Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 81
Filtrar
Más filtros

Bases de datos
Tipo del documento
Intervalo de año de publicación
1.
Zhonghua Nei Ke Za Zhi ; 61(10): 1095-1118, 2022 Oct 01.
Artículo en Zh | MEDLINE | ID: mdl-36207965

RESUMEN

Dyslipidemia is an important risk factor of atherosclerotic cardiovascular disease (ASCVD). Statins delay the occurrence and development of ASCVD, and reduce the risk of cardiovascular events and death. Due to safety concerns, there exist insufficient use of lipid-lowering agents and a high withdrawal rate of the agents in the elderly. To promote the prevention and treatment of ASCVD, this expert consensus is issued and focuses on the management of dyslipidemia of Chinese elderly basing on the clinical evidence of the use of lipid-lowering drugs by the elderly, and the lipid management guidelines and expert consensus recommendations at home and abroad.


Asunto(s)
Aterosclerosis , Enfermedades Cardiovasculares , Dislipidemias , Inhibidores de Hidroximetilglutaril-CoA Reductasas , Anciano , Enfermedades Cardiovasculares/prevención & control , China , LDL-Colesterol , Consenso , Dislipidemias/tratamiento farmacológico , Humanos , Inhibidores de Hidroximetilglutaril-CoA Reductasas/uso terapéutico
2.
Artículo en Zh | MEDLINE | ID: mdl-32131151

RESUMEN

Objective: To investigate the mental health of clinical first-line medical staff in COVID-19 epidemic and provide theoretical basis for psychological intervention. Methods: The mental health status of the first-line medical staff was investigated by Self-rating Anxiety Scale(SAS) and Post-Traumatic Stress Disorder Self- rating Scale (PTSD-SS). From February 7 to 14, 2020, 246 medical staff participated in the treatment of COVID-19 were investigated using cluster sampling, and received 230 responses, with a recovery rate of 93.5%. Results: The incidence of anxiety in medical staff was 23.04% (53/230) , and the score of SAS was(42.91±10.89). Among them, the incidence of severe anxiety, moderate anxiety and mild anxiety were 2.17%(5/230) , 4.78%(11/230) and 16.09%(37/230) , respectively. The incidence of anxiety in female medical staff was higher than that in male [25.67%(48/187) vs 11.63%(5/43) , Z=-2.008, P=0.045], the score of SAS in female medical staff was higher than that in male [(43.78±11.12) vs (39.14±9.01) , t=-2.548, P=0.012]. The incidence of anxiety in nurses was higher than that in doctors[26.88% (43/160) vs 14.29% (10/70) , Z=-2.066, P=0.039], and the score of SAS in nurses was higher than that in doctors [ (44.84±10.42) vs (38.50±10.72) , t=-4.207, P<0.001]. The incidence of stress disorder in medical staff was 27.39% (63/230) , and the score of PTSD-SS was (42.92±17.88) . The score of PTSD-SS in female medical staff was higher than that in male[ (44.30±18.42) vs (36.91±13.95) , t=-2.472, P=0.014]. Conclusion: In COVID-19 epidemic , the incidence of anxiety and stress disorder is high among medical staff. Medical institutions should strengthen the training of psychological skills of medical staff. Special attention should be paid to the mental health of female nurses.


Asunto(s)
Ansiedad/epidemiología , Infecciones por Coronavirus/epidemiología , Infecciones por Coronavirus/terapia , Epidemias , Cuerpo Médico de Hospitales/psicología , Neumonía Viral/epidemiología , Neumonía Viral/terapia , Trastornos por Estrés Postraumático/epidemiología , COVID-19 , China/epidemiología , Femenino , Encuestas Epidemiológicas , Humanos , Incidencia , Masculino , Cuerpo Médico de Hospitales/estadística & datos numéricos , Pandemias , Escalas de Valoración Psiquiátrica , Centros de Atención Terciaria
3.
Artículo en Zh | MEDLINE | ID: mdl-29699015

RESUMEN

Objective: To investigate the cause of occupational exposure among 136 nurses in a tertiary infectious disease hospital, and puts forward the prevention strategy. Methods: A total of 136 nurses exposed to occupational exposure between 2014 and 2016 were included in the study. Analysis was conducted from the years of work of nurses, exposure routes, and the pathogens. Results: The nurses suffer from the highest risk of occupational exposures (73.91%) .Nurses working for less than 5 years and interns are most likely to suffer occupational exposure (45.59% and 35.29% respectively) . Occupational exposure was mainly caused by needle injuries, in which infusion was the main route of occupational exposure (36.76%) . The improper treatment of needle pulling after infusion is the main link of needle puncture (36.76%) . Occupational exposure pathogens were mainly HBV (63.24%) . Conclusion: Nursing staff is the high-risk group of occupational exposure. Irregular operation, lack of awareness of protection, improper disposal after the needle withdrawal and poor safety assessment of the operating environment are the main causes of occupational exposure. It is suggested to strengthen the training of occupational safety and protection, enhance clinical nurses occupational safety protection consciousness, standardize medical operation, so as to prevent the occurrence of occupational exposure.


Asunto(s)
Lesiones por Pinchazo de Aguja/epidemiología , Enfermeras y Enfermeros/psicología , Enfermedades Profesionales/prevención & control , Exposición Profesional/prevención & control , Salud Laboral , Personal de Salud , Humanos , Factores de Riesgo , Centros de Atención Terciaria
4.
Eur J Clin Microbiol Infect Dis ; 35(10): 1557-65, 2016 Oct.
Artículo en Inglés | MEDLINE | ID: mdl-27401906

RESUMEN

Pyogenic liver abscess (PLA) is a potentially life-threatening disease in many parts of the world, especially in Asia. The aim of this study was to quantify the proportion of common pathogens in patients with PLA in China, using a meta-analysis method based on systematic review of published studies. Several electronic databases were searched to identify the studies reporting the pathogens of PLA. We performed a meta-analysis to calculate the pooled proportion of pathogens and subgroup analysis among the included studies using R 3.1.1 software. In total, 183 studies were included in our final analysis, Klebsiella spp (54 %), Escherichia spp (29 %), Enterobacter spp (9 %), Proteus spp (6 %) and Pseudomonas spp (5 %) comprised the major gram-negative bacteria. Gram-positive bacteria mainly included Staphylococcus spp (13 %), Streptococcus spp (8 %) and Enterococcus spp (7 %). The distribution of pathogens in PLA patients were different in different economic regions in China. The proportion of Klebsiella spp had an upward tendency in recent years compared to other pathogens. In addition, the proportion of common pathogens in PLA patients with diabetes mellitus (DM) were carried out indicating that the dominant pathogens were Klebsiella spp (66 %), Escherichia spp (21 %) and Enterobacter spp (11 %). This meta-analysis showed that the main pathogens of PLA were Klebsiella spp, Escherichia spp, Staphylococcus spp, and Enterobacter spp in China. To ensure a precise estimate of the epidemiology of the pathogens, further large-scale or even a population-based study is needed.


Asunto(s)
Infecciones Bacterianas/microbiología , Bacterias Gramnegativas/aislamiento & purificación , Bacterias Grampositivas/aislamiento & purificación , Absceso Piógeno Hepático/microbiología , Infecciones Bacterianas/epidemiología , China/epidemiología , Bacterias Gramnegativas/clasificación , Bacterias Grampositivas/clasificación , Humanos , Absceso Piógeno Hepático/epidemiología , Prevalencia
5.
Zhonghua Yi Xue Za Zhi ; 96(41): 3284-3288, 2016 Nov 08.
Artículo en Zh | MEDLINE | ID: mdl-27852371

RESUMEN

Objective: To investigate the relation between cognition and serum calcium in the patients with Parkinson's disease (PD), analyze the related factors of cognition, and evaluate the correlation of serum calcium with specific cognitive domains. Methods: A total of 77 patients with Parkinson's disease who was hospitalized in the Second Affiliated Hospital of Soochow University, from Dce 2013 to May 2015 were subjected to the cognitive, motor and depression function assessment, and the fasting blood calcium samples were collected from the PD patients and 75 normal control subjects. According to cognitive function, PD patients were divided into dementia group and without dementia group. Then the serum calcium levels of three groups and the related factors of the cognitive were analyzed by multiple linear regression. Results: (1) The level of serum calcium in PD group with dementia (2.21±0.09) mmol/L was significantly lower than the normal control group (2.30±0.09)mmol/L (P<0.001), and there was no difference between the level of serum calcium in PD group without dementia (2.27±0.13 mmol/L) and normal control group (P=0.144). The level of serum calcium in PD group with dementia was lower than PD group without dementia, and there was marked statistical significance (P=0.023). (2) In PD patients, the cognitive scores correlated with serum calcium levels, education, H-Y stages and Unified Parkinson's Disease Rating Scale (UPDRS) Ⅲ scores (P<0.05), but didn't with gender, age, disease duration, depression levels, Body Mass Index (BMI) and total equivalent levodopa doses (P>0.05). (3) In PD patients, serum calcium level correlated with the visuospatial and executive capability, calculation ability, language ability (P1=0.004; P2=0.027; P3=0.021). Conclusions: (1) There is correlation between the serum calcium and the cognitive impairment. Lower serum calcium level predicts worse cognitive scores. (2) In PD patients, the change of the cognitive function is affected by their education, H-Y stages and UPDRSⅢ scores. (3) The serum calcium level of PD patients closely relates to the cognitive domain of the visuospatial and executive capability, calculation ability, and language ability.


Asunto(s)
Calcio/sangre , Cognición , Enfermedad de Parkinson , Trastornos del Conocimiento , Depresión , Humanos
6.
Plant Dis ; 98(4): 572, 2014 Apr.
Artículo en Inglés | MEDLINE | ID: mdl-30708716

RESUMEN

The experimental host range of Maize chlorotic mottle virus (MCMV) is restricted to the Gramineae (Poaceae) family with maize as a natural host. However, MCMV has never been found to infect sugarcane (Saccharum officinarum L.) plants in fields. MCMV can cause corn lethal necrosis disease (CLND) resulting from synergistic interaction between this virus and Maize dwarf mosaic virus (MDMV), Wheat streak mosaic virus (WSMV), or Sugarcane mosaic virus (SCMV) (1). MCMV was first found on maize plants in Yunnan Province in China in 2011 (2), and co-infection of MCMV and SCMV was reported on maize in Yunnan Province in China in 2013 (1). In January 2013, while surveying MCMV on maize in Yunnan Province, we found sugarcane planted near an MCMV-infected maize field with chlorotic and mosaic viral symptoms. Five symptomatic sugarcane plants were collected and screened for MCMV using a monoclonal antibody-based dot-ELISA (1). MCMV was detected in all five sugarcane samples using this assay. To further confirm the ELISA results, total RNA was isolated from sugarcane leaves using TRIzol reagent (Invitrogen, Carlsbad, CA) and assayed for MCMV by reverse transcription (RT)-PCR with primers M69F (ACAGGACACCGTTGCCGTTTAT) and M70R (CATGGGTGGGTCAAGGCTTACT) designed to amplify nt 3301 to 4282 of MCMV maize isolate YN2 (GenBank Accession No. JQ982468). The expected 982-bp amplicon was obtained from all five sugarcane samples confirming that the five sugarcane samples were infected with MCMV. Using purified total RNA as a template, RT-PCR was performed using SuperScript III Reverse Transcriptase (Invitrogen, Carlsbad, CA) and Pfusion High-Fidelity DNA polymerase (New England Biolabs, Ipswich, MA) with primers M10 (AGGTAATCTGCGGCAACAGACC, 1 to 22 nt) and M36 (GGGCCGGAAGAGAGGGGCATTAC, 4436 to 4414 nt). The sequence of the resulting cDNA amplicon (KF010583) indicated that the MCMV sugarcane isolate shares 99% sequence identity with the MCMV maize isolate YN2 from Yunnan Province in China. Attempts to mechanically transmit MCMV from sugarcane to maize were unsuccessful. However, quantitative real time RT-PCR result revealed that the virus titer in sugarcane plants was about 6 to 10 times lower than that in maize plants (data not shown). SCMV was also detected in the five MCMV-infected sugarcane samples by RT-PCR with primers W48F (GTGTGGAATGGTTCACTCAAAGCTG) and W49R (GGTGTTGCAATTGGTGTGTACACG), designed to amplify a 395-bp fragment of the SCMV Beijing isolate (AY042184). The sequence of the amplified products shared 98% identity with SCMV isolate JP2 (JF488065). Thus, we think chlorotic and mosaic symptoms on the sugarcane plant samples were caused by co-infection of MCMV and SCMV and the sugarcane plants harbor both viruses implicated in causing maize lethal necrosis. This study indicates that MCMV naturally infects sugarcane plants. To our knowledge, this is the first report of MCMV infecting sugarcane plants. References: (1) J.-X. Wu et al. J. Zhejiang Univ-Sci B (Biomed & Biotechnol). 14:555, 2013. (2) L. Xie et al. J. Phytopathol. 159:191, 2011.

7.
Zhonghua Xue Ye Xue Za Zhi ; 45(8): 738-747, 2024 Aug 14.
Artículo en Zh | MEDLINE | ID: mdl-39307720

RESUMEN

Objective: To evaluate the efficacy and safety of hypomethylating agents (HMA) in patients with myelodysplastic syndromes (MDS) . Methods: A total of 409 MDS patients from 45 hospitals in Zhejiang province who received at least four consecutive cycles of HMA monotherapy as initial therapy were enrolled to evaluate the efficacy and safety of HMA. Mann-Whitney U or Chi-square tests were used to compare the differences in the clinical data. Logistic regression and Cox regression were used to analyze the factors affecting efficacy and survival. Kaplan-Meier was used for survival analysis. Results: Patients received HMA treatment for a median of 6 cycles (range, 4-25 cycles) . The complete remission (CR) rate was 33.98% and the overall response rate (ORR) was 77.02%. Multivariate analysis revealed that complex karyotype (P=0.02, OR=0.39, 95%CI 0.18-0.84) was an independent favorable factor for CR rate. TP53 mutation (P=0.02, OR=0.22, 95%CI 0.06-0.77) was a predictive factor for a higher ORR. The median OS for the HMA-treated patients was 25.67 (95%CI 21.14-30.19) months. HMA response (P=0.036, HR=0.47, 95%CI 0.23-0.95) was an independent favorable prognostic factor, whereas complex karyotype (P=0.024, HR=2.14, 95%CI 1.10-4.15) , leukemia transformation (P<0.001, HR=2.839, 95%CI 1.64-4.92) , and TP53 mutation (P=0.012, HR=2.19, 95%CI 1.19-4.07) were independent adverse prognostic factors. There was no significant difference in efficacy and survival between the reduced and standard doses of HMA. The CR rate and ORR of MDS patients treated with decitabine and azacitidine were not significantly different. The median OS of patients treated with decitabine was longer compared with that of patients treated with azacitidine (29.53 months vs 20.17 months, P=0.007) . The incidence of bone marrow suppression and pneumonia in the decitabine group was higher compared with that in the azacitidine group. Conclusion: Continuous and regular use of appropriate doses of hypomethylating agents may benefit MDS patients to the greatest extent if it is tolerated.


Asunto(s)
Síndromes Mielodisplásicos , Humanos , Síndromes Mielodisplásicos/tratamiento farmacológico , Masculino , Persona de Mediana Edad , Femenino , Estudios Retrospectivos , Anciano , Adulto , Anciano de 80 o más Años , Adulto Joven , Adolescente , Resultado del Tratamiento , Azacitidina/uso terapéutico
8.
Acta Virol ; 57(3): 305-11, 2013.
Artículo en Inglés | MEDLINE | ID: mdl-24020756

RESUMEN

Hepatitis B virus (HBV) can be propagated in vitro in primary cultures of human hepatocytes and some stable hepatoma cell lines maintained under specific conditions. The lack of simple and non-neoplastic cell culture systems for HBV has hampered the analysis of virus life cycle and development of antiviral compounds. In this study, we succeeded in prolonging the lifespan of human hepatocytes in primary culture by transducing them with human telomerase reverse transcriptase (hTERT) gene. The transgenic cells expressed hTERT constitutively and propagated HBV up to 5x105 DNA copies/ml for 28 days.


Asunto(s)
Virus de la Hepatitis B/fisiología , Hepatitis B/virología , Hepatocitos/virología , Telomerasa/genética , Transducción Genética , Replicación Viral , Animales , Línea Celular , Células Cultivadas , Hepatitis B/enzimología , Hepatitis B/genética , Virus de la Hepatitis B/genética , Hepatocitos/enzimología , Humanos , Ratones , Telomerasa/metabolismo , Cultivo de Virus
9.
Eur Rev Med Pharmacol Sci ; 27(18): 8762-8772, 2023 09.
Artículo en Inglés | MEDLINE | ID: mdl-37782188

RESUMEN

OBJECTIVE: Gestational diabetes mellitus (GDM) is a serious pregnancy complication, and women with undiagnosed diabetes mellitus can develop chronic hyperglycemia during pregnancy. The purpose of this study is to investigate the impact of information-based continuity of care on glucose levels, health awareness, and maternal and infant outcomes in pregnant women with GDM, thereby providing a basis for the clinical implementation of effective interventions for GDM to reduce or avoid adverse outcomes due to GDM. PATIENTS AND METHODS: One hundred and sixty cases of pregnant women with GDM who underwent treatment in the obstetrics and gynecology department of our hospital from June 2019 to September 2021 were randomly selected as the study population and divided into the control group (n=80) and the study group (n=80). Women in the control group were received with conventional nursing intervention, and those in the study group were obtained with information-based continuity of care on the basis of the control group. Basic clinical data were collected. The levels of fasting blood glucose (FBG), 2h postprandial glucose (2hPG), knowledge of health education, treatment compliance scores, and changes in delivery outcomes were compared between the two groups. According to the maternal blood glucose control level, 160 pregnant women with GDM were divided into the better control group (143 cases) and the poor control group (17 cases). The risk factors affecting the level of maternal glycemic control in gestational diabetes were analyzed. RESULTS: After the intervention, the levels of FBG and 2hPG were significantly lower in both groups than those before the intervention, while the levels of FBG and 2hPG in the study group were notably lower than those in the control group. The health education knowledge score and treatment compliance score after the intervention were significantly higher than those before the intervention, and the health education knowledge score and treatment compliance score in the study group were observably higher than those in the control group (p<0.01). The adverse pregnancy outcomes of pregnant women in the study group were significantly reduced compared with those in the control group (p<0.05). Logistic regression analysis showed that body mass index (BMI), dietary control, literacy, and information-based continuity of care were all influential factors for maternal glycemic control level (p<0.05). Among the influencing factors, dietary control and continuity of care had clinical value in predicting maternal glycemic control levels in gestational diabetes. CONCLUSIONS: Continuous nursing based on informatization can effectively control the blood glucose level of pregnant women with GDM, improve the treatment compliance of pregnant women and the awareness rate of gestational diabetes knowledge so as to reduce the occurrence of adverse pregnancy outcomes and improve the health level. In addition, BMI and dietary control are independent risk factors that affect the blood glucose control level of pregnant women. Relevant intervention measures should be formulated according to the relevant influencing factors to effectively control the blood glucose level of pregnant women with GDM and improve maternal and infant outcomes.


Asunto(s)
Diabetes Gestacional , Embarazo , Lactante , Humanos , Femenino , Diabetes Gestacional/terapia , Glucemia , Mujeres Embarazadas , Escolaridad , Educación en Salud
10.
J Mater Sci Mater Med ; 23(4): 1097-107, 2012 Apr.
Artículo en Inglés | MEDLINE | ID: mdl-22327946

RESUMEN

This study aimed to investigate the feasibility of the nanostructured 3D poly(lactide-co-glycolide) (PLGA) constructs, which are loaded with dexamethasone (DEX) and growth factor embedded heparin/poly(L-lysine) nanoparticles via a layer-by-layer system, to serve as an effective scaffold for nucleus pulposus (NP) tissue engineering. Our results demonstrated that the microsphere constructs were capable of simultaneously releasing basic fibroblast growth factor and DEX with approximately zero order kinetics. The dual bead microspheres showed no cytotoxicity, and promoted the proliferation of the rat mesenchymal stem cells (rMSCs) by lactate dehydrogenase assay and CCK-8 assay. After 4 weeks of cultivation in vitro, the rMSCs-scaffold hybrids contained significantly higher levels of sulfated GAG/DNA and collagen type II than the control samples. Moreover, quantitative real time PCR analysis revealed that the expression of disc-matrix proteins including collagen type II, aggrecan, and versican in the rMSCs-scaffold hybrids was significantly higher than that in the control group, whereas the expression of osteogenic differentiation marker (collagen type I) was decreased. Taken together, these data indicate that Dex/bFGF PLGA microspheres could be used as a scaffold to improve the rMSCs growth and differentiating into NP like cells, and reduce the inflammatory response for IVD tissue engineering.


Asunto(s)
Diferenciación Celular/efectos de los fármacos , Dexametasona/farmacología , Factor 2 de Crecimiento de Fibroblastos/farmacología , Disco Intervertebral/fisiología , Células Madre Mesenquimatosas/efectos de los fármacos , Microesferas , Regeneración , Animales , Secuencia de Bases , Células Cultivadas , Colágeno/metabolismo , ADN/metabolismo , Cartilla de ADN , Estudios de Factibilidad , Femenino , Glicosaminoglicanos/metabolismo , Ácido Láctico , Masculino , Células Madre Mesenquimatosas/citología , Microscopía Electrónica de Rastreo , Ácido Poliglicólico , Copolímero de Ácido Poliláctico-Ácido Poliglicólico , Ratas , Ratas Sprague-Dawley , Reacción en Cadena en Tiempo Real de la Polimerasa
11.
Hum Reprod ; 26(7): 1860-7, 2011 Jul.
Artículo en Inglés | MEDLINE | ID: mdl-21489975

RESUMEN

BACKGROUND: The objective of this study was to explore the potential for vertical transmission of hepatitis B virus (HBV) from parents to offspring via human germ cells. METHODS: For study samples, 250 oocytes from hepatitis B surface antigen (HBsAg) seropositive women and 578 embryos from couples with at least one HBsAg seropositive partner were collected. HBV DNA in the nuclei of oocytes and embryos was detected by fluorescence in situ hybridization; HBsAg expression was analysed using immunofluorescence; and serum HBV DNA levels were measured by real-time PCR. The HBV infection duration of the women and the serum HBsAg status of their mothers were also examined. RESULTS: HBV DNA was present in 9.6% (24/250) of oocytes and 14.4% (83/578) of embryos. Rates of HBV DNA positive embryos were similar among couples in which the woman, man or both partners were HBsAg seropositive, 13.1% (57/436), 21.3% (16/75) and 14.9% (10/67), respectively. Rates of positivity in oocytes and embryos were significantly higher in a group with high serum levels HBV DNA than in a group with lower serum levels (P= 0.004 and P= 0.002, respectively). Higher rates of oocyte positivity were found for women whose mothers were HBV infected compared with those with uninfected mothers. Expression of HBsAg was observed in 8.7% (2/28) oocytes and 14.1% (10/71) embryos (P= 0.34). CONCLUSIONS: The presence of HBV DNA in human oocytes or embryos was related to the women's serum levels of HBV DNA and the infection status of their mothers. The HBV positive embryos were either maternally or paternally dependent. HBV infection may result in vertical transmission to the offspring via germ cells.


Asunto(s)
Embrión de Mamíferos/virología , Hepatitis B/transmisión , Transmisión Vertical de Enfermedad Infecciosa , Oocitos/virología , ADN Viral/análisis , Femenino , Hepatitis B/inmunología , Antígenos de Superficie de la Hepatitis B/sangre , Virus de la Hepatitis B/inmunología , Virus de la Hepatitis B/aislamiento & purificación , Humanos , Hibridación Fluorescente in Situ
12.
Plant Dis ; 95(6): 776, 2011 Jun.
Artículo en Inglés | MEDLINE | ID: mdl-30731930

RESUMEN

During May of 2009, a new devastating disease was observed on pomegranate (Punica granatum L.) that caused losses estimated at 30% as surveyed by 10 orchards in Panzhihua-Xichang Region of Sichuan Province, Southwest China. Characteristic symptoms were yellow and wilting leaves. Initial symptoms only occurred on shoots, but later, leaves of the whole tree turned yellow and wilted, causing extensive defoliation and dieback and the xylem of the trunk turned brown to black with a star burst-like pattern. Finally, heavy infection resulted in the whole tree dying, causing severe yield losses. A fungus was consistently isolated from basal stems and roots of diseased plants. Single conidia were obtained and cultured on potato dextrose agar (PDA) and incubated at 25 ± 1°C with a 12-h light/dark photoperiod. Mycelium was initially hyaline and then rapidly became dark greenish brown. Two types of endoconidia were produced in 5 days. Barrel-shaped conidia were hyaline, 1-celled, and measured 7.3 to 9.4 × 11.6 to 13.2 µm. Cylindrical conidia were hyaline, 1-celled, and measured 9.2 to 29.6 × 3.1 to 6.8 µm. Aleurioconidia were brownish, thick walled, near globose, and measured 8.7 to 18.1 × 8.2 to 10.7 µm. Perithecia were dark brown to black, globose, measured 90.8 to 149.8 µm in diameter, and had a long thin neck, 254.4 to 533.8 µm long, through which ascospores exuded. Ascospores were small, hyaline, hat shaped, measured 3.7 to 6.5 × 3.1 to 5.7 µm, and accumulated in a sticky matrix at the tip of the ascomal neck. The fungus was identified as Ceratocystis fimbriata (anamorph Chalara sp.) (1). The internal transcribed spacer (ITS) region of rDNA was amplified with universal primers ITS4/ITS5 and sequenced (GenBank Accession No. HQ529711), and comparisons with GenBank showed 99% similarity with C. fimbriata on Colocasia esculenta from Brazil (Accession No. AM712448.1). Pathogenicity tests were conducted. Two-week-old seedlings of pomegranate cv. Qingpiruanzi, germinated in plastic containers in the greenhouse, were wounded with a needle to a depth of 0.5 mm at the base of the stem below the soil level and near the root system, and then inoculated by drenching the wounds with a spore suspension (105 conidia per ml). Control plants were inoculated with sterile water. There were four replicates for each treatment. The treated plants were incubated at 25 ± 1°C with 80 to 95% relative humidity under a 12-h light/dark photoperiod in a greenhouse. All inoculated plants wilted within 25 days after inoculation and C. fimbriata was reisolated. All control plants remained healthily. To our knowledge, this is the first finding of pomegranate wilt caused by C. fimbriata in Sichuan Province. This pathogen may pose a serious threat to pomegranate production in Sichuan where it is a major fruit tree. This pathogen has been previously reported in India (3) and Yunnan Province, China (2), but is not known elsewhere. References: (1) C. J. B. Engelbrecht and T. C. Harrington. Mycologia 97:57, 2005. (2) Q. Huang et al. Plant Dis. 87:1150, 2003. (3) Y. M. Somasekhara. Plant Dis. 83:400, 1999.

14.
Acta Virol ; 52(1): 59-62, 2008.
Artículo en Inglés | MEDLINE | ID: mdl-18459837

RESUMEN

Fourteen isolates of Turnip mosaic virus (TuMV) were obtained from the leaves of diseased cruciferous plants in China. According host tests, the isolates were classified into B-host and BR-host group. The nucleotide sequences of the coat protein (CP) and helper component proteinase (HC-Pro) genes of the isolates were determined. The CP genes consisted of 864 nucleotides encoding a polypeptide of 288 amino acids. The HC-Pro genes comprised 1374 nucleotides encoding a polypeptide of 458 amino acids. The genes CP and HC-Pro of the 14 isolates shared nucleotide sequence identities ranging from 89.2 to 99.5% and 79.1 to 99.9%, respectively. Amino acid sequence identities of CP and HC-Pro proteins ranged from 95.1 to 100% and 94.8 to 99.8%, respectively. Phylogenetic tree based on the CP gene indicated that 13 of the 14 TuMV isolates belonged to the world-B group, while the remaining isolate ZJ1 belonged to the basal-BR group. The phylogenetic tree based on the HC-Pro gene was similar to that of CP gene with the exception of the isolate JX that clustered with the Asian-BR group. Our results were consistent with the previous results demonstrating that a majority of the isolates collected from Brassica spp. belonged to the world-B group.


Asunto(s)
Brassica napus/virología , Proteínas de la Cápside/genética , Cisteína Endopeptidasas/genética , Enfermedades de las Plantas/virología , Potyvirus/genética , Potyvirus/aislamiento & purificación , Proteínas Virales/genética , China , Datos de Secuencia Molecular , Filogenia , Potyvirus/clasificación , Análisis de Secuencia de ADN
16.
Zhonghua Xue Ye Xue Za Zhi ; 38(4): 307-312, 2017 Apr 14.
Artículo en Zh | MEDLINE | ID: mdl-28468092

RESUMEN

Objective: To assess the efficiency and safety of low-dose decitabine in patients with lower-risk myelodysplastic syndrome (MDS) to couple with the clinical significance of MDS-related gene mutations. Methods: This study was done in 4 institutions in Zhejiang Province. A total of 62 newly diagnosed patients with lower-risk MDS were assigned to two groups of decitabine (12 mg·m(-2)·d(-1) for 5 consecutive days) and best supportive care (BSC) . Their bone marrow samples were subject to examinations of MDS-related 15 gene mutations. The primary endpoints were the proportion of patients who achieved overall response (ORR) after at least two cycles and progression-free survival (PFS) , and their relevances to the gene mutations. Results: Of 62 enrolled patients, and 51 cases were included in the final analysis. 16 of 24 patients (66.7%) in decitabine group achieved ORR versus 8 of 27 (29.6%) in BSC group (χ(2)=6.996, P=0.008) ; PFS prolongation of decitabine versus BSC was statistically significant (not reached vs 13.7 months, P=0.037) . Among 51 patients, at least one gene mutation was identified in 20 patients (39.2%) , including 4 single SF3B1 mutation. PFS in cases with gene mutations (not including single SF3B1 mutation) was significantly shorter than of no gene mutation (9.2 months vs 18.5 months, P=0.008) , but not for ORR (37.5% vs 58.1%, P=0.181) . Among 16 patients with mutated genes, ORR in decitabine and BSC groups were 75% (6/8) and 0 (0/8) , respectively. The most adverse events in decitabine group were grade 3 to 4 neutropenia (45.8%) and grade 3 to 4 infections (33.3%) . Conclusion: This preliminary study showed that low-dose decitabine produced promising results with an acceptable safety in lower-risk MDS patients, especially for those with mutated genes. Further study targeting poor prognostic lower-risk MDS patients should be warranted.


Asunto(s)
Mutación , Síndromes Mielodisplásicos , Antimetabolitos Antineoplásicos , Azacitidina/análogos & derivados , Decitabina , Supervivencia sin Enfermedad , Humanos , Pronóstico , Riesgo , Resultado del Tratamiento
17.
J Med Genet ; 42(4): 318-21, 2005 Apr.
Artículo en Inglés | MEDLINE | ID: mdl-15805158

RESUMEN

The genetic aetiology of autism remains elusive. Occasionally, individuals with Cowden syndrome (a cancer syndrome) and other related hamartoma disorders such as Bannayan-Riley-Ruvalcaba syndrome, Proteus syndrome, and Proteus-like conditions, are characterised by germline PTEN mutations, and may have neurobehavioural features resembling autism as well as overgrowth and macrocephaly. Therefore, we undertook PTEN gene mutation analysis in 18 subjects mainly prospectively ascertained with autism spectrum disorder and macrocephaly. Of these 18 autistic subjects (13 males and five females; ages 3.1-18.4 years) with a head circumference range from 2.5 to 8.0 standard deviations above the mean, three males (17%) carried germline PTEN mutations. These three probands had previously undescribed PTEN mutations: H93R (exon 4), D252G (exon 7), and F241S (exon 7). They had the larger head circumference measurements amongst all our study subjects. The three residues altered in our patients were highly evolutionarily conserved. We suggest that PTEN gene testing be considered for patients with autistic behaviour and extreme macrocephaly. The gene findings may impact on recurrence risks as well as medical management for the patient.


Asunto(s)
Trastorno Autístico/genética , Anomalías Craneofaciales/genética , Genes Supresores de Tumor , Mutación de Línea Germinal , Fosfohidrolasa PTEN/genética , Adolescente , Secuencia de Aminoácidos , Animales , Niño , Preescolar , Femenino , Humanos , Masculino , Datos de Secuencia Molecular , Mutación Missense , Fenotipo , Alineación de Secuencia , Homología de Secuencia
18.
Plant Dis ; 90(10): 1359, 2006 Oct.
Artículo en Inglés | MEDLINE | ID: mdl-30780951

RESUMEN

Tomato yellow leaf curl virus (TYLCV) is a devastating pathogen of tomato that causes significant yield losses in many tropical and subtropical regions (2). In China, however, there has as yet been no report of this virus, although other begomoviruses have been reported infecting tomato (1,3). A yellow mosaic disease was observed on tomato with 90% disease incidence during March 2006 in fields of Sunqiao, Shanghai Province, China. Triple-antibody sandwich enzyme-linked immunosorbent assay (TAS-ELISA) tests indicated that tomato plants were not infected by Tomato mosaic virus or Cucumber mosaic virus. Tomato plants were found to be infested with Bemisia tabaci, suggesting a begomovirus etiology. The disease agent was transmitted to tomato by whiteflies and produced yellow mosaic and stunting symptoms that were identical to those observed in the field. Total DNA was isolated from eight collected leaf samples. Polymerase chain reaction (PCR) was performed with begomovirus degenerate primers PA and PB (3), and an amplicon of the expected size (~500 bp) was obtained in all eight samples but not from healthy leaf samples. The PCR products from two samples (SH1 and SH2) were cloned and sequenced. All residues in the sequences were confirmed by comparison of duplicate clones. Alignment of the sequences showed that they shared 97.4% nucleotide sequence identity (GenBank Accession No. AM282874-75), suggesting that they were infected by an identical virus. Overlapping primers Full/F (5'-AGCCCAATACATTGGGCC ACGA-3') and Full/R (5'-CGTAAGTTTCCTCAACGGACTGC-3') were then designed to amplify the full length DNA-A of SH2. The sequence was determined to be 2,781 nucleotides long (GenBank Accession No. AM282874). A comparison with other begomoviruses shows SH2 DNA-A has the highest nucleotide sequence identity (99.8%) with TYLCV isolate Tosa from Japan (GenBank Accession No. AB192966). The above results indicate that the virus associated with yellow mosaic disease of tomato in Shanghai is an isolate of TYLCV. To our knowledge, this is the first report of TYLCV in China and the first report of a begomovirus in Shanghai. References: (1) X. F. Cui et al. J. Virol. 78:13966, 2004. (2) E. Moriones and J. Navas-Castillo. Virus Res. 71:123, 2000. (3) Z. H. Li et al. Arch. Virol. 149:1721, 2004.

19.
Cancer Res ; 61(11): 4311-4, 2001 Jun 01.
Artículo en Inglés | MEDLINE | ID: mdl-11389050

RESUMEN

Discovery of somatically mutated cells in human tissues has been less frequent than would be predicted by in vitro mutational rates. We analyzed the PTEN tumor suppressor gene as an early marker for endometrial carcinogenesis, and we show that 43% of histologically normal premenopausal endometria contain rare glands that fail to express PTEN protein because of mutation and/or deletion. These persist between menstrual cycles. Histopathology of PTEN-null glands is initially unremarkable, but with progression, they form distinctive high-density clusters. These data are consistent with a progression model in which initial mutation is not rate limiting.


Asunto(s)
Neoplasias Endometriales/genética , Monoéster Fosfórico Hidrolasas/genética , Lesiones Precancerosas/genética , Proteínas Supresoras de Tumor , Adulto , Neoplasias Endometriales/metabolismo , Neoplasias Endometriales/patología , Endometrio/citología , Endometrio/metabolismo , Endometrio/fisiología , Femenino , Expresión Génica , Genes Supresores de Tumor , Humanos , Inmunohistoquímica , Persona de Mediana Edad , Mutación , Fosfohidrolasa PTEN , Monoéster Fosfórico Hidrolasas/biosíntesis , Lesiones Precancerosas/metabolismo , Lesiones Precancerosas/patología
20.
Cancer Res ; 59(17): 4213-5, 1999 Sep 01.
Artículo en Inglés | MEDLINE | ID: mdl-10485457

RESUMEN

About 15% of sporadic colorectal cancers show microsatellite instability (MSI) due to the inactivation of mismatch repair genes and are termed MSI-H tumors. In these tumors, frameshift mutations in coding repeats have been found within the TGFbeta-RII, BAX, and IGFRII genes that are probably involved in their progression. In the present work, we report frequent mutations in TCF-4, another target gene for instability. TCF-4 codes for a transcription factor that is a crucial member of the adenomatous polyposis coil (APC)/beta-catenin/T-cell factor (TCF) pathway. Fifty percent (4 of 8) of human MSI-H colorectal cell lines and 39% (19 of 49) of MSI-H colorectal primary tumors were found to have a 1-bp deletion in an (A)9 repeat within the coding region of this gene. In contrast, a frameshift mutation was found in only 1 of 56 non-MSI colorectal tumors and in none of 16 non-MSI colorectal cancer cell lines. These results suggest that TCF-4 frameshift mutations are selected for and play a role in colorectal MSI-H tumorigenesis. Depending on different reading frames due to alternatively spliced TCF-4 mRNA, the (A)9 repeat normally codes for several isoforms that could serve as modulators of TCF-4 transcriptional activity. The deletion of one nucleotide in this repeat could change TCF-4 transactivating properties by modifying the respective proportions of the different isoforms.


Asunto(s)
Neoplasias Colorrectales/genética , Mutación del Sistema de Lectura , Repeticiones de Microsatélite , Transactivadores , Factores de Transcripción/genética , Proteínas del Citoesqueleto/genética , Genes APC , Humanos , Reacción en Cadena de la Polimerasa de Transcriptasa Inversa , Factores de Transcripción TCF , Proteína 2 Similar al Factor de Transcripción 7 , Células Tumorales Cultivadas , beta Catenina
SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA