Protein expression/secretion boost by a novel unique 21-mer cis-regulatory motif (Exin21) via mRNA stabilization.

Boosting protein production is invaluable in both industrial and academic applications. We discovered a novel expression-increasing 21-mer cis-regulatory motif (Exin21) that inserts between SARS-CoV-2 envelope (E) protein-encoding sequence and luciferase reporter gene. This unique Exin21 (CAACCGCGGTTCGCGGCCGCT), encoding a heptapeptide (QPRFAAA, designated as Qα), significantly (34-fold on average) boosted E production. Both synonymous and nonsynonymous mutations within Exin21 diminished its boosting capability, indicating the exclusive composition and order of 21 nucleotides. Further investigations demonstrated that Exin21/Qα addition could boost the production of multiple SARS-CoV-2 structural proteins (S, M, and N) and accessory proteins (NSP2, NSP16, and ORF3), and host cellular gene products such as IL-2, IFN-γ, ACE2, and NIBP. Exin21/Qα enhanced the packaging yield of S-containing pseudoviruses and standard lentivirus. Exin21/Qα addition on the heavy and light chains of human anti-SARS-CoV monoclonal antibody robustly increased antibody production. The extent of such boosting varied with protein types, cellular density/function, transfection efficiency, reporter dosage, secretion signaling, and 2A-mediated auto-cleaving efficiency. Mechanistically, Exin21/Qα increased mRNA synthesis/stability, and facilitated protein expression and secretion. These findings indicate that Exin21/Qα has the potential to be used as a universal booster for protein production, which is of importance for biomedicine research and development of bioproducts, drugs, and vaccines.

Predicted changes in distribution and grazing value of Stipa-based plant communities across the Eurasian steppe.

The Eurasian steppe is one of the world's largest continuous areas of grassland and has an important role in supporting livestock grazing, the most ubiquitous land use on Earth. However, the Eurasian steppe is under threat, from irrational grazing utilization, climate change, and resource exploitation. We used an ensemble modeling approach to predict the current and future distribution of Stipa-dominated plant communities in three important steppe subregions; the Tibetan Alpine, Central Asian, and Black Sea-Kazakhstan subregions. We combined this with an assessment of the grazing value of 22 Stipa species, the dominant grassland species in the area, to predict how grazing value might change under future climate change predictions. We found that the effects of changing climates on grazing values differed across the three subregions. Grazing values increased in the Tibetan alpine steppe and to a lesser extent in Central Asia, but there were few changes in the Black Sea-Kazakhstan subregion. The response of different species to changing climates varied with environmental variables. Finally, our trait-based assessment of Stipa species revealed variations in grazing value, and this had major effects on the overall grazing value of the region. Our results reinforce the importance of trait-based characteristics of steppe plant species, how these traits affect grazing value, and how grazing values will change across different areas of the Eurasian steppe. Our work provides valuable insights into how different species will respond to changing climates and grazing, with important implications for sustainable management of different areas of the vast Eurasian steppe ecosystem.

Source identification and migration fate of heavy metals of soil-groundwater system in a thousand-year cultivation region.

Pollution of farmland by heavy metals threatens food security and human health. In addition, heavy metals in soil could infiltrate into groundwater to influence the water quality and safety of drinking water. However, the relationship between heavy metal pollution in soil and groundwater is still not clear. In this study, we investigated the soil and groundwater in the Guanzhong Plain region, which is a significant grain production base in China, and determined the spatial distributions, ecological risk, sources, and migration fates of heavy metals (As, Cd, Cr, Cu, Ni, Pb, and Zn). The results showed that the mean values (0-20 cm) in the soil were 19.57 mg kg-1 for As, 0.71 mg kg-1 for Cd, 69.65 mg kg-1 for Cr, 21.97 mg kg-1 for Cu, 28.67 mg kg-1 for Ni, 17.54 mg kg-1 for Pb, and 73.77 mg kg-1 for Zn, and the corresponding mean values in groundwater were 1.2, 0.04, 4.69, 0.15, 0.07, 0.3, and 3.6 µg L-1, respectively. The mean values for As, Cd, Cr, Pb, and Zn in soil exceeded the background values, and the mean values for As, Cd and Pb exceeded those in groundwater. Positive matrix factorization models identified five sources (fertilizers and organic fertilizers, natural sources, pesticides and herbicides, industrial activities, and sedimentation caused by transportation) for heavy metal pollution in soil and four sources (industry activity, atmospheric sedimentation caused by transportation, natural sources, and agriculture) for heavy metal pollution in groundwater. The soil particle composition and soil organic carbon content were important factors that affected the vertical distribution of heavy metals in the soil. The migration modes (convection and diffusion) were not found for all heavy metals. These results help to understand the relationships between heavy metals in soil and groundwater in farmland ecosystems regionally.

Polarization-maintaining all-fiber tunable mode-locked laser based on a thermally controlled Lyot filter.

We propose and demonstrate for the first time, to the best of our knowledge, a thermally controlled all polarization-maintaining (PM) fiber Lyot filter. This filter is implemented in an all-PM mode-locked fiber laser to achieve wavelength tunability. When operating in the single-wavelength tunable mode, the center wavelength can be tuned across a range from 1546 nm to 1571 nm. Furthermore, the laser can also operate in a dual-wavelength mode with center wavelengths at 1545 nm and 1571 nm. The temperature sensitivity achieved in our all-PM fiber Lyot filter is 0.602 nm/°C, which is over 46 times higher than other fiber-based filters such as a fiber Bragg grating filter (0.013 nm/°C). This highly stable and versatile wavelength-tunable all-PM fiber mode-locked laser is a promising source for various applications requiring wavelength tunability and/or dual-wavelength output, such as coherent Raman microscopy and dual-comb spectroscopy.

Distribution characteristics and controls of soil organic carbon at different spatial scales in China's Loess Plateau.

Understanding the variations and controls of soil organic carbon (SOC) at different spatial scales can help in selecting edaphic and environmental covariates that enables us to model SOC more accurately. The present study investigated the distribution characteristics and controls of SOC content at various spatial scales, including a deep soil core (204.5 m) taken from land surface down to bedrock (plot scale), two toposequences with different slope aspects (slope scale), and eighty-six soil profiles along a north-south transect under different land uses (regional scale) in China's Loess Plateau. The results showed that SOC content at different spatial scales decreased exponentially with increasing soil depth, but the rate of reduction differed at various spatial scales and in soil layers at different depths. For the deep soil core, the SOC content and the average rate of reduction with depth in the 0-15.5 m soil layer were significantly higher than the corresponding values of the 15.5-34.5 m and 34.5-204.5 m soil layers (p < 0.05). For the toposequences with varying slope aspects, SOC content in the 0-50 cm soil layer declined rapidly with increasing depth; while SOC content in the 50-200 cm soil layer showed relatively no change. There was no significant difference of average SOC content at depths of 0-200 cm for forestland and grassland considering slope aspects that differed or were the same (p > 0.05) due to the similar climatic conditions. However, SOC content within 0-500 cm soil profile under different land uses along the north-south transect exhibited a significant difference (p < 0.05), following the order of farmland (4.94 ± 1.23 g kg-1) > forestland (3.01 ± 1.45 g kg-1) > grassland (2.03 ± 0.68 g kg-1); moreover, the mean SOC content of the 0-500 cm soil profile generally decreased from south to north following the decreasing rainfall and temperature gradient. The average rates of reduction of SOC content in the 0-50 cm soil layer under different land uses (0.0807-0.1756 g kg-1 cm-1) were higher than the values of the 50-200 cm (0.0021-0.0154 g kg-1 cm-1) and 200-500 cm soil layers (0.0001-0.0017 g kg-1 cm-). The SOC content at the plot scale at different depths positively correlated with total nitrogen content. The SOC content at the slope scale was mainly affected by soil water content and saturated hydraulic conductivity, while that at the regional scale was impacted by climate, topography and soil water/clay content. Pedotransfer functions were applied to adequately simulate and predict SOC content at different spatial scales in the studied area, which could provide a foundation to build SOC prediction models and extrapolate the various spatial scales to other loess regions worldwide. Our findings demonstrate the importance of considering the scale effects for efficiently predicting the spatial patterns of SOC and can help in devising better policy to protect or enhance existing SOC stocks.

Fiber-based dynamically tunable Lyot filter for dual-wavelength and tunable single-wavelength mode-locking of fiber lasers.

We propose and demonstrate a novel dynamically tunable fiber-based Lyot filter for the realization of a dual-wavelength mode-locked fiber laser, operating at center wavelengths of 1535 nm and 1564 nm. The same laser cavity can also be operated in a single-wavelength mode-locked regime with a wavelength tuning range of 30 nm, from 1532 nm to 1562 nm. The proposed dynamically tunable Lyot-filter provides a simple setup for laser mode-locking using a single laser cavity design to generate dual-wavelength pulses, with the flexibility to also allow the generation of single-wavelength pulses with a continuously-tunable center wavelength.

Distributions of arsenic and other heavy metals, and health risk assessments for groundwater in the Guanzhong Plain region of China.

The aim of this study was to evaluate the quality of shallow groundwater and deep groundwater in the Guanzhong Plain region of China, as well as the related health risk to humans. In total, 130 groundwater samples were collected comprising 116 from shallow groundwater (dug wells) and 14 from deep groundwater (drilled wells). The water samples were analyzed to determine the levels of As and 12 other heavy metals (Al, Cd, Mn, Cr, V, Fe, Ni, Cu, Zn, Co, Pb, and Mo). The results showed that the concentrations of As and other heavy metals in the deep groundwater samples were lower than the safe limits, but the Cr concentrations in some shallow groundwater samples exceeded the safe limits. The heavy metal pollution index and heavy metal evaluation index both showed that As and other heavy metals were pollutants at low levels in all of the shallow and deep groundwater sample. Health risk assessments showed that the deep groundwater samples had no associated non-carcinogenic health risks, whereas the shallow groundwater samples had non-carcinogenic health risks due to contamination with Cr and As. Some shallow groundwater samples had associated carcinogenic health risks due to contamination with Cr and As, whereas the deep groundwater samples only had carcinogenic health risks because of contamination with Cr. These results suggest that local residents and government departments should be made aware of Cr and As pollution in shallow groundwater.

Identification of AcAP5 as a novel factor Xa inhibitor with both direct and allosteric inhibition.

Ancylostoma caninum anticoagulant peptide 5 (AcAP5) is a potent inhibitor for coagulation factor Xa (FXa). Previous studies show that AcAP5 binds to FXa at the active site, and/or the exosite. The active site-binding contributes to direct blocking of FXa catalytic activity, but the effect of exosite-binding and the underlying mechanism remain unknown. To investigate whether and how the exosite-binding affects FXa function, we prepared several AcAP5 mutants with modifications to the active site-binding or exosite-binding region. Their FXa-inhibiting and anticoagulant activities were examined both in vitro and in rabbit plasma, and the interactions with FXa were analyzed using in silico molecular modeling, docking, and molecular dynamics simulation. Mutants abolishing either active site- or exosite-binding resulted in a dramatic decrease in their anti-FXa and anticoagulant activities. Elongation of AcAP5 exosite-binding region also impaired the FXa-inhibiting activity. Computational analysis demonstrated that the conformation of FXa becomes more rigid due to exosite-binding with AcAP5, which consequently affects its catalytic activity. Our results suggest that both active site- and exosite-binding contribute to the FXa inhibitory activity of AcAP5.

Revelation of the dynamic progression of hypoxia-reoxygenation injury by visualization of the lysosomal hydrogen peroxide.

Hydrogen peroxide (H2O2) plays an important role in pathological conditions, such as cerebral ischemia-reperfusion (I-R) injury. Fluorescent probes may serve as valuable tools to detect the amount, temporal and spatial distribution of H2O2 in living cells. To investigate the role of lysosomal H2O2 involved in cerebral I-R injury, we designed and synthesized a lysosome-targetable two-photon fluorescent probe ztl-4, through expansion and substitution of the original pyridazinone scaffold, conjugation of electronic-donating aromatic ring and precise terminal modification of the alkyl linker. The probe ztl-4 exhibited fast, sensitive and highly selective response toward H2O2. ztl-4 could image exogenous H2O2 in SH-SY5Y cells and brain slices. In addition, ztl-4 was located in lysosomes with high colocalization coefficient compared with LysoTracker. ztl-4 was further applied for detecting the endogenous generation of H2O2 in SH-SY5Y cells subjected to oxygen and glucose deprivation (OGD) or OGD/reoxygenation (OGD/R) injury. Both OGD- and OGD/R-induced cell injury caused a time-dependent increase of H2O2 production within lysosomes. Moreover, OGD/R-treated cells showed much more amount of H2O2 than OGD-treated cells, indicating that reoxygenation will promote H2O2 accumulation in lysosomes of post-hypoxia cells. Therefore, the probe is suitable for monitoring the dynamic changes of lysosomal H2O2 in cells.

Effect of magnolol on cerebral injury and blood brain barrier dysfunction induced by ischemia-reperfusion in vivo and in vitro.

Magnolol, a neolignan compound isolated from traditional Chinese medicine Magnolia officinalis, has a potentially therapeutic influence on ischemic stroke. Previous studies have demonstrated that cerebral ischemia-reperfusion (I-R) and blood-brain barrier (BBB) are involved in the pathogeneses of stroke. Therefore, in vivo and in vitro studies were designed to investigate the effects of magnolol on I-R-induced neural injury and BBB dysfunction. In cerebral I-R model of mice, cerebral infarct volumes, brain water content, and the exudation of Evans blue were significantly reduced by intravenous injection with magnolol at the doses of 1.4, 7.0, and 35.0 µg/kg. When primary cultured microglial cells were treated with 1 µg/ml lipopolysaccharide (LPS) plus increasing concentrations of magnolol, ranging from 0.01 to 10 µmol/L, magnolol could statistically inhibit LPS-induced NO release, TNF-α secretion, and expression of p65 subunit of NF-κB in the nucleus of microglial cells. In the media of brain microvascular endothelial cells (BMECs), oxygen and glucose deprivation-reperfusion (OGD-R) could remarkably lead to the elevation of TNF-α and IL-1ß levels, while magnolol evidently reversed these effects. In BBB model in vitro, magnolol dose- and time-dependently declined BBB hyperpermeability induced by oxygen and glucose deprivation (OGD), OGD-R, and ephrin-A1 treatment. More importantly, magnolol could obviously inhibit phosphorylation of EphA2 (p-EphA2) not only in ephrin-A1-treated BMECs but also in cerebral I-R model of mice. In contrast to p-EphA2, magnolol significantly increased ZO-1 and occludin levels in BMECs subjected to OGD. Taken together, magnolol can protect neural damage from cerebral ischemia- and OGD-reperfusion, which may be associated with suppressing cerebral inflammation and improving BBB function.

Increased autophagic degradation contributes to the neuroprotection of hydrogen sulfide against cerebral ischemia/reperfusion injury.

Hydrogen sulfide (H2S), an endogenous gaseous signal molecule, exhibits protective effect against ischemic injury. However, its underlying mechanism is not fully understood. We have recently reported that exogenous H2S decreases the accumulation of autophagic vacuoles in mouse brain with ischemia/reperfusion (I/R) injury. To further investigate whether this H2S-induced reduction of autophagic vacuoles is caused by the decreased autophagosome synthesis and/or the increased autophagic degradation inautophagic flux, we performed in vitro and in vivo studies using SH-SY5Y cells for the oxygen and glucose deprivation/reoxygenation (OGD/R) and mice for the cerebral I/R, respectively. NaHS (a donor of H2S) treatment significantly increased cell viability and reduced cerebral infarct volume. NaHS treatment reduced the OGD/R-induced elevation in LC3-II (an autophagic marker), which was completely reversed by co-treatment with an autophagic flux inhibitor bafilomycin A1 (BafA1). However, H2S did not affect the OGD/R-induced increase of the ULK1 self-association and decrease of the ATG13 phosphorylation, which are the critical steps for the initiation of autophagosome formation. Cerebral I/R injury caused an increase in LC3-II, a decrease in p62 and the accumulation of autophagosomes in the cortex and the hippocampus, which were inhibited by NaHS treatment. This H2S-induced decline of LC3-II in ischemic brain was reversed by BafA1. Moreover, BafA1 treatment abolished the protection of H2S on the cerebral infarction. Collectively, the neuroprotection of exogenous H2S against ischemia/hypoxia and reperfusion/reoxygenation injury is mediated by the enhancement of autophagic degradation.

Increased Community-Associated Infections Caused by Panton-Valentine Leukocidin-Negative MRSA, Shanghai, 2005-2014.

During 2005-2014, community-associated methicillin-resistant Staphylococcus aureus infections increased in Shanghai, China. Most infections were caused by sequence type 59 S. aureus that lacked Panton-Valentine leukocidin. This finding challenges the notion that Panton-Valentine leukocidin is necessary for epidemiologic success of community-associated methicillin-resistant S. aureus.

Rational Design of Fluorescent Phthalazinone Derivatives for One- and Two-Photon Imaging.

Phthalazinone derivatives were designed as optical probes for one- and two-photon fluorescence microscopy imaging. The design strategy involves stepwise extension and modification of pyridazinone by 1) expansion of pyridazinone to phthalazinone, a larger conjugated system, as the electron acceptor, 2) coupling of electron-donating aromatic groups such as N,N-diethylaminophenyl, thienyl, naphthyl, and quinolyl to the phthalazinone, and 3) anchoring of an alkyl chain to the phthalazinone with various terminal substituents such as triphenylphosphonio, morpholino, triethylammonio, N-methylimidazolio, pyrrolidino, and piperidino. Theoretical calculations were utilized to verify the initial design. The desired fluorescent probes were synthesized by two different routes in considerable yields. Twenty-two phthalazinone derivatives were synthesized and their photophysical properties were measured. Selected compounds were applied in cell imaging, and valuable information was obtained. Furthermore, the designed compounds showed excellent performance in two-photon microscopic imaging of mouse brain slices.

Exogenous hydrogen sulfide attenuates cerebral ischemia-reperfusion injury by inhibiting autophagy in mice.

Hydrogen sulfide (H2S), the third gas transmitter, has been proven to be neuroprotective in cerebral ischemic injury, but whether its effect is mediated by regulating autophagy is not yet clear. The present study was undertaken to explore the underlying mechanisms of exogenous H2S on autophagy regulation in cerebral ischemia. The effects and its connection with autophagy of NaHS, a H2S donor, were observed through neurological deficits and cerebral infarct volume in middle cerebral artery occlusion (MCAO) mice; autophagy-related proteins and autophagy complex levels in the ischemic hemisphere were detected with Western blot assay. Compared with the model group, NaHS significantly decreased infarct volume and improved neurological deficits; rapamycin, an autophagy activator, abolished the effect of NaHS; NaHS decreased the expression of LC3-II and up-regulated p62 expression in the ischemic cortex 24 h after ischemia. However, NaHS did not significantly influence Beclin-1 expression. H2S has a neuroprotective effect on ischemic injury in MCAO mice; this effect is associated with its influence in down-regulating autophagosome accumulation.

AraC-Type Regulator Rsp Adapts Staphylococcus aureus Gene Expression to Acute Infection.

Staphylococcus aureus is an important human pathogen that can cause two categories of severe infections. Acute infections are characterized by pronounced toxin production, while chronic infections often involve biofilm formation. However, it is poorly understood how S. aureus controls the expression of genes associated with acute versus biofilm-associated virulence. We here identified an AraC-type transcriptional regulator, Rsp, that promotes the production of key toxins while repressing major biofilm-associated genes and biofilm formation. Genome-wide transcriptional analysis and modeling of regulatory networks indicated that upregulation of the accessory gene regulator (Agr) and downregulation of the ica operon coding for the biofilm exopolysaccharide polysaccharide intercellular adhesin (PIA) were central to the regulatory impact of Rsp on virulence. Notably, the Rsp protein directly bound to the agrP2 and icaADBC promoters, resulting in strongly increased levels of the Agr-controlled toxins phenol-soluble modulins (PSMs) and alpha-toxin and reduced production of PIA. Accordingly, Rsp was essential for the development of bacteremia and skin infection, representing major types of acute S. aureus infection. Our findings give important insight into how S. aureus adapts the expression of its broad arsenal of virulence genes to promote different types of disease manifestations and identify the Rsp regulator as a potential target for strategies to control acute S. aureus infection.

Species-abundance--seed-size patterns within a plant community affected by grazing disturbance.

Seed size has been advanced as a key factor that influences the dynamics of plant communities, but there are few empirical or theoretical predictions of how community dynamics progress based on seed size patterns. Information on the abundance of adults, seedlings, soil seed banks, seed rains, and the seed mass of 96 species was collected in alpine meadows of the Qinghai-Tibetan Plateau (China), which had different levels of grazing disturbance. The relationships between seed-mass-abundance patterns for adults, seedlings, the soil seed bank, and seed rain in the plant community were evaluated using regression models. Results showed that grazing levels affected the relationship between seed size and abundance properties of adult species, seedlings, and the soil seed bank, suggesting that there is a shift in seed-size--species-abundance relationships as a response to the grazing gradient. Grazing had no effect on the pattern of seed-size-seed-rain-abundance at four grazing levels. Grazing also had little effect on the pattern of seed-size--species-abundance and pattern of seed-size--soil-seed-bank-abundance in meadows with no grazing, light grazing, and moderate grazing), but there was a significant negative effect in meadows with heavy grazing. Grazing had little effect on the pattern of seed-size--seedling-abundance with no grazing, but had significant negative effects with light, moderate, and heavy grazing, and the |r| values increased with grazing levels. This indicated that increasing grazing pressure enhanced the advantage of smaller-seeded species in terms of the abundances of adult species, seedlings, and soil seed banks, whereas only the light grazing level promoted the seed rain abundance of larger-seeded species in the plant communities. This study suggests that grazing disturbances are favorable for increasing the species abundance for smaller-seeded species but not for the larger-seeded species in an alpine meadow community. Hence, there is a clear advantage of the smaller-seeded species over the larger-seeded species with increases in the grazing level.

Identification of antituberculosis agents that target ribosomal protein interactions using a yeast two-hybrid system.

Mycobacterium tuberculosis kills about 2 million people annually and antibiotic resistance is a cause of increased mortality. Therefore, development of new antituberculosis drugs is urgent for the control of widespread tuberculosis infections. For this purpose, we performed an innovative screen to identify new agents that disrupt the function of ribosomes in M. tuberculosis. Two bacterial ribosomal proteins L12 and L10 interact with each other and constitute the stalk of the 50S ribosomal subunit, which recruits initiation and elongation factors (EFs) during translation. Therefore, the L12-L10 interaction should be essential for ribosomal function and protein synthesis. We established a yeast two-hybrid system to identify small molecules that block the interaction between L12 and L10 proteins from M. tuberculosis. Using this system, we identified two compounds T766 and T054 that show strong bactericidal activity against tuberculosis but with low toxicity to mice and other bacterial strains. Moreover, using surface plasmon resonance (SPR) assay, we have demonstrated that these compounds bind specifically to L12 to disrupt L12-L10 interaction. Overproduction of L12 protein, but not L10, lowers the antibacterial activity of T766 and T054, indicating that the ribosome is likely the cellular target. Therefore, our data demonstrate that this yeast two-hybrid system is a useful tool to identify unique antituberculosis agents targeting the ribosomal protein L12-L10 interaction.

Mechanisms of linezolid resistance in staphylococci and enterococci isolated from two teaching hospitals in Shanghai, China.

BACKGROUND: Linezolid is one of the most effective treatments against Gram-positive pathogens. However, linezolid-resistant/intermediate strains have recently emerged in worldwide. The purpose of this study was to analyse the prevalence and resistance mechanisms of linezolid-resistant/intermediate staphylococci and enterococci in Shanghai, China. RESULTS: Thirty-two linezolid-resistant/intermediate strains, including 14 Staphylococcus capitis, three Staphylococcus aureus, 14 Enterococcus faecalis and one Enterococcus faecium clinical isolates, were collected in this study which displayed linezolid MICs of 8 to 512 µg/ml, 8-32 µg/ml, 4-8 µg/ml and 4 µg/ml, respectively. All linezolid-resistant S. capitis isolates had a novel C2131T mutation and a G2603T mutation in the 23S rRNA region, and some had a C316T (Arg106Cys) substitution in protein L4 and/or harboured cfr. Linezolid-resistant S. aureus isolates carried a C389G (Ala130Gly) substitution in protein L3, and/or harboured cfr. The cfr gene was flanked by two copies of the IS256-like element, with a downstream orf1 gene. Linezolid-resistant/intermediate enterococci lacked major resistance mechanisms. The semi-quantitative biofilm assay showed that 14 linezolid-resistant E. faecalis isolates produced a larger biofilm than linezolid-susceptible E. faecalis strains. Transmission electron microscopy showed the cell walls of linezolid-resistant/intermediate strains were thicker than linezolid-susceptible strains. CONCLUSION: Our data indicated that major resistance mechanisms, such as mutations in 23S rRNA and ribosomal proteins L3 and L4, along with cfr acquisition, played an important role in linezolid resistance. Secondary resistance mechanisms, such as biofilm formation and cell wall thickness, should also be taken into account.

Effects of plant diversity and community structure on ecosystem multifunctionality under different grazing potentials in the eastern Eurasian steppe.

Grazing potential represents the potential carrying capacity of steppe livestock production. Understanding the impact of changes in plant diversity and community structure on ecosystem multifunctionality (EMF) at different grazing potentials is crucial for the sustainable management of steppe ecosystems. We examined the associations between plant diversity, community structure, above-ground ecosystem multifunctionality (AEMF), and below-ground ecosystem multifunctionality (BEMF) at various grazing potentials. Our assessment employed generalized linear mixed-effects models and structural equation models to determine the impact of these factors on ecosystem multifunctionality. Our study results indicated that ecosystem multifunctionality differed depending on the level of grazing potential and decreased as grazing potential declined. The impact of plant diversity and community structure on above- and below-ground ecosystem multifunctionality varied. Plant diversity and community structure correlated more with AEMF than BEMF. Plant diversity had the most significant effect on EMF under high grazing potential, while community structure had the greatest effect on EMF under moderate and low grazing potential. These improve our understanding of the correlation between steppe plant diversity, community structure, and above- and below-ground ecosystem multifunctionality. This understanding is necessary to develop strategies to increase plant diversity or regulate community structure and the sustainability of steppes.

Predicting the potential risk of Caragana shrub encroachment in the Eurasian steppe under anthropogenic climate change.

Climate change and human activities drive widespread shrub encroachment in global grassland ecosystems, particularly in the Eurasian steppe. Caragana shrubs, the primary contributors to shrub encroachment in this region, play a crucial role in shaping the ecosystem's structure and function. Future changes in the suitable distribution range of Caragana species will directly affect the ecological security and sustainable socio-economic development of the Eurasian steppe ecosystem. We used an ensemble modeling approach to predict Caragana shrub-dominated plant communities' current and future distribution in three major steppe subregions: the Black Sea-Kazakhstan steppe, the Tibetan Plateau steppe, and the Central Asian steppe. We assessed the potential risk of Caragana shrub encroachment by predicting changes in the suitable distribution area of 19 Caragana shrub species under future climate changes. Our research findings suggest that the expansion of Caragana species in different subregions of the Eurasian steppe is influenced by the effects of climate change in various ways. The distribution of Caragana species is primarily influenced by precipitation and temperature, and the global human modification (ghm) has a significant impact on the Central Asian and Tibetan Plateau subregions. Minimal changes are expected in the Black Sea-Kazakhstan subregion, a slight increase on the Tibetan Plateau, and a substantial rise in the Central Asian subregion, which suggests a higher potential risk of Caragana species shrub encroachment in that area. Our research provides valuable insights into the response of Caragana shrub encroachment to changing climates and human activities. It also has implications for the sustainable management of different areas of the vast Eurasian steppe ecosystem.