Effective therapies for sickle cell disease: are we there yet?

Sickle cell disease (SCD) is a common genetic blood disorder associated with acute and chronic pain, progressive multiorgan damage, and early mortality. Recent advances in technologies to manipulate the human genome, a century of research and the development of techniques enabling the isolation, efficient genetic modification, and reimplantation of autologous patient hematopoietic stem cells (HSCs), mean that curing most patients with SCD could soon be a reality in wealthy countries. In parallel, ongoing research is pursuing more facile treatments, such as in-vivo-delivered genetic therapies and new drugs that can eventually be administered in low- and middle-income countries where most SCD patients reside.

Therapeutic Effects of Hematopoietic Stem Cell Derived From Gene-Edited Mice on ß654-Thalassemia.

ß-thalassemia is an inherited blood disease caused by reduced or inadequate ß-globin synthesis due to ß-globin gene mutation. Our previous study developed a gene-edited mice model (ß654-ER mice) by CRISPR/Cas9-mediated genome editing, targeting both the ßIVS2-654 (C > T) mutation site and the 3' splicing acceptor site at 579 and corrected abnormal ß-globin mRNA splicing in the ß654-thalassemia mice. Herein, we further explored the therapeutic effect of the hematopoietic stem cells (HSCs) from ß654-ER mice on ß-thalassemia by consecutive HSC transplantation. The results indicated that HSC transplantation derived from gene-edited mice can significantly improve the survival rate of mice after lethal radiation doses and effectively achieve hematopoietic reconstruction and long-term hematopoiesis. Clinical symptoms, including hematologic parameters and tissue pathology of transplanted recipients, were significantly improved compared to the non-transplanted ß654 mice. The therapeutic effect of gene-edited HSC transplantation demonstrated no significant difference in hematological parameters and tissue pathology compared with wild-type mouse-derived HSCs. Our data revealed that HSC transplantation from gene-edited mice completely recovered the ß-thalassemia phenotype. Our study systematically investigated the therapeutic effect of HSCs derived from ß654-ER mice on ß-thalassemia and further confirmed the efficacy of our gene-editing approach. Altogether, it provided a reference and primary experimental data for the clinical usage of such gene-edited HSCs in the future.

Autologous gene therapy for hemoglobinopathies: From bench to patient's bedside.

In recent years, a growing number of clinical trials have been initiated to evaluate gene therapy approaches for the treatment of patients with transfusion-dependent ß-thalassemia and sickle cell disease (SCD). Therapeutic modalities being assessed in these trials utilize different molecular techniques, including lentiviral vectors to add functional copies of the gene encoding the hemoglobin ß subunit in defective cells and CRISPR-Cas9, transcription activator-like effector protein nuclease, and zinc finger nuclease gene editing strategies to either directly address the underlying genetic cause of disease or induce fetal hemoglobin production by gene disruption. Here, we review the mechanisms of action of these various gene addition and gene editing approaches and describe the status of clinical trials designed to evaluate the potentially for these approaches to provide one-time functional cures to patients with transfusion-dependent ß-thalassemia and SCD.

Regulatory Assessment of Casgevy for the Treatment of Transfusion-Dependent ß-Thalassemia and Sickle Cell Disease with Recurrent Vaso-Occlusive Crises.

Sickle cell disease (SCD) and transfusion-dependent ß-thalassemia (TDT) are hereditary haemoglobinopathies characterized by a reduction in functional ß-globin chains. Both conditions cause tiredness and increase susceptibility to infection, which can lead organ failure, significantly reducing life expectancy and typically requiring those affected to undergo regular erythrocyte transfusion. Recently, a novel therapeutic treatment for SCD and TDT was approved by the UK regulatory body (Medicines and Healthcare products Regulatory Agency; MHRA). Exagamglogene autotemcel (Casgevy) is the first licensed therapy globally to utilize CRIPSR/Cas9 technology and induces an increase in expression of γ-globin chains to compensate for the reduction in functional ß-globin. Casgevy represents a first-in-class therapeutic, and numerous considerations were made by the MHRA throughout its assessment of the medicine. These include, but are not limited to, the risk of tumorigenicity and off-target editing, a limited cohort size, the validity of proposed dosing and the conduction of only single-arm studies. The MHRA's analyses of the data to support the proposed indications are presented and discussed throughout this manuscript. Overall, the sponsors claims were considered well supported by their data, and Casgevy was licensed for the treatment of TDT or SCD in patients 12 years of age and older for whom hematopoietic stem cell (HSC) transplantation is appropriate, but a human leukocyte antigen-matched related HSC donor is not available.

Epigenetic inactivation of ERF reactivates γ-globin expression in ß-thalassemia.

The fetal-to-adult hemoglobin switch is regulated in a developmental stage-specific manner and reactivation of fetal hemoglobin (HbF) has therapeutic implications for treatment of ß-thalassemia and sickle cell anemia, two major global health problems. Although significant progress has been made in our understanding of the molecular mechanism of the fetal-to-adult hemoglobin switch, the mechanism of epigenetic regulation of HbF silencing remains to be fully defined. Here, we performed whole-genome bisulfite sequencing and RNA sequencing analysis of the bone marrow-derived GYPA+ erythroid cells from ß-thalassemia-affected individuals with widely varying levels of HbF groups (HbF ≥ 95th percentile or HbF ≤ 5th percentile) to screen epigenetic modulators of HbF and phenotypic diversity of ß-thalassemia. We identified an ETS2 repressor factor encoded by ERF, whose promoter hypermethylation and mRNA downregulation are associated with high HbF levels in ß-thalassemia. We further observed that hypermethylation of the ERF promoter mediated by enrichment of DNMT3A leads to demethylation of γ-globin genes and attenuation of binding of ERF on the HBG promoter and eventually re-activation of HbF in ß-thalassemia. We demonstrated that ERF depletion markedly increased HbF production in human CD34+ erythroid progenitor cells, HUDEP-2 cell lines, and transplanted NCG-Kit-V831M mice. ERF represses γ-globin expression by directly binding to two consensus motifs regulating γ-globin gene expression. Importantly, ERF depletion did not affect maturation of erythroid cells. Identification of alterations in DNA methylation of ERF as a modulator of HbF synthesis opens up therapeutic targets for ß-hemoglobinopathies.

A synonymous variant is unmasked in thalassaemia.

The genetic underpinnings of beta-thalassaemia encompass a myriad of molecular mechanisms. The ability of synonymous mutations, an often-overlooked category of variants, to influence ß-globin expression and phenotypic disease is highlighted by this report by Gorivale et al. Commentary on: Gorivale et al. When a synonymous mutation breaks the silence in a thalassaemia patient. Br J Haematol 2024;204:677-682.

Reducing the transcriptional read-through rate of a lentiviral vector for ß-thalassemia gene therapy.

BACKGROUND: LentiGlobin BB305 is a self-inactivating lentiviral vector carrying a human ß-globin expressing cassette for treating ß-thalassemia. Initially, a 2 × 250 bp chicken Locus Control Region fragment of cHS4, functioning as an insulator, was placed at its ΔU3, which was removed after the first clinical trial led by a French team to avoid abnormal splicing, etc. This action could potentially lead to an increasing risk of the transcriptional read-through rate driven by the ß-globin promoter to a significant level, posing a biosafety risk in clinical trials. METHODS: In the present study, a read-through reducing agent (C-U+ or WPRE) was designed to be placed at the 3' UTR of the ß-globin gene. The Enhancer Activities and/or Transcriptional Read-Through (EATRT) rate at the mRNA level and the protein expression level regarding lentiviral preparation titer were examined. RESULTS: We found that the insertion of the element (C-U+ or WPRE) reduced the EATRT effectively by 53% or 41%, respectively. C-U+ has less impact on virus package efficiency. Furthermore, there was no significant difference in the protein expression level after the C-U+ or WPRE insertion. CONCLUSIONS: The results of the present study show that inserting C-U+ or WPRE before the polyA sequence of the BB305 would reduce the EATRT rate at no cost of its expressing efficacy and viral preparation titers. Thus, we present an alternative improvement for a safer lentiviral vector for ß-thalassemia clinical trials.

Identification and characterization of CHD4-associated eRNA as a novel modulator of fetal hemoglobin levels in ß-thalassemia.

Fetal-to-adult hemoglobin switching is controlled by programmed silencing of γ-globin while the re-activation of fetal hemoglobin (HbF) is an effective strategy for ameliorating the clinical severity of ß-thalassemia and sickle cell disease. The identification of enhancer RNAs (eRNAs) related to the fetal (α2γ2) to adult hemoglobin (α2ß2) switching remains incomplete. In this study, the transcriptomes of GYPA+ cells from six ß-thalassemia patients with extreme HbF levels were sequenced to identify differences in patterns of noncoding RNA expression. It is interesting that an enhancer upstream of CHD4, an HbF-related core subunit of the NuRD complex, was differentially transcribed. We found a significantly positive correlation of eRNA-CHD4 enhancer-gene interaction using the public database of FANTOM5. Specifically, the eRNA-CHD4 expression was found to be significantly higher in both CD34+ HSPCs and HUDEP-2 than those in K562 cells which commonly expressed high level of HbF, suggesting a correlation between eRNA and HbF expression. Furthermore, prediction of transcription binding sites of cis-eQTLs and the CHD4 genomic region revealed a putative interaction site between rs73264846 and ZNF410, a known transcription factor regulating HbF expression. Moreover, in-vitro validation showed that the inhibition of eRNA could reduce the expression of HBG expression in HUDEP-2 cells. Taken together, the findings of this study demonstrate that a distal enhancer contributes to stage-specific silencing of γ-globin genes through direct modulation of CHD4 expression and provide insights into the epigenetic mechanisms of NuRD-mediated hemoglobin switching.

BACH1 regulates erythrophagocytosis and iron-recycling in ß-thalassemia.

Macrophages play essential roles in erythrophagocytosis and iron recycling. ß-thalassemia is characterized by a genetic defect in hemoglobin synthesis, which increases the rate of iron recycling. We previously showed that reduced expression of the BTB and CNC homolog 1 (BACH1) gene leads to increased phagocytosis of abnormal RBCs by activated monocytes. However, the mechanisms underlying this abnormal RBC clearance remained unclear. Herein, the spleen and bone marrow cells of ß-thalassemic mice were examined for erythrophagocytosis CD markers and iron-recycling genes. Higher expression levels of CD47 and CD163 on RBCs and macrophages, respectively, were observed in ß-thalassemic mice than in wild-type cells. The decreased expression of BACH1 caused an increase in Nrf2, Spic, Slc40a1, and HMOX1 expression in splenic red pulp macrophages of thalassemic mice. To investigate BACH1 regulation, a macrophage cell line was transfected with BACH1-siRNA. Decreased BACH1 expression caused an increase in CD163 expression; however, the expression levels were lower when the cells were cultured in media supplemented with ß-thalassemia/HbE patient plasma. Additionally, the iron recycling-related genes SPIC, SLC40A1, and HMOX1 were significantly upregulated in BACH1-suppressed macrophages. Our findings provide insights into BACH1 regulation, which plays an important role in erythrophagocytosis and iron recycling in thalassemic macrophages.

Cellular and animal models for the investigation of ß-thalassemia.

ß-Thalassemia is a genetic form of anemia due to mutations in the ß-globin gene, that leads to ineffective and extramedullary erythropoiesis, abnormal red blood cells and secondary iron-overload. The severity of the disease ranges from mild to lethal anemia based on the residual levels of globins production. Despite being a monogenic disorder, the pathophysiology of ß-thalassemia is multifactorial, with different players contributing to the severity of anemia and secondary complications. As a result, the identification of effective therapeutic strategies is complex, and the treatment of patients is still suboptimal. For these reasons, several models have been developed in the last decades to provide experimental tools for the study of the disease, including erythroid cell lines, cultures of primary erythroid cells and transgenic animals. Years of research enabled the optimization of these models and led to decipher the mechanisms responsible for globins deregulation and ineffective erythropoiesis in thalassemia, to unravel the role of iron homeostasis in the disease and to identify and validate novel therapeutic targets and agents. Examples of successful outcomes of these analyses include iron restricting agents, currently tested in the clinics, several gene therapy vectors, one of which was recently approved for the treatment of most severe patients, and a promising gene editing strategy, that has been shown to be effective in a clinical trial. This review provides an overview of the available models, discusses pros and cons, and the key findings obtained from their study.

Two novel deletion mutations in ß-globin gene cause ß-thalassemia trait in two Chinese families.

BACKGROUND: ß-Thalassemia is mainly caused by point mutations in the ß-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered. RESULTS: In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed ßCD59) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed ßCD128-134) in family A and B, respectively. Both the two novel mutations lead to ß-thalassemia trait. However, when compounded with other ß0-thalassemia, it may behave with ß-thalassemia intermedia or ß-thalassemia major. CONCLUSION: Our study broadens the variants spectral of ß-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis.

COVID-19 and ß-thalassemia: in lieu of evidence and vague nexus.

Coronavirus disease 19 (COVID-19) is an infectious disease caused by severe acute respiratory coronavirus 2 (SARS-CoV-2) causing acute systemic disorders and multi-organ damage. ß-thalassemia (ß-T) is an autosomal recessive disorder leading to the development of anemia. ß-T may lead to complications such as immunological disorders, iron overload, oxidative stress, and endocrinopathy. ß-T and associated complications may increase the risk of SARS-CoV-2, as inflammatory disturbances and oxidative stress disorders are linked with COVID-19. Therefore, the objective of the present review was to elucidate the potential link between ß-T and COVID-19 regarding the underlying comorbidities. The present review showed that most of the ß-T patients with COVID-19 revealed mild to moderate clinical features, and ß-T may not be linked with Covid-19 severity. Though patients with transfusion-dependent ß-T (TDT) develop less COVID-19 severity compared to non-transfusion-depend ß-T(NTDT), preclinical and clinical studies are recommended in this regard.

Reliability of hemoglobin A2 value as measured by the Premier Resolution system for screening of ß-thalassemia carriers.

OBJECTIVES: Accurate quantification of hemoglobin (Hb) A2 is vital for diagnosing ß-thalassemia carriers. This study aimed to assess the precision and diagnostic utility of HbA2 measurements using the new high-performance liquid chromatography (HPLC) method, Premier Resolution, in comparison to capillary electrophoresis (CE). METHODS: We analyzed 418 samples, previously identified as A2A by CE, using Premier Resolution-HPLC. We compared the results, established correlations, and determined an optimal HbA2 cutoff value for ß-thalassemia screening. Additionally, we prospectively evaluated the chosen cutoff value in 632 samples. Mutations in the ß- and α-globin genes were identified using polymerase chain reaction (PCR) techniques and DNA sequencing. RESULTS: HbA2 levels were consistently higher with Premier Resolution, yet there was a significant correlation with CE in all samples (bias, -0.33; r, 0.991), ß-thalassemia (bias, -0.27; r, 0.927), and non-ß-thalassemia carriers (bias, -0.36; r, 0.928). An HbA2 cutoff value of ≥4.0 % for ß-thalassemia screening achieved 100 % sensitivity and 99.6 % specificity. Further validation yielded sensitivity, specificity, positive predictive value, negative predictive value, and accuracy of 97.3 , 99.8, 97.3, 99.8, and 99.7 %, respectively. We also identified a rare ß-Hb variant, Hb La Desirade [HBB:c.389C>T], associated with ß-thalassemia and co-inherited with a single α-globin gene. CONCLUSIONS: The Premier Resolution HPLC is a reliable and accurate method for routine ß-thalassemia carrier screening, aligning with existing CE methods.

Appropriateness of the EQ-5D-5L in capturing health-related quality of life in individuals with transfusion-dependent ß-thalassemia: a mixed methods study.

BACKGROUND: Individuals with transfusion-dependent ß-thalassemia (TDT) experience symptoms and functional impacts that reduce their health-related quality of life. However, EQ-5D-derived health utility index scores in TDT often indicate good HRQoL, suggesting the EQ-5D may not adequately capture the impact of TDT. This study explored the disease and treatment burden of TDT and examined the appropriateness of the EQ-5D-5L descriptive system (DS) in measuring HRQoL in TDT. METHODS: Adults with TDT in the United Kingdom, United States, and France completed a background questionnaire and EQ-5D-5L DS, followed by 60-minute semi-structured interviews on symptoms and HRQoL impacts of TDT (concept elicitation) and appropriateness of EQ-5D-5L DS (cognitive debrief). Transcribed interviews were analyzed using thematic and content analyses. The relationship between TDT symptoms and impacts were summarized in a conceptual model. EQ-5D-5L DS was mapped to concepts identified in the qualitative data to assess its capture of HRQoL concepts. Participants' EQ-5D-5L DS scores were compared to their qualitative descriptions for each dimension to assess their concordance. RESULTS: Thirty participants in the United States (n = 14 [46.7%]), United Kingdom. (n = 12 [40.0%]), and France (n = 4 [13.3%]) completed the study (73.3% female; mean age = 28.4 years [standard deviation (SD) = 5.1]; mean annual red blood cell transfusion [RBCT] frequency = 18.4 [SD = 7.6]). Participants reported TDT symptoms and impacts on HRQoL, all fluctuating across the RBCT cycle. EQ-5D-5L DS did not fully capture 11 of 16 (68.8%) HRQoL concepts reported. Most participants (n = 20/27 [74.1%]) reported that EQ-5D-5L DS did not capture important aspects of living with TDT, and 42.9% (n = 12/28) reported negative/neutral overall impressions of EQ-5D-5L DS. The highest degree of discordance between participants' qualitative data and EQ-5D-5L DS dimension scores was observed with mobility (42.3%) and self-care (34.6%), where the qualitative descriptions relating to these dimensions were worse than their quantitative scores. CONCLUSION: Current findings suggest that EQ-5D-5L DS lacks content validity and the derived health utility index score may not fully represent the burden of disease in TDT.

Research on the clinical factors of cardiac iron deposition in children with beta-thalassemia major.

Magnetic resonance imaging (MRI) T2* is the gold standard for detecting iron deposition in cardiac tissue, but the technique has limitations and cannot be fully performed in paediatric thalassemia patients. The aim of this study was to analyse clinical data to identify other predictors of cardiac iron deposition. A retrospective analysis was performed on 370 children with ß-TM. According to the cardiac MRI results, patients were allocated to a cardiac deposition group and noncardiac deposition group. Multivariate analysis revealed that genotype and corrected QT interval were associated with cardiac iron deposition, indicating that the-ß0/ß0 genotype conferred greater susceptibility to cardiac iron deposition. Receiver operating characteristic curve (ROC) analysis was performed, and the area under the curve (AUC) of genotype was 0.651. The AUC for the corrected QT interval was 0.711, at a cut-off value of 418.5 ms. ROC analysis of the combined genotype and corrected QT interval showed an AUC of 0.762 with 81.3% sensitivity and 64.7% specificity. Compared to patients with the ß+/ß+ and ß0ß+ genotypes, ß0ß0 children with ß-TM were more likely to have cardiac iron deposition.  Conclusion: The genotype and QTc interval can be used to predict cardiac iron deposition in children with ß-TM who are unable to undergo MRI T2 testing.

Transcriptional Repressor BCL11A in Erythroid Cells.

BCL11A, a zinc finger repressor, is a stage-specific transcription factor that controls the switch from fetal (HbF, α2γ2) to adult (HbA, α2ß2) hemoglobin in erythroid cells. While BCL11A was known as a factor critical for B-lymphoid cell development, its relationship to erythroid cells and HbF arose through genome-wide association studies (GWAS). Subsequent work validated its role as a silencer of γ-globin gene expression in cultured cells and mice. Erythroid-specific loss of BCL11A rescues the phenotype of engineered sickle cell disease (SCD) mice, thereby suggesting that downregulation of BCL11A expression might be beneficial in patients with SCD and ß-thalassemia. Common genetic variation in GWAS resides in an erythroid-specific enhancer within the BCL11A gene that is required for its own expression. CRISPR/Cas9 gene editing of the enhancer revealed a GATA-binding site that confers a large portion of its regulatory function. Disruption of the GATA site leads to robust HbF reactivation. Advancement of a guide RNA targeting the GATA-binding site in clinical trials has recently led to approval of first-in-man use of ex vivo CRISPR editing of hematopoietic stem/progenitor cells (HSPCs) as therapy of SCD and ß-thalassemia. Future challenges include expanding access and infrastructure for delivery of genetic therapy to eligible patients, reducing potential toxicity and costs, exploring prospects for in vivo targeting of hematopoietic stem cells (HSCs), and developing small molecule drugs that impair function of BCL11A protein as an alternative option.

Technically feasible solutions to challenges in preimplantation genetic testing for thalassemia: experiences of multiple centers between 2019 and 2022.

PURPOSE: In clinical practice, the success of preimplantation genetic testing for monogenic diseases (PGT-M) for thalassemia was hindered by the absence of probands, incomplete family members, or failure in detecting embryonic gene mutation sites. This study aimed to address these issues. METHODS: This retrospective study included 342 couples undergoing PGT-M for α- or ß-thalassemia at three reproductive medicine centers from 2019 to 2022. Various methods were used to construct parental haplotypes. A total of 1778 embryos were analyzed and selected for transfer based on chromosomal ploidy and PGT-M results. Follow-up involved amniocentesis results and clinical outcomes. RESULTS: Haplotypes were established using DNA samples from probands or parents, as well as sibling blood samples, single sperm, and affected embryos, achieving an overall success rate was 99.4% (340/342). For α-thalassemia and ß-thalassemia, the concordance between embryo single nucleotide polymorphism (SNP) haplotype analysis results and mutation loci detection results was 93.8% (1011/1078) and 98.2% (538/548), respectively. Multiple annealing and looping-based amplification cycles (MALBAC) showed a higher whole genome amplification success rate than multiple displacement amplification (MDA) (98.8% (1031/1044) vs. 96.2% (703/731), p < 0.001). Amniocentesis confirmed PGT-M outcomes in 100% of cases followed up (99/99). CONCLUSION: This study summarizes feasible solutions to various challenging scenarios encountered in PGT-M for thalassemia, providing valuable insights to enhance success rate of PGT-M in clinical practice.

Splice Acceptor Mutation [HBB:c.93-2A > T] in a Patient with Hb S/ß0-Thalassemia.

We report a case of Hb S/ß0-thalassemia (Hb S/ß0-thal) in a patient who is a compound heterozygote for the Hb Sickle mutation (HBB:c.20A > T) and a mutation of the canonical splice acceptor sequence of IVS1 (AG > TG, HBB:c.93-2A > T). This is the fifth mutation involving the AG splice acceptor site of IVS1, all of which prevent normal splicing and cause ß0-thal.

Premarital Screening is Pivotal in Reducing the Births of Babies Affected with Thalassemia Major in Iraq.

Thalassemia major is one of the health problems in Iraq, especially in Kurdistan. Pre-marriage mandatory preventive screening program was established in Kurdistan in 2008, which allowed us to study the prevalence of different hemoglobinopathies among newly married young adults in this region. A total of 1154 subjects (577 couples) attending the Koya district, premarital Health center, were screened using red cell indices. Those who had mean corpuscular volume (MCV)<80 fl and mean corpuscular hemoglobin (MCH)<27 pg had high-performance liquid chromatography and iron studies. Out of 1154 individuals that were evaluated, 183 (11.9%) had low MCV and MCH. Of the former 183 subjects, 69 (5.97%) had ß-thalassemia trait, 10 (0.86%) had δß-thalassemia trait, and no other hemoglobinopathies were recorded in our study. There was second-degree consanguinity in 4.7% of all 577 couples. In two couples, both partners had ß-thalassemia trait and both were consanguineous. Both couples decided to separate after counseling. Based on the current study, the role of the premarital screening program in decreasing the number of new thalassemia major cases among the Kurdish population is laudable. Therefore, mandatory premarital screening is advised in all parts of Iraq.

A Novel 165 Kb Duplication Involving the α-Globin Gene Cluster Is Identified by Low-Pass Whole Genome Sequencing in a Chinese Thalassemia Intermedia Patient.

Copy number variations (CNVs) involving the α-globin gene cluster can lead to an imbalance in the proportion of α- and ß-globin chains and consequently cause clinical symptoms of ß-thalassemia. In our case, a 6-year-old boy, clinically diagnosed with ß thalassemia intermedia, was admitted for further genetic diagnosis with his family. Targeted sequencing and third generation sequencing (TGS) were used to detect the possible variants of the thalassemia genes. Low-pass whole genome sequencing (lpWGS) was conducted to specify the exact location of relevant CNVs across the genome, which was then validated by multiplex ligation-dependent probe amplification.The results revealed that the patient had a heterozygous ß0 mutation of Codon17 (A > T) and a full duplication of the α-globin gene cluster, inherited from his mother and father, respectively. Besides, a novel point mutation within the 5' untranslated region of ß-Globin (HBB: c. -175 (G > A) was only detected in the patient. This study suggests that lpWGS seems a powerful alternative to detect large CNVs related to thalassemia with second intention for more information of the breakpoints and a simultaneous genome-scale detection of other pathogenic CNVs.