Regulation of the brain dopaminergic system by juvenile hormone in honey bee males (Apis mellifera L.).

Dopamine (DA) and juvenile hormone (JH) are multifunctional regulators of behaviour in social insects, with distinct effects across species and even between different dominance positions within the same species. We examined the effects of JH on the brain dopaminergic system in honey bee males to investigate the potential relationship between JH and DA within Apis mellifera. Both DA content and the expression of three DA receptor genes (Amdop1, Amdop2 and Amdop3) increased in the male honey bee brain from day 4 to day 8 after emergence. Treatment of 4-day-old males with a JH analogue (methoprene, JHA) enhanced brain DA levels. Brain expression of Amdop1 was also enhanced by JHA but not by a DA receptor agonist 2-amino 6,7-dihydroxy-1,2,3,4-tetrahydronaphthalene (6,7-ADTN), indicating that Amdop1 up-regulation was not mediated by increased DA receptor stimulation. Furthermore, Amdop1 expression was still enhanced when JHA was co-applied with the DA receptor antagonist cis-(Z)-flupenthixol. Expression levels of Amdop2 and Amdop3 were not altered by JHA, 6,7-ADTN or by JHA plus the DA receptor antagonist. Regulation of the brain dopaminergic system by JH, as observed in solitary species, is conserved in male honey bees but not in female honey bees and other advanced eusocial insects.

Observation of the fractional quantum Hall effect in an oxide.

The quantum Hall effect arises from the cyclotron motion of charge carriers in two-dimensional systems. However, the ground states related to the integer and fractional quantum Hall effect, respectively, are of entirely different origin. The former can be explained within a single-particle picture; the latter arises from electron correlation effects governed by Coulomb interaction. The prerequisite for the observation of these effects is extremely smooth interfaces of the thin film layers to which the charge carriers are confined. So far, experimental observations of such quantum transport phenomena have been limited to a few material systems based on silicon, III-V compounds and graphene. In ionic materials, the correlation between electrons is expected to be more pronounced than in the conventional heterostructures, owing to a large effective mass of charge carriers. Here we report the observation of the fractional quantum Hall effect in MgZnO/ZnO heterostructures grown by molecular-beam epitaxy, in which the electron mobility exceeds 180,000 cm(2) V(-1) s(-1). Fractional states such as ν = 4/3, 5/3 and 8/3 clearly emerge, and the appearance of the ν = 2/5 state is indicated. The present study represents a technological advance in oxide electronics that provides opportunities to explore strongly correlated phenomena in quantum transport of dilute carriers.

Inactivation of transforming activity of plasmid DNA by lipid peroxidation.

DNA damage due to NADPH-dependent lipid peroxidation of liposomes was examined using liposomes prepared from lipids, NADPH-cytochrome P-450 reductase and cytochrome P-450 isolated from rat liver microsomes. Plasmid pBR322 DNA was incubated in the reaction mixture for liposomal lipid peroxidation and introduced to Escherichia coli CSR603 (uvrArecA). More of the transforming activity of the DNA was lost as the lipid peroxidation progressed, and this inactivation was dependent on the extent of lipid peroxidation. Single strand breaks occurred in the plasmid DNA. Hydroxyl radical scavengers could not prevent most of the strand breaks or the lipid peroxidation reaction. Chloroform extracts from the reaction mixture of peroxidized microsomes also inactivated the transforming activity of pBR322 DNA but did not cause strand breaks. The 105 000 X g supernatant of the reaction mixture, which contained more than 85% of the thiobarbituric acid-reactive substances, did not inactivate the plasmid DNA. The degradative products of [U-14C]arachidonic acid in the liposomes did not bind to DNA. These results led to the conclusion that at least two types of DNA damaging agent are produced during NADPH-dependent microsomal lipid peroxidation. One induces single strand breaks of DNA and another inactivates the plasmid-transforming activity without inducing strand breaks.

Relationship between CYP2C9 and 2C19 genotypes and tolbutamide methyl hydroxylation and S-mephenytoin 4'-hydroxylation activities in livers of Japanese and Caucasian populations.

Genomic DNA was isolated from livers of 39 Japanese and 45 Caucasians and the genotypes of CYP2C9 and 2C19 genes were determined with PCR methods using synthetic oligonucleotide primers. Liver microsomes were also prepared from these human samples and activities for tolbutamide methyl hydroxylation and S-mephenytoin 4'-hydroxylation were determined. The single base mutation of C416T (Arg144Cys) in CYP2C9 was detected in 22% of Caucasians but not in Japanese samples. Another single base mutation at A1061C (Ile359Leu) in the CYP2C9 gene was found with frequencies of about 8% in both races. We did not detect any individuals who have either homozygous Cys144/Cys144 or Leu359/Leu359 CYP2C9 variant nor both heterozygous Cys144-Ile359 and Arg144-Leu359 CYP2C9 variant in the human samples examined. The CYP2C19m2 genetic polymorphism was found only in Japanese people, while CYP2C19m1 type was determined in both races, with higher incidence in Japanese than in Caucasian population. Immunoblotting analysis of human liver microsomes suggested that CYP2C9 is a major component of the human CYP2C enzyme pool; it accounted for approximately 20% of total P450 in liver microsomes of both human populations. The levels of CYP2C19 protein were determined to be about 0.8% and 1.4% of total P450 (mean) in Japanese and Caucasians, respectively. We did not detect CYP2C19 protein in liver microsomes of humans who were genotyped for CYP2C19 gene as m1/m1, m1/m2, and m2/m2 variants but detected CYP2C9 protein in all of the samples examined. Good correlations were found between levels of CYP2C9 and activities of tolbutamide methyl hydroxylation (r = 0.77) and between levels of CYP2C19 and activities of S-mephenytoin 4'-hydroxylation (r = 0.86) in liver microsomes of the human samples examined. Tolbutamide methyl hydroxylation activities were lower in human samples with the Leu359 allele of CYP2C9 than those with the Cys144 allele and wild-type (Arg144-Ile359); the former type showed slightly higher K(m) values. When calculated on P450 basis, liver microsomes of individuals having m1/m1, m1/m2, and m2/m2 types of CYP2C19 had very low catalytic activities for S-mephenytoin 4'-hydroxylation. These results provide useful comparisons for pharmacokinetic and toxicokinetic models of some of the clinically used drugs that are oxidized by CYP2C proteins in humans.

Uptake of 10 polar organic solvents during short-term respiration.

Respiratory uptake was investigated for 10 polar organic solvents with high blood/air partition coefficients (lambda(blood/air)): ethyl acetate (lambda(blood/air), 77), methyl iso-butyl ketone (90), methyl acetate (90), methyl propyl ketone (150), acetone (245), iso-pentyl alcohol (381), iso-propyl alcohol (848), methyl alcohol (2590), ethylene glycol monobutyl ether (EGBE, 7970), and propylene glycol monomethyl ether (PGME, 12380). Test-air concentrations (Cinh) were 25 to 200 ppm. Four healthy male volunteers inhaled the test air for 10 min at rest and then room air for 5 min. The percentage of solvent in the end-exhaled air and in the mixed-exhaled air increased after the start of the test-air respiration, and reached a quasi-steady-state level within a few min. The speeds of these increases at the start of the test-air respiration became lower as lambda(blood/air) increased. The mean uptakes (U) for the last five min of the test air respiration were 67.3, 52.9, 60.4, 53.0, 52.6, 63.0, 60.3, 60.8, 79.7, and 81.3%, respectively, for ethyl acetate, methyl iso-butyl ketone, methyl acetate, methyl propyl ketone, acetone, iso-pentyl alcohol, iso-propyl alcohol, methyl alcohol, EGBE and PGME. Thus, U values of the alcohols were higher than those of the ketones and lower than the glycol ethers. The overall view, except for esters, showed that U increased with lambda(water/air) increases. This tendency can be explained by a hypothesis that solvent absorbed in the mucus layer of the respiratory tract is removed by the bronchial blood circulation. U values of ethyl acetate and methyl acetate were higher than those of methyl iso-butyl ketone and methyl propyl ketone, though the lambda(blood/air) values of these esters were nearly equal to those of the ketones. For the respiration of the esters, their metabolites, ethyl alcohol and methyl alcohol, were detected in the exhaled air. The exhalation percentage of the metabolites increased after the start of test-air respiration and reached a quasi-steady-state level of 2 and 3%, respectively, by the 5th min. These data suggest that removal of the solvent via metabolism in the wall tissue of the respiratory tract plays an important role for the esters.

Mutagenesis resulting from DNA damage by lipid peroxidation in the supF gene of Escherichia coli.

In vitro incubation of rat microsomal lipids with NADPH and Fe3+ in the presence of cytochrome P450 reductase produces lesions in double-stranded pZ189 plasmid DNA, the mutagenic potential of which was analyzed after transfection into Escherichia coli host cells that had been induced for SOS functions by ultraviolet irradiation. The extent of lipid peroxidation, when monitored by the formation of thiobarbituric acid reaction substances, was increased with increased addition of lipids in the reaction mixture. Mutagenesis was determined with the forward mutation assay using the supF gene of pZ189 as a target. When treated pZ189 DNA was used to transfect host cells, a seven-fold increase in mutation frequency for SOS uninduced hosts and a 12-fold increase in mutation frequency for SOS induced hosts was observed at 50% survival compared to that observed with untreated DNA. Sequence analysis shows that incubation of pZ189 DNA in the lipid peroxidation reaction mixture results mostly in single base substitutions, the most frequent base change being G:C-->C:G transversion, followed by G:C-->T:A transversion. The fact that, in the SOS induced hosts, the spectrum obtained by lipid peroxidation is similar to that of hydrogen peroxide suggests the possible involvement for mutagenesis of superoxide produced during lipid peroxidation, but not lipid peroxidation end products such as aldehyde or alkane. Treatment of pZ189 DNA with increasing extents of lipid peroxidation did not yield increasing formation of 8-hydroxyguanine. The results suggest that the origins of G:C-->C:G and G:C-->T:A transversions may be (an) as yet unidentified lesion(s) generated by lipid peroxidation.

Construction of Escherichia coli K12 phr deletion and insertion mutants by gene replacement.

We replaced an Escherichia coli phr gene by a 1.4-kb fragment of DNA coding for resistance to chloramphenicol. Characterization of 2 deletions (phr-19 and phr-36) and 1 insertion (phr-34) in the phr gene revealed no photoreactivation. Photoreactivation-deficient strains of either recA56 or lexA1(ind-) were more sensitive to UV radiation in the dark than phr-proficient counterparts. The presence of the phr defect in uvrA6 strains increased by 1.5-2-fold his-4(Ochre) to His+ mutation induced by ultraviolet light compared to uvrA6 phr+ strains, although there was no difference in UV sensitivity between uvrA6 phr+ and uvrA6 phr- strains. 30-35% of the His+ mutations thus induced were suppressor mutations in uvrA6 phr+ and 49-55% in uvrA6 phr- strains. The UV mutagenesis results are consistent with the previous observations that suppressor mutations targeted by a thymine-cytosine pyrimidine dimer are reduced in the dark in cells with amplified DNA photolyase.

Mutation induction in Escherichia coli incubated in the reaction mixture of NADPH-dependent lipid peroxidation of rat-liver microsomes.

Experiments were carried out to examine mutation induction in E. coli cells incubated in the reaction mixture of NADPH-dependent lipid peroxidation of microsomes isolated from rat liver. The results obtained were as follows: (1) Lipid peroxidation of microsomes occurred extensively on incubation with NADPH and Fe2+. In the E. coli WP2uvrA(pKM101) system, the mutation frequency to streptomycin resistance increased markedly when the cells were incubated in the reaction mixture of microsomal lipid peroxidation. The induced mutation frequencies were dependent on the extent of the lipid peroxidation. (2) It was also found that the mutations were induced at the same rate as in the case of (1) when the cells were added to the microsomal suspensions after the reactions due to the short-lived free radicals had terminated. (3) The cytotoxicity of the lipid peroxidation products was larger in the DNA repair-defective mutant, E. coli SR18 (uvrArecA) than the wild-type strain, SR749. From these results it is concluded that some DNA-damaging and mutagenic substances are indeed produced in the degradation process of peroxidized polyunsaturated fatty acids in liver microsomal lipids.

Mutagenic and cytotoxic effects of oxygen free radicals generated by methylviologen (paraquat) on Escherichia coli with different DNA-repair capacities.

Investigations were carried out to examine the mutagenic and cytotoxic effects of oxygen free radicals on E. coli. E. coli B strains with different DNA-repair capacities were exposed to methyl viologen, commonly called paraquat (1,1'-dimethyl-4,4'-bipyridinium dichloride, MV), which has been shown to act as an intracellular generator of superoxide radicals. The results obtained were as follows: The cytotoxicity of MV in E. coli was dioxygen-dependent and due to the extent of intracellular generation of superoxide radicals. Cells containing higher levels of superoxide dismutase were more resistant to the toxic effect of MV. The cytotoxicity of MV was greater in DNA repair-deficient E. coli, Bs-1(exrA uvrB), NG30(recA) and R15(polA), than in DNA-repair-proficient strains (B/r and H/r30) and Hs30 (uvrB). MV was found to be mutagenic to E. coli H/r30 and Hs30 under aerobic conditions. The mutation frequencies to streptomycin resistance and to arginine prototrophy increased with the dose of MV in both strains. However, E. coli NG30 was unmutable by MV. The mutation induction did not occur under anaerobic conditions. The expression of the umu operon in E. coli was induced by MV under aerobic conditions. From these results, it was concluded that superoxide radicals intracellularly generated by MV include DNA damage, which causes cytotoxicity and mutation induction in E. coli, and that DNA damage induced by oxygen radicals is repairable by at least recA, polA and exrA(lexA) gene-controlled mechanisms.

Mutations of a shuttle vector plasmid, pZ189, in Escherichia coli induced by boron neutron captured beam (BNCB) containing alpha-particles.

A shuttle vector, pZ189, carrying a bacterial suppressor tRNA marker gene (supF) was dissolved in Tris-EDTA buffer containing 0.3 M 10B-enriched boric acid and then irradiated with boron neutron captured beam (BNCB) produced by the nuclear reaction 10B (n,alpha) 7Li with thermal neutrons. A DNA repair-deficient mutant, KS46 (uvrA-), of Escherichia coli was transformed with the plasmid DNA, and the transformants carrying mutations on the supF gene were selected as nalidixic acid-resistant colonies. The mutation frequency (2.4 x 10(-4)) of pZ189 at the D10 dose was about 70 times greater than the spontaneous rate (3.5 x 10(-6)). The plasmid mutations were analyzed using DNA sequencers; 88% of them were base substitutions. A few minus-one frameshifts (7%) and deletions (5%) were detected. Among these base substitutions, transversions of G:C to T:A (42%) and G:C to C:G (29%) predominated. Twenty-seven percent of the base substitutions were G:C to A:T transitions; no A:T to G:C transitions were detected.

Specificity of mutations induced by riboflavin mediated photosensitization in the supF gene of Escherichia coli.

Riboflavin-mediated photosensitization has been shown to produce 8-hydroxyguanine (oh8Gua) in DNA. We investigated the specificity of mutation of photosensitized supF gene induced in Escherichia coli. The oh8Gua repair deficient E. coli mutant mutM and mutY were transformed with plasmid pUB3 carrying the supF gene irradiated with white light in the presence of riboflavin. Under these conditions, riboflavin photosensitization increased the amounts of oh8Gua in pUB3 DNA. Three types of a single base substitution occurring at G:C pairs were detected in both wild-type and mutM mutant strains. Almost all base substitutions were transversions to T:A or C:G pairs occurring at a similar extent in both wild-type and mutM strains. Mutations derived from mutY strain transformed with photosensitized DNA were only G:C to T:A transversions. These G:C to T:A transversions observed in the mutY strain were suggested to be the result of mispairing of oh8Gua with adenine. Riboflavin-mediated photosensitization may also produce lesions on DNA causing G:C to C:G changes by unknown mechanisms.

Delayed transfection of DNA after riboflavin mediated photosensitization increases G:C to C:G transversions of supF gene in Escherichia coli mutY strain.

We have previously reported that the majority of base substitution mutations of the Escherichia coli supF gene induced by riboflavin mediated photosensitization were G:C to C:G changes, in addition to G:C to T:A changes which were probably caused by 8-hydroxyguanine (oh(8)Gua), in wild type and mutM mutator mutant strains. This implies that lesions other than oh(8)Gua are produced by riboflavin-photosensitization. G:C to C:G base substitutions have been found in the mutations induced by ionizing radiation and reactive oxygen species, as well as spontaneous mutation. To characterize the G:C to C:G mutation, riboflavin- photosensitized plasmid DNA carrying the supF gene was left at room temperature for 5 h in the dark before transfection. The delayed transfection gave a mutational spectrum different from that for immediate transfection. G:C to C:G transversions significantly increased in mutY mutator strain, in which the transversion was not detected in the immediate transfection. Lesions causing G:C to C:G changes increased during 5-h holding after photosensitization and MutY protein presumably takes part in this type of base change mutation.

Mutational specificity of the ferrous ion in a supF gene of endonuclease III/VIII deficient Escherichia coli.

When 125 microM Fe2+/EDTA treated plasmid pUB3 was used to transfect an Escherichia coli NKJ2004 (nth nei) host, which is totally defective in glycosylases for thymine glycol and 5-hydroxycytosine, a 3.7 fold increase in mutation frequency was observed. Among 46 supF mutants sequenced, 28 had base substitutions, with G:C-->C:G transversion predominant (14 cases), followed by G:C-->T:A transversion (6 cases) and G:C-->A:T transition (6 cases). The results are consistent with our previous Fe2+ mutagenesis results where, in the wild type host, 78% were base substitutions, with G:C-->C:G transversion (59%) predominant, followed by G:C-->T:A transversion (28%) and G:C-->A:T transition (11%). Treatment of pUB3 DNA with Fe2+/EDTA did not yield formation of Endonuclease III sensitive sites. The possibility of 5-hydroxycytosine as the causative lesion for Fe2+ induced G:C-->C:G transversion is discussed.

[Detection of toxigenic Vibrio cholerae O1 using polymerase chain reaction for amplifying the cholera enterotoxin gene].

A rapid and simple procedure using polymerase chain reaction (PCR) was developed for the detection of cholera enterotoxin (CT) producing character. This method is based on amplifying a 380 base pair (bp) segment of the CT gene (ctx) which controls the production of CT. Two single-stranded oligonucleotides, synthetized to be complementary to the known nucleotide sequences of genes encoding the A-subunit of ctx, were used as extension primers. The oligonucleotide sequences are 5'TCAAACTATATTGTCTGGTC (CT-1) and 5'CGCAAGTATTACTCATCGA (CT-2). As template DNA was used 5 microliter of boiled bacterial culture broth at 95 degrees C for 5 min without the need for DNA extraction. The amplified target DNA were confirmed with only CT producing Vibrio cholerae O1 but not with CT non-producing organisms such as heat labile enterotoxin producing Escherichia coli by electrophoretic analysis of PCR mixture after amplification. A few isolates of CT producing V. mimicus and V. cholerae non-O1 were identified.

[Development and testing of cholera enterotoxin gene probe for detection of toxigenic Vibrio cholerae O1].

A DNA probe was developed for the genetic detection from cholera enterotoxin (CT) producing Vibrio cholerae O1 and other organisms. The structural genes of CT (ctx) were cloned from chromosomal DNA of CT producing V. cholerae O1 569B. We subcloned a 552-base-pair fragment encoding a part of CT A-subunit for use of the CT-probe, and made the recombinant plasmid called pSKM24 which has eight copies of the CT-probe. The 32P-labeled CT-probe detected ctx in 72 isolates such as V. cholerae O1, V. cholerae non-O1 and other species of bacteria, but did not react heat-labile enterotoxin genes in enterotoxigenic Escherichia coli (ETEC) by DNA hybridization. The colony hybridization test using the CT-probe is specific, rapid and useful technique for detection of ctx and identification of CT producing V. cholerae.

[Therapeutic effects of cefuzonam against severe infections in patients with hematopoietic disorders. Hanshin Infection Study Group].

Cefuzonam (CZON) was used to treat severe infections in 151 patients with hematopoietic disorders, and its efficacy and safety were assessed. The drug was given in doses of 2.0 to 6.0 g a day, divided into 2 or 3, intravenously by injection or infusion. The clinical effects were excellent in 34 cases, good in 40 cases, fair in 5 cases, and poor in 57 cases. Therefore, the results were excellent or good in 54.4% of the patients treated. The efficacy rates were 43.8 and 35.9% for groups of patients whose neutrophil counts were 500/microliters or less and 100/microliters or less, respectively. It was excellent or good in 70.6% of patients in whom causative agents were identified, and in 66.7 and 80.0% of patients infected with Gram-negative and -positive bacilli, respectively. The efficacy rate for patients infected with unidentified agents was 52.1%. The rate for patients who had received other antibiotics previously was 41.5%. The rate for patients having received only one antibiotic for the preceding treatment was 50.0%. Six (3.9%) of the treated patients experienced adverse effects including changes in laboratory test results observed in 4.

Mutational specificity of the ferrous ion in a supF gene of Escherichia coli.

A plasmid, pZ189, was treated with Fe2+/EDTA, and mutagenesis was determined by DNA sequencing. In the fgp+ Escherichia coli host, 78% were base substitutions, with G:C- > C:G transversion (58.7%) predominant, followed by G:C- > T:A transversion (28.3%). In the fpg-1 mutant, 88% were base substitutions among which 46% were G:C- > C:G and 42% G:C- > T:A. Fe2+ resulted in increased formation of 8-hydroxydeoxyguanosine (8-ohdG) in pZ189 DNA. The origin of Fe(2+)-induced G:C- > T:A transversion may be 8-ohdG; on the other hand, the origin of G:C- > C:G is neither 8-ohdG nor 2,6-diamino-4-hydroxy-5-formamidopyrimidine.

Hydrogen peroxide induces G:C to T:A and G:C to C:G transversions in the supF gene of Escherichia coli.

A vector plasmid, pZ189, carrying an Escherichia coli supF gene as a target for mutations, was treated with a combination of hydrogen peroxide and Fe3+/EDTA complex and propagated in E. coli host cells that had been induced for SOS functions by ultraviolet irradiation. The mutations frequency increased by up to 30-fold over spontaneous background levels with increasing concentrations of hydrogen peroxide. The increase in mutation frequency correlated with an increase in the formation of 8-hydroxydeoxyguanosine in the pZ189 DNA. Sequence analysis of 82 independent supF mutant plasmids revealed that 70 mutants contained base substitutions, with 63 of the 70 involving a G:C base pair, and with G:C-->C:G (28 cases) and G:C-->T:A (26 cases) transversions predominating. Investigation of the influence of the local DNA sequence on the transversions revealed that the guanine at the center of the triplet 5'-PuGA-3' was five times more likely to mutate after treatment with hydrogen peroxide than that at the center of 5'PyGN3'. G:C-->T:A transversions presumably resulted from mispairing of an altered G (probably 8-hydroxydeoxyguanosine) with deoxyadenosine. The origin of the G:C-->C:G transversions may be an as yet unidentified lesion generated by hydrogen peroxide. Mutagenic hotspots for base substitutions were found at positions 133, 160 and 168. Mutation spectra and the positions of mutagenic hotspots, when compared with a previously determined spontaneous mutagenesis spectrum, also provide information on the mechanism of spontaneous mutagenesis.

[Estimation of drug-metabolizing enzyme activities by measuring urinary metabolites of aspirin].

The effect of the inducers of drug-metabolizing enzymes on the urinary excretion of aspirin metabolites in rats was studied. As to the inducer, rats were administered polychlorinated biphenyls (KC-500: 10, 50, and 100 mg/kg b.w.), phenobarbital (80 mg/kg b.w.), or 3-methylcholanthrene (25 mg/kg) intraperitoneally once a day for three days. The rats were orally administered aspirin (50 mg/kg) on the second-10th day after the pre-treatment with each inducer, and the urine were collected respectively. Aspirin metabolites (salicylic acid, salicyluric acid, and gentisic acid) in the urine were simultaneously determined with high-performance liquid chromatography and the liver microsomal cytochrome P-450 was determined. The results obtained were as follows. Excretion rate of total gentisic acid and salicylate glucuronide in the urine collected for first 6 hours were increased significantly by the pre-treatment with KC-500 or phenobarbital. In the pre-treated rats with various dose of KC-500, positive correlation was observed between the amount of liver microsomal cytochrome P-450 and the urinary excretion rate of gentisic acid (p less than 0.001). Salicylic acid hydroxylating activity of liver microsome was increased in the rats pretreated with KC-500, phenobarbital, or 3-methylcholanthrene. These results show that the increased urinary excretion of total gentisic acid and salicylate glucuronide may be due to the induction of drug-metabolizing enzymes in the liver. Therefore, it may be expected that these two aspirin metabolites are good indicators for the estimation of the activities of drug-metabolizing enzymes in vivo.