D3 enhances the radiosensitivity depending on VDR and activates the NADPH oxidase-ROS-apoptosis axis. Our findings suggest that 1α,25(OH)2D3 in combination with radiation enhances lung and ovarian cell radiosensitivity, potentially providing a novel combination therapeutic strategy.

Evaluation of the association between urinary cadmium levels below threshold limits and the risk of diabetes mellitus: a dose-response meta-analysis.

As cadmium levels are increasing in the environment, the adverse effects of cadmium exposure specifically associated with chronic diseases are receiving increasing attention. Several population-based studies have been conducted on the association between cadmium and diabetes mellitus (DM) but have reported controversial results. Here, we aimed to evaluate the association between cadmium exposure and DM. In this meta-analysis, a random effects model was used because there was evidence of heterogeneity among studies. A dose-response relationship was assessed through a restricted cubic spline model with three knots. The results showed a positive association between cadmium levels in the body and DM (OR = 1.27; 95% CI, 1.07-1.52). The cadmium levels in the body were defined on the basis of combined urinary and blood cadmium. Subgroup analysis further indicated a positive association between urinary cadmium levels and DM (OR = 1.31; 95% CI, 1.02-1.69). The dose-response analysis results showed a positive association between levels of urinary cadmium above 2.43 µg/g creatinine and DM, and the risk of DM increased by 16% for each l µg/g creatinine increase in urinary cadmium levels. The results from our meta-analysis indicate that cadmium levels in the body are positively associated with DM, and urinary cadmium levels above 2.43 µg/g creatinine are associated with an increased risk of DM.

The Relationship between Maternal Serum Vitamin D Levels and Infant Neurodevelopment and Anthropometry: A Prospective Observational Study.

This study was designed to determine whether there is a relationship between serum vitamin D levels and neurodevelopment and anthropometry in Chinese infants. A prospective cohort study with 160 women who gave birth to 160 healthy full-term infants and who were followed up for 6 mo was done. It included 80 pregnant women with vitamin D deficiency, and the other 80 pregnant women were enrolled matching the age and delivery method with a 25(OH)D level of more than 50 nmol/L. There was a signicant intergroup difference in length, weight or head circumference at birth (p<0.05). Meanwhile, there was a signicant intergroup difference in cognitive development and achievement at 6 mo (p<0.001). In multivariate analyses, maternal 25(OH)D levels less than 50 nmol/L were independently associated with a higher tendency for a low Bayley mental score (MDI) at 6 mo (OR=2.77, 95% CI: 1.44-5.35, p=0.002), as well as Bayley motor score (PDI) (OR=2.08, 95% CI: 1.07-4.04, p=0.032). Thus we observed that maternal vitamin D was associated with infant neurodevelopment and anthropometry.

[Relationship between polymorphisms of DNA repair gene XRCC3 and susceptibility to lung cancer].

OBJECTIVE: To study the polymorphisms of DNA repair gene XRCC3 and the relationship between genetic variations and susceptibility to lung cancer. METHODS: A case-control study of 291 patients with lung cancer and 273 cancer-free subjects as a control group was conducted from September 2006 to January 2007 to detect XRCC3 polymorphisms at loci. Genotypes of XRCC3 were analyzed by real time PCR using Taqman probes. RESULTS: Compared with never smoking subjects with wild homozygous genotype (Thr/Thr), smokers with the same genotytpe (Thr/Thr) had increased risk of lung cancer, adjusted odds ratio (OR) was 2.467 (95% CI: 1.49 - 4.08, P < 0.001). Smokers with the heterozygous genotype (Thr/Met) also had increased risk of lung cancer, adjusted OR was 2.283 (95% CI: 1.21 - 6.60, P < 0.05). XRCC3 codon 241 homozygous genotype (Thr/Thr) and pack-years of smoking less than 30 had a weak protective effect on adenocarcinoma (OR = 0.49, 95% CI: 0.26 - 0.93, P < 0.05). Allel Met of XRCC3 codon 241 and smoking conferred an increased risk of squamous cell carcinoma (OR = 9.69, 95% CI: 3.27 - 28.72, P < 0.01). Those with allel Met of XRCC3 codon 241 and pack-years of smoking less than 30 or more than 30 had different risk of squamous cell carcinoma, the OR was 8.00 (95% CI: 1.97 - 32.52, P < 0.01), and 11.67 (95% CI: 2.98 - 45.73, P < 0.01) respectively. CONCLUSION: The results demonstrated that genetic polymorphism of XRCC3 DNA repair gene may contribute to the susceptibility to lung cancer and have synergistic effect with smoking.