Primates and disability: Behavioral flexibility and implications for resilience to environmental change.

Congenital malformations, conditions, injuries, and illness can lead to long-term physical impairment and disability in nonhuman primates. How individual primates change their behaviors flexibly to compensate for their disabilities can inform our understanding of their resilience and ability to adjust to environmental change. Here, we synthesize the literature on nonhuman primates and disability, addressing the questions: how does disability influence behavior in primates? What insights can we take from the literature to better understand and predict the capacity of primates to modify their behaviors in the face of human-induced environmental change? We conducted a systematic review of the literature on spontaneous physical impairment and disability in captive, free-ranging, and wild primates. We surveyed 2807 articles on Web of Science and Scopus and identified 114 studies that fit our predetermined inclusion criteria. Behavioral plasticity, maternal and conspecific care, and the potential for innovation of novel behaviors allow many primates with disabilities to compensate when faced with challenges that are outside the scope of usual circumstances. We also found that 60% of the publications connected primate physical impairment and disability to human activities, suggesting an entangled relationship among humans, the environment, and primate disability. Disability and physical impairments provide an opportunity to examine how primates modify their behavior when presented with challenging conditions, and their potential resilience to a changing environment.

Mothers of disabled infants had higher cortisol levels in a free-ranging group of Japanese macaques (Macaca fuscata).

Glucocorticoids (GCs) are hormones released in response to stressors and can provide insight into an organism's physiological well-being. Experiencing chronic challenges to homeostasis is associated with significant deviations from baseline fecal GCs (fGCs) in many species, providing a noninvasive biomarker for assessing stress. In the group of free-ranging Japanese macaques (Macaca fuscata) at the Awajishima Monkey Center in Japan, ~17% have congenital limb malformations. We collected 646 fecal samples from 27 females over three consecutive birth seasons (May-August) and analyzed them using enzyme immunoassay to extract fGCs. We explored the relationship between fGC levels and individual (physical impairment and reproductive status), social (dominance rank and availability of kin for social support), and ecological variables (exposure to potential predators, rainfall, and wild fruit availability). A disabled infant was associated significantly with higher fGC in the mother; however, physical impairment in adult females was not significantly related to fGC levels. Females with higher dominance rank had significantly lower fGC levels than lower ranking females. Other factors did not relate significantly to fGC. These results suggest that providing care that meets the support needs of disabled infants poses a physiological challenge for mothers and suggests that physically impaired adults are able to effectively compensate for their disabilities with behavioral plasticity. Once an individual with congenital limb malformations survives infancy through their mother's care, physical impairment does not appear to influence fGC values, while social variables like dominance rank significantly influenced cortisol values in free-ranging female Japanese macaques.

Monoallelic and biallelic variants in LEF1 are associated with a new syndrome combining ectodermal dysplasia and limb malformations caused by altered WNT signaling.

PURPOSE: LEF1 encodes a transcription factor acting downstream of the WNT-ß-catenin signaling pathway. It was recently suspected as a candidate for ectodermal dysplasia in 2 individuals carrying 4q35 microdeletions. We report on 12 individuals harboring LEF1 variants. METHODS: High-throughput sequencing was employed to delineate the genetic underpinnings of the disease. Cellular consequences were characterized by immunofluorescence, immunoblotting, pulldown assays, and/or RNA sequencing. RESULTS: Monoallelic variants in LEF1 were detected in 11 affected individuals from 4 unrelated families, and a biallelic variant was detected in an affected individual from a consanguineous family. The phenotypic spectrum includes various limb malformations, such as radial ray defects, polydactyly or split hand/foot, and ectodermal dysplasia. Depending on the type and location of LEF1 variants, the inheritance of this novel Mendelian condition can be either autosomal dominant or recessive. Our functional data indicate that 2 molecular mechanisms are at play: haploinsufficiency or loss of DNA binding are responsible for a mild to moderate phenotype, whereas loss of ß-catenin binding caused by biallelic variants is associated with a severe phenotype. Transcriptomic studies reveal an alteration of WNT signaling. CONCLUSION: Our findings establish mono- and biallelic variants in LEF1 as a cause for a novel syndrome comprising limb malformations and ectodermal dysplasia.

Nonframeshifting indel variations in polyalanine repeat of HOXD13 gene underlies hereditary limb malformation for two Chinese families.

BACKGROUND: Polydactyly and syndactyly are the most common hereditary limb malformations. Molecular genetic testing is of great significance for hereditary limb malformations, which can establish prognosis and recurrence risk of surgical intervention. METHODS: The present study aimed to identify the genetic etiologies of a three-generation family with postaxial polydactyly and a four-generation family with postaxial syndactyly. Whole exome sequencing was used, followed by standard mutation screening procedure, Sanger sequencing and bioinformatics analysis. RESULTS: Two nonframeshifting insertion/deletion (indel) mutations in HOXD13 (c.206_207ins AGCGGCGGCTGCGGCGGCGGCGGC:p.A68insAAAAAAAA or c.171_182delGGCGGCGGCGGC: p.56_60delAAAA) were successfully identified as the pathogenic mutation. The two nonframeshifting indel mutations led to truncation or expansion of homopolymeric alanine (Poly-Ala) repeats of HOXD13 proteins. Sequence alignment of HOXD13 protein among many different species for Poly-Ala position is highly conserved. Hypothetical three-dimensional (3-D) structural analysis further showed mutant HOXD13 proteins (p.A68insAAAAAAAA and p.56_60delAAAA) converted the disordered fragment into a short ß-strand (residues 63-68 or residues 64-68), thereby forming a conformational change. CONCLUSIONS: The present study identified two nonframeshifting mutations of HOXD13 polyalanine repeat location in two Chinese families with postaxial polydactyly or postaxial syndactyly. Our results also provide new insights into genetic counseling and clinical management.

Multiplex targeted high-throughput sequencing in a series of 352 patients with congenital limb malformations.

Congenital limb malformations (CLM) comprise many conditions affecting limbs and more than 150 associated genes have been reported. Due to this large heterogeneity, a high proportion of patients remains without a molecular diagnosis. In the last two decades, advances in high throughput sequencing have allowed new methodological strategies in clinical practice. Herein, we report the screening of 52 genes/regulatory sequences by multiplex high-throughput targeted sequencing, in a series of 352 patients affected with various CLM, over a 3-year period of time. Patients underwent a clinical triage by expert geneticists in CLM. A definitive diagnosis was achieved in 35.2% of patients, the yield varying considerably, depending on the phenotype. We identified 112 single nucleotide variants and 26 copy-number variations, of which 52 are novel pathogenic or likely pathogenic variants. In 6% of patients, variants of uncertain significance have been found in good candidate genes. We showed that multiplex targeted high-throughput sequencing works as an efficient and cost-effective tool in clinical practice for molecular diagnosis of congenital limb malformations. Careful clinical evaluation of patients may maximize the yield of CLM panel testing.

Etiological diagnosis in limb reduction defects and the number of affected limbs: A population-based study in the Northern Netherlands.

Limb reduction defects (LRDs) that affect multiple limbs are considered to be more often heritable, but only few studies have substantiated this. We aimed to investigate if an etiological diagnosis (genetic disorder or clinically recognizable disorder) is more likely to be made when multiple limbs are affected compared to when only one limb is affected. We used data from EUROCAT Northern Netherlands and included 391 fetuses and children with LRDs born in 1981-2017. Cases were classified as having a transverse, longitudinal (preaxial/postaxial/central/mixed), intercalary, or complex LRD of one or more limbs and as having an isolated LRD or multiple congenital anomalies (MCA). We calculated the probability of obtaining an etiological diagnosis in cases with multiple affected limbs versus one affected limb using relative risk (RR) scores and Fisher's exact test. We showed that an etiological diagnosis was made three times more often when an LRD occurred in multiple limbs compared to when it occurred in one limb (RR 2.9, 95% CI 2.2-3.8, p < 0.001). No genetic disorders were found in isolated cases with only one affected limb, whereas a genetic disorder was identified in 16% of MCA cases with one affected limb. A clinically recognizable disorder was found in 47% of MCA cases with one affected limb. Genetic counseling rates were similar. We conclude that reduction defects of multiple limbs are indeed more often heritable. Genetic testing seems less useful in isolated cases with one affected limb, but is warranted in MCA cases with one affected limb.

Perinatal outcomes of infants with congenital limb malformations: an observational study from a tertiary referral center in Central Europe.

BACKGROUND: Congenital limb malformations are rare, and their perinatal outcomes are not well described. This study analyzed the perinatal outcomes of infants with congenital limb malformations. METHODS: All infants with congenital limb malformations who underwent prenatal assessment and delivery at our tertiary referral center from 2004 through 2017 were retrospectively identified. Neonatal outcome parameters were assessed, and the predictors of worse perinatal outcomes were determined. RESULTS: One hundred twenty-four cases of congenital limb malformations were identified, of which 104 (83.9%) were analyzed. The upper limb was affected in 15 patients (14.4%), the lower limb in 49 (47.1%), and both limbs in 40 (38.5%) patients. A fetal syndrome was identified in 66 patients (63.5%); clubfoot and longitudinal reduction defects were the most frequent malformations. In total, 38 patients (36.5%) underwent termination, seven (6.7%) had stillbirth, and 59 (56.7%) had live-born delivery. Rates of preterm delivery and transfer to the Neonatal Intensive Care Unit were 42.4 and 25.4%, respectively. Localization of the malformation was a determinant of perinatal outcome (P = .006) and preterm delivery (P = .046). CONCLUSIONS: Congenital limb malformations frequently occur bilaterally and are associated with poor perinatal outcomes, including high rates of stillbirth and preterm delivery. Multidisciplinary care and referral to a perinatal center are warranted.

WNT10B variants in split hand/foot malformation: Report of three novel families and review of the literature.

Split-hand/foot malformation (SHFM) is a genetically heterogeneous congenital limb malformation typically limited to a defect of the central rays of the autopod, presenting as a median cleft of hands and feet. It can be associated with long bone deficiency or included in more complex syndromes. Among the numerous genetic causes, WNT10B homozygous variants have been recently identified in consanguineous families, but remain still rarely described (SHFM6; MIM225300). We report on three novel SHFM families harboring WNT10B variants and review the literature, allowing us to highlight some clinical findings. The feet are more severely affected than the hands and there is a frequent asymmetry without obvious side-bias. Syndactyly of third-fourth fingers was a frequent finding (62%). Polydactyly, which was classically described in SHFM6, was only present in 27% of patients. No genotype-phenotype correlation is delineated but heterozygous individuals might have mild features of SHFM, suggesting a dose-effect of the WNT10B loss-of-function.

Two cases of polydactyly in wild brown howler monkeys (Alouatta guariba clamitans).

We report the first two cases of polydactyly in an atelid species: (i) a wild ca. 16-week-old infant female presenting seven digits in both feet and other bone malformations and (ii) a wild newborn male presenting six digits in both feet with the extra digit fused to the hallux.

Advances in the Molecular Genetics of Non-syndromic Syndactyly.

Syndactyly, webbing of adjacent digits with or without bony fusion, is one of the most common hereditary limb malformations. It occurs either as an isolated abnormality or as a component of more than 300 syndromic anomalies. There are currently nine types of phenotypically diverse nonsyndromic syndactyly. Non-syndromic syndactyly is usually inherited as an autosomal dominant trait, although the more severe presenting types and subtypes may show autosomal recessive or X-linked pattern of inheritance. The phenotype appears to be not only caused by a main gene, but also dependant on genetic background and subsequent signaling pathways involved in limb formation. So far, the principal genes identified to be involved in congenital syndactyly are mainly involved in the zone of polarizing activity and sonic hedgehog pathway. This review summarizes the recent progress made in the molecular genetics, including known genes and loci responsible for non-syndromic syndactyly, and the signaling pathways those genetic factors involved in, as well as clinical features and animal models. We hope our review will contribute to the understanding of underlying pathogenesis of this complicated disorder and have implication on genetic counseling.

Non-syndromic phocomelia: A rare case report signifying prenatal screening.

Phocomelia is a rare congenital condition characterized by severe limb malformation, where the limbs are either partly or completely underdeveloped. Phocomelia can occur as a syndrome or as a limb-specific abnormality. The frequency of phocomelia ranges from 0.6 to 4.2 per 100,000 live births; hence, there are not many reports of this deformity. Genetic inheritance and the use of thalidomide are the two main etiological factors of phocomelia. Several symptoms and visceral abnormalities are associated with this condition. Ultrasonography is crucial for the early detection of phocomelia during the intrauterine stage. Presented here is a case of phocomelia in a 6-year-old boy who was diagnosed after birth, with no maternal history of thalidomide usage or family history of the same condition. This case is unique in that it involves a child born with phocomelia but no additional congenital defects observed in related syndromes. Because of that, we suggest this case may be isolated.

Clinical, genetic, and molecular aspects of split-hand/foot malformation: an update.

We here provide an update on the clinical, genetic, and molecular aspects of split-hand/foot malformation (SHFM). This rare condition, affecting 1 in 8,500-25,000 newborns, is extremely complex because of its variability in clinical presentation, irregularities in its inheritance pattern, and the heterogeneity of molecular genetic alterations that can be found in affected individuals. Both syndromal and nonsyndromal forms are reviewed and the major molecular genetic alterations thus far reported in association with SHFM are discussed. This updated overview should be helpful for clinicians in their efforts to make an appropriate clinical and genetic diagnosis, provide an accurate recurrence risk assessment, and formulate a management plan.

Long-term donor site outcome after second toe transfer for congenital hand differences.

This study evaluates the long-term donor site outcomes after second toe transfers for congenital hand differences performed during childhood. In total, 25 toe transfers in 18 patients were followed up for a mean period of 17.4 years. We examined the patients clinically, radiologically and with a gait analysis system. Patient-reported outcome measures were collected. The patients were asymptomatic and there were no problematic clinical or radiological findings. Patients expressed high levels of satisfaction. The results were consistent, regardless of the resection level in the toe transfer or whether the operation was unilateral or bilateral. No postoperative complications or late reoperations on the foot were observed.Level of evidence IV.

Developmental genomics of limb malformations: Allelic series in association with gene dosage effects contribute to the clinical variability.

Genetic heterogeneity, reduced penetrance, and variable expressivity, the latter including asymmetric body axis plane presentations, have all been described in families with congenital limb malformations (CLMs). Interfamilial and intrafamilial heterogeneity highlight the complexity of the underlying genetic pathogenesis of these developmental anomalies. Family-based genomics by exome sequencing (ES) and rare variant analyses combined with whole-genome array-based comparative genomic hybridization were implemented to investigate 18 families with limb birth defects. Eleven of 18 (61%) families revealed explanatory variants, including 7 single-nucleotide variant alleles and 3 copy number variants (CNVs), at previously reported "disease trait associated loci": BHLHA9, GLI3, HOXD cluster, HOXD13, NPR2, and WNT10B. Breakpoint junction analyses for all three CNV alleles revealed mutational signatures consistent with microhomology-mediated break-induced replication, a mechanism facilitated by Alu/Alu-mediated rearrangement. Homozygous duplication of BHLHA9 was observed in one Turkish kindred and represents a novel contributory genetic mechanism to Gollop-Wolfgang Complex (MIM: 228250), where triplication of the locus has been reported in one family from Japan (i.e., 4n = 2n + 2n versus 4n = 3n + 1n allelic configurations). Genes acting on limb patterning are sensitive to a gene dosage effect and are often associated with an allelic series. We extend an allele-specific gene dosage model to potentially assist, in an adjuvant way, interpretations of interconnections among an allelic series, clinical severity, and reduced penetrance of the BHLHA9-related CLM spectrum.

Hand and Upper Limb Malformations in Italy: A Multicentric Study.

Background: Although hand and upper limb malformations are quite frequent, up to now very few reports have been published on epidemiology. The aim of this study is to evaluate the number of infants who presented with hand and upper limb malformations from 2010 to 2015 in Italy. Methods: A retrospective analysis of a pediatric population presenting with hand and upper extremity malformations was carried out, gathering reports achieved from eight Italian Centers of pediatric hand surgery. Other factors such as gender, date and region of birth, family distribution of malformations and associated syndromes, were analysed. Results: Out of 3,100,421 live births, 765 children presented with hand and upper limb malformations. The incidence was 2,5/10,000 live births with a predominance of males and the right side. Radial polydactyly was the anomaly with the highest percentage, closely followed by simple syndactyly, simbrachidactyly and complex syndactyly. Less common conditions were the triphalangic thumb, thumb in palm, proximal radioulnar synostosis and Sprengel deformity. Inheritance of and familial predisposition to those malformations was recorded in 25 cases, while 84 children presented with syndromes related to hand anomalies. Conclusions: In conclusion the incidence of hand and upper extremity malformations in Italy is lower than that registered in other countries. The retrospective nature of the study combined with the fact that some defects frequently evade pediatric hand surgeon consultations are some possible limitations of the study. However, our data confirmed that, in spite of the decrease in the birth rate in Italy, the trend of congenital hand disorders maintained a stable trend. We aim to integrate this study with a prospective analysis and to involve the institutional health authorities in other countries so as to register the correct incidence of hand and upper extremity defects.

Prenatal Diagnosis of Acromelic Frontonasal Dysostosis.

Acromelic frontonasal dysostosis (AFND; MIM #603671) is a rare autosomal dominant genetic disorder caused by a heterozygous mutation in the ZSWIM6 (KIAA1577) gene located at chromosome 5q12.1. It is phenotypically characterized by frontonasal malformation with hypertelorism, telecanthus, nasal clefting or bifid nasal tip, wide fontanels and sutures, brachycephaly, and cleft palate. The patients also present with central nervous system malformations such as encephalocele, agenesis of the corpus callosum, or interhemispheric lipoma. Limb malformations can also be found, including preaxial polydactyly of the feet and sometimes postaxial polydactyly of the hands, talipes equinovarus, or tibia malformations. Here, we present a case of early prenatal diagnosis of AFND with ultrasound and necropsy images which show the phenotypic findings of this syndrome.

Deciphering the mutational signature of congenital limb malformations.

Congenital limb malformations (CLMs) affect 1 in 500 live births. However, the value of exome sequencing (ES) for CLM is lacking. The purpose of this study was to decipher the mutational signature of CLM on an exome level. We enrolled a cohort of 66 unrelated probands (including 47 families) with CLM requiring surgical correction. ES was performed for all patients and available parental samples. A definite molecular diagnosis was achieved in 21 out of 66 (32%) patients. We identified 19 pathogenic or likely pathogenic single-nucleotide variants and three copy number variants, of which 11 variants were novel. We identified four variants of uncertain significance. Additionally, we identified RPL9 and UBA2 as novel candidate genes for CLM. By comparing the detailed phenotypic features, we expand the phenotypic spectrum of diastrophic dysplasia and chromosome 6q terminal deletion syndrome. We also found that the diagnostic rate was significantly higher in patients with a family history of CLM (p = 0.012) or more than one limb affected (p = 0.034). Our study expands our understanding of the mutational and phenotypic spectrum of CLM and provides novel insights into the genetic basis of these syndromes.

Nonsyndromic Split-Hand/Foot Malformation: Recent Classification.

Split-hand/foot malformation (SHFM) is a genetic limb anomaly disturbing the central rays of the autopod. SHFM is a genetically heterogeneous disorder with variable expressivity inherited as syndromic and nonsyndromic forms. We provide an update of the clinical and molecular aspects of nonsyndromic SHFM. This rare condition is highly complex due to the clinical variability and irregular genetic inheritance observed in the affected individuals. Nonsyndromic SHFM types have been reviewed in terms of major molecular genetic alterations reported to date. This updated overview will assist researchers, scientists, and clinicians in making an appropriate molecular diagnosis, providing an accurate recurrence risk assessment, and developing a management plan.

Long-term outcomes after pollicization: a mean 11-year follow-up study.

This study evaluates the long-term results of pollicization for a congenitally absent or severely hypoplastic thumb. Twenty-nine patients with 34 pollicizations were divided to two groups: those with simple thumb hypoplasia (22 pollicizations) and those with radial longitudinal dysplasia (12 pollicizations). The patients were followed from 1.3 to 32 years, with a mean follow-up time of 11 years. The patients were examined clinically and radiologically, and they completed a questionnaire concerning satisfaction with appearance, function, and social interaction. The Percival score was also calculated. In both groups, grip and pinch strengths of the operated hands were inferior to the normative age-related values. Radiologically, flattening of the original metacarpal head was found in 20 out of the 34 operated hands. We found better patient satisfaction in the simple hypoplasia group than in the radial longitudinal dysplasia group. The functional outcomes and patients' satisfaction did not correlate with the age of patients at operation. Level of evidence: IV.

Identification of novel mutations in preaxial polydactyly patients through whole-exome sequencing.

BACKGROUND: Polydactyly is one of the most common hereditary limb malformation characterized by additional digits in hands and/or feet. With extra fingers/toes, which could be very problematic, polydactyly patients are usually treated in early childhood by removing of extra digits with surgery. Genetically, polydactyly is caused by mutations of genes that involve in digit formation. METHODS: In the current report, we performed genetic analysis for polydactyly using DNA samples from a cohort of 20 Chinese patients. All patients show preaxial polydactyly in one of their hands. RESULTS: With whole-exome sequencing (WES), we have identified two novel heterozygous mutations c.G2844A in GLI3 gene (OMIM 165240) and c.1409_1410del in EVC gene (OMIM 604831). Compound heterozygous mutations that affect KIAA0586 gene (OMIM 610178) are also detected. Proteins encoded by the genes have important roles in primary cilia and regulate sonic hedgehog signaling pathway. CONCLUSION: Our study highlights the important roles of primary cilia in limb development, and helps to further understand the molecular mechanisms for polydactyly formation.