Natural occurrence of tomato chlorosis virus on tomatillo (Physalis philadelphica) in the United States.

Tomatillo (Physalis philadelphica L.) is an annual plant native to Mexico and Guatemala, and cultivated in other tropical and subtropical regions. In October 2023, tomatillo plants with interveinal yellowing of leaves, marginal chlorosis, leaf thickening, and leaf rolling symptoms (Figure 1) were observed at Colquitt and Tift County, Georgia, US. The disease incidence ranged from 80-100 % which reduced fruit quality and marketability. Twenty tomatillo leaves exhibiting severe symptoms were collected, and, sub-sampled of the leaves were pooled into microcentrifuge tubes. Further, MagMAX 96 viral RNA isolation kit (Thermo Fisher Scientific, US), was used for the extraction of (n=4) total nucleic acid (TNA) (Kavalappara et al. 2021). Symptomatic leaves were tested for the presence of insect-transmitted viruses such as begomovirus (tomato yellow leaf curl virus, TYLCV), potyvirus (turnip mosaic virus, TuMV), crinivirus (tomato infectious chlorosis virus, TICV; tomato chlorosis virus, ToCV), and tospovirus (orthotospovirus tomatomaculae, TSWV). Polymerase chain reaction (PCR) was performed for detecting TYLCV, using gene-specific primers (Kumar et al., 2023). However, for ToCV, TuMV and TICV detection, cDNA was prepared using 100 ng of TNA as a template, followed by the PCR ( Liu et al., 2012). Moreover, the detection of TSWV was conducted using immuno-strips (Adgia, US) following the manufacturer's instructions. ToCV was detected from all the tested samples, while TuMV, TICV, TYLCV and TSWV were not detected in any symptomatic tissues. In addition, RT-PCR was performed using gene-specific primers targeting the RNA-dependent RNA polymerase (RdRP) gene and the heat-shock protein 70 (Hsp70) gene of ToCV. The PCR amplicon of 439 bp encoding Hsp70 and 643 bp corresponding to RdRP was gel-purified and Sanger sequenced (Azenta Life Sciences, US). BLASTn analysis shows RdRP gene from ToCV-tomatillo (OR905600) has 100 % identity with ToCV of RNA1 segment (RdRP, GenBank accession no. AY903447, Florida, US), while Hsp70 gene (OR900219) has 100 % identity with ToCV of RNA2 segment (Hsp70, GenBank accession no. LC778246, Cairo, Egypt). In addition, the symptomatic tomatillo leaves were studied for transmission assay using tomato, employing non-viruliferous whiteflies (Bemisia tabaci) with 48 h of acquisition access period. Further, two weeks post-infection, the presence of ToCV was detected from the test plants while other whitefly-transmitted viruses remins undetected. In 2023, ToCV is widespread in tomato-growing counties, infecting commercially grown tomato cultivars with intermediate resistance against TYLCV-IL (Israel strain). However, tomatillo plants infected with TuMV in California (Liu et al., 2012), TSWV in Georgia, (Díaz-Pérez and Pappu 2000) and TYLCV in Mexico (Gámez-Jiménez et al. 2009) were reported. This study suggests that tomatillo could be a permissive host for ToCV while restrictive to other prevalent viruses in the region. A recent investigation speculates a potential synergistic interaction between ToCV and TYLCV-IL, exacerbating the breakdown of host resistance in tomato (Fiallo-Olivé et al. 2019, Kumar et al. 2023). To the best of our knowledge, this is the first report for the natural incidence of ToCV on tomatillo within the US. The findings will contribute to developing more effective management strategies against emerging viral threats.

First Report of Watermelon Crinkle Leaf-Associated Virus-2 (WCLaV-2) in Watermelon (Citrullus lanatus) in Georgia, USA.

Watermelon (Citrullus lanatus) is a key horticultural crop in Georgia with farmgate value of 142 million USD (2022 Farm Gate Value Report), yet faces challenges from whitefly-transmitted viruses, especially during periods of elevated whitefly populations in the fall. Foliar symptoms on watermelon plants including yellow mottling and chlorosis, wrinkling, bunching, and upward curling, were observed in experimental fields at UGA Tifton and commercial fields in Colquitt County in the fall of 2023. These were similar to those described for watermelon crinkle leaf-associated viruses (WCLaV-1 and WCLaV-2) from Florida (Hendrick et al, 2021) and Texas (Hernandez et al., 2021). The disease incidence reached 100% in both locations. WCLaV-1 was previously identified in Georgia (Adeleke et al., 2022a); however, WCLaV-2 remained undetected in further surveys (Adeleke et al., 2022b). Total nucleic acid was extracted from symptomatic leaf tissues with the MagMAXTM 96 Viral RNA isolation kit (ThermoFisher Scientific, USA), following the manufacturer's guidelines, with the omission of DNAse treatment. The presence of WCLaV-1 was identified through reverse transcription-polymerase chain reaction (RT-PCR) (Hernandez et al., 2021) in 17 out of 24 samples in Tift County, and 12 out of 15 samples from Colquitt County. Within the same set of samples, WCLaV-2 was identified in three samples from Tift County and four samples from Colquitt County by RT-PCR directed at the RdRp gene (Hernandez et al., 2021). WCLaV-1 was not detected in the three samples from Tift County that had WCLaV-2, while mixed infections of WCLaV-2 and WCLaV-1 were observed in the samples form Colquitt County. Two whitefly transmitted viruses, previously reported in Georgia were also identified as mixed infection in these samples (Table S1). The presence of WCLaV-2 was further confirmed by amplifying the movement protein (MP) gene of WCLaV-2 by RT-PCR assays (Hernandez et al., 2021). The amplicons, with expected sizes of 968bp for the RdRp gene and 562bp for the MP gene of WCLaV-2, located on RNA 1 and RNA 2 segments respectively, were directly sequenced from both directions (Genewiz, USA) from a sample collected in Tift County. The resulting data were analyzed via BLASTn search. The MP gene fragment (PP178543) shared 100% identity with isolates from Brazil (LC636074.1), Texas (MW559086.1), and Florida (MZ325858.1). RdRp gene (PP178542) shared >99.7% identity with isolates from Brazil (LC636073.1), Texas (MW559083.1) and Florida (MZ325855.1). WCLaV-1 and WCLaV-2, initially discovered in Asia (Xin et al., 2017), have been assigned to the genus Coguvirus, in the family Phenuiviridae (Walker et al., 2022). Subsequent reports from the USA (Hendrick et al., 2021; Hernandez et al., 2021), Australia (Mulholland et al., 2023), and Brazil (Maeda et al., 2022) indicate the global spread of these viruses. Watermelon is the primary host of WCLaV-2. Despite these findings, biological information, including vector relations, for both viruses and other members of the genus Coguvirus remains elusive. The impact of these viruses on watermelon production and yield in the identified regions remains largely unknown, underscoring the need for further investigations.

Differential sensitivities of photosynthetic component processes govern oxidative stress levels and net assimilation rates in virus-infected cotton.

Cotton (Gossypium hirsutum L.) leafroll dwarf virus disease (CLRDD) is a yield-limiting threat to cotton production and can substantially limit net photosynthetic rates (AN). Previous research showed that AN was more sensitive to CLRDD-induced reductions in stomatal conductance than electron transport rate (ETR) through photosystem II (PSII). This observation coupled with leaf reddening symptomology led to the hypothesis that differential sensitivities of photosynthetic component processes to CLRDD would contribute to declines in AN and increases in oxidative stress, stimulating anthocyanin production. Thus, an experiment was conducted to define the relative sensitivity of photosynthetic component processes to CLRDD and to quantify oxidative stress and anthocyanin production in field-grown cotton. Among diffusional limitations to AN, reductions in mesophyll conductance and CO2 concentration in the chloroplast were the greatest constraints to AN under CLRDD. Multiple metabolic processes were also adversely impacted by CLRDD. ETR, RuBP regeneration, and carboxylation were important metabolic (non-diffusional) limitations to AN in symptomatic plants. Photorespiration and dark respiration were less sensitive than photosynthetic processes, contributing to declines in AN in symptomatic plants. Among thylakoid processes, reduction of PSI end electron acceptors was the most sensitive to CLRDD. Oxidative stress indicators (H2O2 production and membrane peroxidation) and anthocyanin contents were substantially higher in symptomatic plants, concomitant with reductions in carotenoid content and no change in energy dissipation by PSII. We conclude that differential sensitivities of photosynthetic processes to CLRDD and limited potential for energy dissipation at PSII increases oxidative stress, stimulating anthocyanin production as an antioxidative mechanism.

First report of turnip yellows virus infecting cabbage (Brassica oleracea var. capitata) in the USA.

During the spring of 2021, cabbage (Brassica oleracea var. capitata) planted in the research farm at the University of Georgia, Tifton, exhibited leaf distortion, yellow and purple discoloration at the leaf margin of older leaves, and severe stunting. Symptoms were present on nearly 30% of the plants in the field. To identify the potential agents associated, leaf tissues from two symptomatic plants were sent for high throughput sequencing (HTS) of small RNA (sRNA; DNB sequencing, SE read 1x75bp) to Beijing Genomics Institute, China. From each sample, ~ 18 million raw reads were generated. The reads with poor quality and adapter sequences were removed using CLC Genomics Workbench 21.2 (Qiagen, Germantown, MD). Of the total reads, 2,093 and 3,889 reads aligned to the genome of turnip yellows virus (TuYV) in samples one and two, respectively. Reads of turnip mosaic virus (TuMV) were also detected (data not shown). Partial sequences of TuYV assembled from samples one and two showed 89.5% and 89.9% match and 86% and 93% coverage, respectively, with the genome of the type isolate of TuYV (NC_003743) from the United Kingdom. To confirm the presence of TuYV in the samples collected from the same location, specific primers were designed targeting the P0 region (FP- 5'ACAAAAGAAACCAG- GAGGGAATCC3'; RP-5'GCCTTTTCATACAAACATTTCGGTG3') and coat protein (CP) region (FP-5'GTTAATGAATACGGTCGTGGGTAG3'; RP-5'ATTCTGAAAGAACCAGCT- ATCGATG3') of the virus. Eight of 20 (40%) symptomatic samples were determined to be infected with TuYV based on the amplification of expected size products of the P0 (786 nt) and the CP gene (581 nt) in reverse transcription-PCR (RT-PCR). All samples were also tested for the presence of TuMV by RT-PCR as in Sanchez et al. (2003), but none tested positive despite being identified in HTS. Symptoms on samples from which eithervirus could not be detected indicates the involvement of other factors and would require further studies. The partial P0 and CP gene amplicons of TuYV from two samples each were Sanger sequenced bi-directionally at Genewiz (South Plainfield, NJ) and confirmed as TuYV using BLASTn. The partial CP gene sequences from two samples shared 98.7% nucleotide sequence identity with each other and 88.0% (OK349421) and 87.1% (OK349422) identity with the type isolate. The partial P0 gene sequences (OK349423 and OK349424) shared 99.6% nucleotide sequence identity with each other and 92.2% identity with the type isolate. TuYV, formerly known as beet western yellows virus (BWYV) (Mayo, 2002), genus Palerovirus, family Solemoviridae (Walker et al., 2021), is transmitted persistently by aphids (Stevens et al., 2008), and is distributed throughout temperate regions of the world (Kawakubo et al., 2021). TuYV has a wide host range, including brassica, vegetables and weeds (Stevens et al., 2008). However, losses have been reported primarily on canola (B. napus) in Australia (Jones, 2007) and Europe (Stevens et al., 2008). On cabbage, TuYV infections have been reported from China (Zhang et al., 2016), Serbia (Milosevic et al., 2020) and the Philippines (Buxton-Kirk et al, 2020). TuYV (BWYV) has been found infecting shepherd's purse (Capsella bursa-pastoris) in California (Falk and Duffus, 1984), but there are no reports of the virus from any cultivated crops in the USA. To our knowledge, this is the first report of TuYV in cabbage in the USA. More studies are needed to understand its occurrence and impact on cabbage crops in Georgia as well as other regions in the USA.

First report of watermelon crinkle leaf-associated virus 1 naturally infecting watermelon (Citrullus lanatus) in Georgia, USA.

Watermelon (Citrullus lanatus) is one of the major vegetable crops grown in Georgia during the spring and summer seasons, contributing $180 million of farmgate value to the state's economy (Georgia Farm Gate Value Report 2019). During the summer of 2021, watermelon plants with foliar symptoms such as yellow mottling, chlorosis, and wrinkling with thickened, bunchy, and upward curling were observed on commercial fields of Georgia, USA. A disease incidence of 15-20% in ~56 ac in Tift county and 10-15% in ~60 ac in Wilcox county was observed. The symptoms observed were similar to those described for watermelon crinkle leaf-associated viruses (WCLaV-1 and WCLaV-2) from Florida (Hendrick et al., 2021) and Texas (Hernandez et al., 2021). Symptomatic leaves from Tift (n=40) and Wilcox (n=20) counties were collected, surface sterilized with 0.1% bleach and used for total nucleic acid extractions using MagMAX 96 Viral RNA isolation kit (ThermoFisher Scientific, Waltham, MA, USA) following the manufacturer's instruction without DNase treatment. The potential introduction of WCLaV-1 and WCLaV-2 into Georgia was tested by reverse-transcription-polymerase chain reaction (RT-PCR) assay using specific primers targeting RNA-dependent-RNA polymerase (RdRp) and movement protein (MP) genes of both viruses (Hernandez et al., 2021). The expected amplicon sizes for RdRp (~900 nt) and MP (~500 nt) genes of WCLaV-1 located on RNA 1 and RNA 2 segements, respectively, were observed in 39 of 40 (97.5%) samples from Tift and seven of 20 (35%) samples from Wilcox. However, WCLaV-2 was not detected in any of the tested samples. All 60 samples also tested negative for the whitefly-transmitted viruses prevalent in the region, including cucurbit chlorotic yellows virus, cucurbit yellow stunting disorder virus, and cucurbit leaf crumple virus using virus-specific primers (Kavalappara et al., 2021). A subset of the samples analyzed by RT-PCR were also tested by SYBR green-based real-time RT-PCR assay targeting MP gene of WCLaV-1 using primers WCLaV-1FP (5'TCCACAAGCTTGATGGA- GGG3') and WCLaV-1RP (5'TCCCGAGTGAGGAAGCTAGT3'). The virus was detected in samples from both counties and the results matched with those obtained by the conventional RT-PCR assays (Suppl. Table 1). The presence of WCLaV-1 was further confirmed by sequencing (Genewiz, South Plainfield, NJ, USA) coupled with BLASTn analysis of amplicons resulted from the conventional RT-PCR from three randomly selected samples . The partial RdRp sequences (OL469153 to OL469155) were 99.3% and 99.9% identical to the corresponding sequences of WCLaV-1 isolates from China (KY781184) and Texas (MW559074) respectively. The partial MP sequences (OL469150 to OL469152) were 100% identical to those from China (KY781185) and Texas (MW559077). WCLaV-1 and WCLaV-2 were first discovered in Asia (Xin et al., 2017). Both viruses were subsequently reported from North and South Americas (Hendrick et al., 2021; Hernandez et al., 2021; Maeda et al., 2021), indicating their geographical expansion. Biological information, including vector relations, is unknown for both viruses and other members of the genus Coguvirus (family Phenuiviridae), to which they are provisionally assigned (Zhang et al., 2021). Further studies are also required to understand the biology and impact of both viruses on watermelon production and other crops, if any.

First report of cucurbit chlorotic yellows virus in association with other whitefly-transmitted viruses in squash (Cucurbita pepo) in Georgia.

Viruses transmitted by whiteflies (Bemisia tabaci) cause severe damage to cucurbits in the southern United States. In the fall of 2020, samples of squash plants (Cucurbita pepo) exhibiting symptoms of yellow mottle, interveinal yellowing, and leaf crumple were collected from an insecticide trial in Tifton, Georgia. Total nucleic acid was isolated using the MagMAX 96 Viral RNA Isolation Kit (ThermoFisher Scientific) following the manufacturer's instructions but without DNase treatment. Polymerase chain reaction (PCR) and reverse transcription (RT)-PCR were carried out to determine the presence of whitefly-transmitted viruses. We identified infection by cucurbit chlorotic yellows virus (CCYV) using primers targeting a 953 nt segment of CCYV RNA1 encoding the RNA dependent RNA polymerase gene (RdRp) (CCYV-RDRP-1515F-5'CTCCGAGTAGATCATCCCAAATC3' and CCYV-RDRP-1515R-5'TCACCAGAAACTCCACAATCTC 3') along with other whitefly-transmitted viruses previously reported in Georgia. CCYV was detected from 27 of the 28 samples tested, while cucurbit yellow stunting disorder virus (CYSDV; Polston et al., 2008) and cucurbit leaf crumple virus (CuLCrV; Gadhave et al., 2020) were detected from 23 and 28 squash samples, respectively, with all three viruses regularly occurring as mixed infections. The presence of CCYV was further confirmed by amplification of portions of two different genomic segments from RNA2, including a section of the heat-shock protein (HSP) homolog gene (Bananej et al. 2013) as well as a portion of the coat protein (CP) gene which was amplified using primers CCYV_CPF-5'TCCCGGTGCCAACT GAGACA3' and CCYV_CPR- 5' TACGCGCGGCAGAGGAATTT 3'. The respective 462 bp HSP and 375 bp CP amplicons were cloned and sequenced. The partial coat protein gene sequence (MW251342) was 97.86% identical to a CCYV isolate from Shanghai (KY400633). The partial HSP sequence (MW251341) shared 99.73% identity with the recently identified CCYV isolate from California (MH806868). Criniviruses are an emerging group of whitefly-transmitted viruses responsible for worldwide losses of billions of dollars annually (Tzanetakis et al., 2013). CCYV, a member of the genus Crinivirus, was believed to be restricted to Asia, Africa, and the Mediterranean regions of Europe (Bananej et al., 2013; Orfanidou et al., 2014) until it was recently identified in the Imperial Valley of California (Wintermantel et al., 2019). Southern Georgia has been experiencing high whitefly populations, resulting in the emergence of CuLCrV and CYSDV on vegetables in recent years. Because CCYV can produce symptoms virtually identical to those of CYSDV and occurs in mixed infections in cucurbits with other whitefly-transmitted viruses, its epidemiology, role in disease incidence, severity, and impact on economically important crops in the southeastern United States will require further investigation.

First Report of Cucurbit Chlorotic Yellows Virus affecting Watermelon in USA.

Watermelon (Citrullus lanatus) is a high nutrient crop, high in vitamins and very popular in the U.S and globally. The crop was harvested from 101,800 acres with a value of $560 million in the U.S (USDA-NASS, 2020). California, Florida, Georgia and Texas are the four-leading watermelon-producing states in the U.S. During the fall season of 2020, plants in two North Florida watermelon fields, one in Levy County (~20 acres) and one in Suwannee County (~80 acres) with varieties Talca and Troubadour, respectively, exhibited viral-like symptoms. The fields had 100% disease incidence that led to fruit quality issues and yield losses of 80% and above. Symptoms observed in the watermelon samples included leaf crumpling, yellowing and curling, and vein yellowing similar to that of single/and or mixed infection of cucurbit leaf crumple virus (CuLCrV; genus: Begomovirus, family: Geminiviridae), cucurbit yellow stunting disorder virus (CYSDV; genus: Crinivirus, family: Closteroviridae) and squash vein yellowing virus (SqVYV; genus: Ipomovirus, family: Potyviridae), although the vine decline symptoms often associated with SqVYV infection of watermelon were not observed. All three viruses are vectored by whiteflies and previously described in Florida (Akad et al., 2008; Polston et al., 2008; Adkins et al., 2009). To confirm the presence of these viruses, RNA was isolated from 20 symptomatic samples using the RNeasy Plant Mini Kit (Qiagen, USA) as per protocol. This was followed by RT-PCR (NEB, USA) using gene-specific primers described for CuLCrV, CYSDV and SqVYV (Adkins et al., 2009). Amplicons of expected sizes were obtained for all the viruses with the infection of CuLCrV in 17/20, CYSDV in 16/20, and SqVYV in 8/20 samples. In addition, the presence of cucurbit chlorotic yellows virus (CCYV; genus: Crinivirus, family: Closteroviridae) in mixed infection was confirmed in 4/20 samples (3 leaves and 1 fruit) by RT-PCR with primers specific to the CCYV coat protein (CP), heat shock protein 70 homolog (HSP70h) and RNA dependent RNA polymerase (RdRp) designed based on the available CCYV sequences (Sup Table. 1). The RT-PCR amplification was performed using a symptomatic watermelon sample and the amplicons of RdRp, HSP70h and CP were directly sequenced by Sanger method, and the sequences of the amplicons were deposited in GenBank under the accession number: MW527462 (RdRp, 952 bp), MW527461 (HSP70h, 583 bp) and MW527460 (CP, 852 bp). BLASTn analysis demonstrated that the sequences exhibited an identity of 99% to 100% (RdRp and HSP70h, 100%; and CP, 99%) with the corresponding regions of the CCYV isolate Shanghai from China (accession number: KY400636 and KY400633). The presence of CCYV was further confirmed in the watermelon samples by ELISA (Loewe, Germany) using crude sap extracted from the RT-PCR-positive, symptomatic watermelon samples. CCYV was first identified in Kumamoto, Japan in 2004 on melon plants (Gyoutoku et al. 2009). The CCYV was previously reported on melon from Imperial Valley, California (Wintermantel et al., 2019), and more recently on squash in Tifton, Georgia (Kavalappara et al., 2021) and cantaloupe in Cameron, Texas (Hernandez et al., 2021). To our knowledge, this is the first report of CCYV on field watermelon production in the U.S. Continued monitoring of the CCYV in spring and fall watermelon crop, and cucurbit volunteers and weeds will be critical toward understanding the spread of this virus and its potential risk to watermelon in Florida and other regions of the U.S.

Detection of a New Luteovirus in Imported Nectarine Trees: A Case Study to Propose Adoption of Metagenomics in Post-Entry Quarantine.

In spring 2013, 5-year-old nectarine (Prunus persica) trees, grafted on peach rootstock Nemaguard, were found stunted in a propagation block in California. These trees had been propagated from budwood of three nectarine cultivars imported from France and cleared through the post-entry quarantine procedure. Examination of the canopy failed to reveal any obvious symptoms. However, examination of the trunks, after stripping the bark, revealed extensive pitting on the woody cylinder. To investigate the etiological agent, double-stranded RNA was extracted from bark scrapings from the scion and rootstock portions, and a cDNA library was prepared and sequenced using the Illumina platform. BLAST analysis of the contigs generated by the de novo assembly of sequence reads indicated the presence of a novel luteovirus. Complete sequence of the viral genome was determined by sequencing of three overlapping cDNA clones generated by reverse transcription-polymerase chain reaction (RT-PCR) and by rapid amplification of the 5'- and 3'-termini. The virus genome was comprised of 4,991 nucleotides with a gene organization similar to members of the genus Luteovirus (family Luteoviridae). The presence of the virus, tentatively named Nectarine stem pitting-associated virus, was confirmed in symptomatic trees by RT-PCR. Discovery of a new virus in nectarine trees after post-entry quarantine indicates the importance of including (i) metagenomic analysis by next-generation sequencing approach as an essential tool to assess the plant health status, and (ii) examination of the woody cylinders as part of the indexing process.

Mutational analysis of two highly conserved motifs in the silencing suppressor encoded by tomato spotted wilt virus (genus Tospovirus, family Bunyaviridae).

Tospoviruses cause serious economic losses to a wide range of field and horticultural crops on a global scale. The NSs gene encoded by tospoviruses acts as a suppressor of host plant defense. We identified amino acid motifs that are conserved in all of the NSs proteins of tospoviruses for which the sequence is known. Using tomato spotted wilt virus (TSWV) as a model, the role of these motifs in suppressor activity of NSs was investigated. Using site-directed point mutations in two conserved motifs, glycine, lysine and valine/threonine (GKV/T) at positions 181-183 and tyrosine and leucine (YL) at positions 412-413, and an assay to measure the reversal of gene silencing in Nicotiana benthamiana line 16c, we show that substitutions (K182 to A, and L413 to A) in these motifs abolished suppressor activity of the NSs protein, indicating that these two motifs are essential for the RNAi suppressor function of tospoviruses.

Seasonal dynamics of thrips (Thrips tabaci) (Thysanoptera: Thripidae) transmitters of iris yellow spot virus: a serious viral pathogen of onion bulb and seed crops.

Thrips-transmitted Iris yellow spot virus (IYSV) is an important economic constraint to the production of bulb and seed onion crops in the United States and many other parts of the world. Because the virus is exclusively spread by thrips, the ability to rapidly detect the virus in thrips vectors would facilitate studies on the role of thrips in virus epidemiology, and thus formulation of better vector management strategies. Using a polyclonal antiserum produced against the recombinant, Escherichia coli-expressed nonstructural protein coded by the small (S) RNA of IYSV, an enzyme linked immunosorbent assay was developed for detecting IYSV in individual as well as groups of adult thrips. The approach enabled estimating the proportion of potential thrips transmitters in a large number of field-collected thrips collected from field-grown onion plants. Availability of a practical and inexpensive test to identify viruliferous thrips would be useful in epidemiological studies to better understand the role of thrips vectors in outbreaks of this economically important virus of onion.

Microneedle assisted delivery of the cloned components of cucurbit leaf crumple virus in yellow squash (Cucurbita pepo).

Cucurbit leaf crumple virus (CuLCrV) is among the prominent viruses infecting cucurbits in the USA. Attainable procedures of virus inoculation to crops are prerequisite for screening of resistance against the virus. Because mechanical (non-vector-mediated) infection by cucurbit leaf crumple virus (CuLCrV) is inefficient in economically important crops, screening for CuLCrV resistance is currently laborious and time-consuming using transmission by viruliferous whiteflies. We constructed an infectious partial tandem repeat construct of an isolate of CuLCrV from Georgia, USA, in the plant expression binary vector pCambia2300 and transformed it into Agrobacterium tumifaciens strain EHA105. Agroinfiltration of this construct into the abaxial surface of the leaves of common bean (Phaseolus vulgaris L.) produced a systemic infection characteristic of CuLCrV, although this approach was not successful for yellow squash. However, we report a very efficient and reproducible inoculation procedure established in squash when the leaves were injured with a microneedle and rubbed it with cell suspension harbouring the infectious viral construct.

Aphid gene expression following polerovirus acquisition is host species dependent.

Upon acquisition of persistent circulative viruses such as poleroviruses, the virus particles transcytose through membrane barriers of aphids at the midgut and salivary glands via hemolymph. Such intricate interactions can influence aphid behavior and fitness and induce associated gene expression in viruliferous aphids. Differential gene expression can be evaluated by omics approaches such as transcriptomics. Previously conducted aphid transcriptome studies used only one host species as the source of virus inoculum. Viruses typically have alternate hosts. Hence, it is not clear how alternate hosts infected with the same virus isolate alter gene expression in viruliferous vectors. To address the question, this study conducted a transcriptome analysis of viruliferous aphids that acquired the virus from different host species. A polerovirus, cotton leafroll dwarf virus (CLRDV), which induced gene expression in the cotton aphid, Aphis gossypii Glover, was assessed using four alternate hosts, viz., cotton, hibiscus, okra, and prickly sida. Among a total of 2,942 differentially expressed genes (DEGs), 750, 310, 1,193, and 689 genes were identified in A. gossypii that acquired CLRDV from infected cotton, hibiscus, okra, and prickly sida, respectively, compared with non-viruliferous aphids that developed on non-infected hosts. A higher proportion of aphid genes were overexpressed than underexpressed following CLRDV acquisition from cotton, hibiscus, and prickly sida. In contrast, more aphid genes were underexpressed than overexpressed following CLRDV acquisition from okra plants. Only four common DEGs (heat shock protein, juvenile hormone acid O-methyltransferase, and two unannotated genes) were identified among viruliferous aphids from four alternate hosts. Gene ontology (GO) enrichment analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) annotations indicated that the acquisition of CLRDV induced DEGs in aphids associated with virus infection, signal transduction, immune systems, and fitness. However, these induced changes were not consistent across four alternate hosts. These data indicate that alternate hosts could differentially influence gene expression in aphids and presumably aphid behavior and fitness despite being infected with the same virus isolate.

Chitosan coated selenium: A versatile nano-delivery system for molecular cargoes.

The use of nanoscale delivery platforms holds tremendous potential to overcome the current limitations associated with the conventional delivery of genetic materials and hydrophobic compounds. Therefore, there is an imperative need to develop a suitable alternative nano-enabled delivery platform to overcome these limitations. This work reports the first one-step hydrothermal synthesis of chitosan functionalized selenium nanoparticles (Selenium-chitosan, SeNP) that are capable of serving as a versatile nanodelivery platform for different types of active ingredients. The chitosan functionalization modified the surface charge to allow the loading of active ingredients and improve biocompatibility. The effective loading of the SeNP was demonstrated using genetic material, a hydrophobic small molecule, and an antibiotic. Furthermore, the loading of active ingredients showed no detrimental effect on the specific properties (fluorescence and bactericidal) of the studied active ingredients. In vitro antimicrobial inhibitory studies exhibited good compatibility between the SeNP delivery platform and Penicillin G (Pen), resulting in a reduction of the minimum inhibitory concentration (MIC) from 32 to 16 ppm. Confocal microscopy images showed the uptake of the SeNP by a macrophage cell line (J774A.1), demonstrating trackability and intracellular delivery of an active ingredient. In summary, the present work demonstrates the potential of SeNP as a suitable delivery platform for biomedical and agricultural applications.

Whitefly-Transmitted Viruses of Cucurbits in the Southern United States.

Cucurbits are economically important crops that are widely cultivated in many parts of the world, including the southern US. In recent years, higher temperatures have favored the rapid build-up of whiteflies in the fall-grown cucurbits in this region. As a result, whitefly-transmitted viruses (WTVs) have severely impacted the marketable yield of cucurbits. In this review, we discuss three major groups of WTVs negatively impacting cucurbit cultivation in the southern US, including begomoviruses, criniviruses, and ipomoviruses. Here, we discuss the available information on the biology, epidemiology and advances made toward detecting and managing these viruses, including sources of resistance and cultural practices.

Small RNA Profiling of Cucurbit Yellow Stunting Disorder Virus from Susceptible and Tolerant Squash (Cucurbita pepo) Lines.

RNA silencing is a crucial mechanism of the antiviral immunity system in plants. Small RNAs guide Argonaut proteins to target viral RNA or DNA, preventing virus accumulation. Small RNA profiles in Cucurbita pepo line PI 420328 with tolerance to cucurbit yellow stunting disorder virus (CYSDV) were compared with those in Gold Star, a susceptible cultivar. The lower CYSDV symptom severity in PI 420328 correlated with lower virus titers and fewer sRNAs derived from CYSDV (vsRNA) compared to Gold Star. Elevated levels of 21- and 22-nucleotide (nt) size class vsRNAs were observed in PI 420328, indicating more robust and efficient RNA silencing in PI 420328. The distribution of vsRNA hotspots along the CYSDV genome was similar in both PI 420328 and Gold Star. However, the 3' UTRs, CPm, and p26 were targeted at a higher frequency in PI 420328.

Characterization of gene expression patterns in response to an orthotospovirus infection between two diploid peanut species and their hybrid.

Tomato spotted wilt orthotospovirus (TSWV) transmitted by thrips causes significant yield loss in peanut (Arachis hypogaea L.) production. Use of peanut cultivars with moderate field resistance has been critical for TSWV management. However, current TSWV resistance is often not adequate, and the availability of sources of tetraploid resistance to TSWV is very limited. Allotetraploids derived by crossing wild diploid species could help introgress alleles that confer TSWV resistance into cultivated peanut. Thrips-mediated TSWV screening identified two diploids and their allotetraploid possessing the AA, BB, and AABB genomes Arachis stenosperma V10309, Arachis valida GK30011, and [A. stenosperma × A. valida]4x (ValSten1), respectively. These genotypes had reduced TSWV infection and accumulation in comparison with peanut of pure cultivated pedigree. Transcriptomes from TSWV-infected and non-infected samples from A. stenosperma, A. valida, and ValSten1 were assembled, and differentially expressed genes (DEGs) following TSWV infection were assessed. There were 3,196, 8,380, and 1,312 significant DEGs in A. stenosperma, A. valida, and ValSten1, respectively. A higher proportion of genes decreased in expression following TSWV infection for A. stenosperma and ValSten1, whereas a higher proportion of genes increased in expression following infection in A. valida. The number of DEGs previously annotated as defense-related in relation to abiotic and biotic stress was highest in A. valida followed by ValSten1 and A. stenosperma. Plant phytohormone and photosynthesis genes also were differentially expressed in greater numbers in A. valida followed by ValSten1 and A. stenosperma, with over half of those exhibiting decreases in expression.

Evaluation of Wild Peanut Species and Their Allotetraploids for Resistance against Thrips and Thrips-Transmitted Tomato Spotted Wilt Orthotospovirus (TSWV).

Thrips-transmitted tomato spotted wilt orthotospovirus (TSWV) causes spotted wilt disease in peanut (Arachis hypogaea L.) and limits yield. Breeding programs have been developing TSWV-resistant cultivars, but availability of sources of resistance against TSWV in cultivated germplasm is extremely limited. Diploid wild Arachis species can serve as important sources of resistance, and despite ploidy barriers (cultivated peanut is tetraploid), their usage in breeding programs is now possible because of the knowledge and development of induced interspecific allotetraploid hybrids. This study screened 10 wild diploid Arachis and six induced allotetraploid genotypes via thrips-mediated TSWV transmission assays and thrips' feeding assays in the greenhouse. Three parameters were evaluated: percent TSWV infection, virus accumulation, and temporal severity of thrips feeding injury. Results indicated that the diploid A. stenosperma accession V10309 and its derivative-induced allotetraploid ValSten1 had the lowest TSWV infection incidences among the evaluated genotypes. Allotetraploid BatDur1 had the lowest thrips-inflicted damage at each week post thrips release, while diploid A. batizocoi accession K9484 and A. duranensis accession V14167 had reduced feeding damage one week post thrips release, and diploids A. valida accession GK30011 and A. batizocoi had reduced feeding damage three weeks post thrips releasethan the others. Overall, plausible TSWV resistance in diploid species and their allotetraploid hybrids was characterized by reduced percent TSWV infection, virus accumulation, and feeding severity. Furthermore, a few diploids and tetraploid hybrids displayed antibiosis against thrips. These results document evidence for resistance against TSWV and thrips in wild diploid Arachis species and peanut-compatible-induced allotetraploids.

Cotton leafroll dwarf disease: An enigmatic viral disease in cotton.

TAXONOMY: Cotton leafroll dwarf virus (CLRDV) is a member of the genus Polerovirus, family Solemoviridae. Geographical Distribution: CLRDV is present in most cotton-producing regions worldwide, prominently in North and South America. PHYSICAL PROPERTIES: The virion is a nonenveloped icosahedron with T = 3 icosahedral lattice symmetry that has a diameter of 26-34 nm and comprises 180 molecules of the capsid protein. The CsCl buoyant density of the virion is 1.39-1.42 g/cm3 and S20w is 115-127S. Genome: CLRDV shares genomic features with other poleroviruses; its genome consists of monopartite, single-stranded, positive-sense RNA, is approximately 5.7-5.8 kb in length, and is composed of seven open reading frames (ORFs) with an intergenic region between ORF2 and ORF3a. TRANSMISSION: CLRDV is transmitted efficiently by the cotton aphid (Aphis gossypii Glover) in a circulative and nonpropagative manner. Host: CLRDV has a limited host range. Cotton is the primary host, and it has also been detected in different weeds in and around commercial cotton fields in Georgia, USA. SYMPTOMS: Cotton plants infected early in the growth stage exhibit reddening or bronzing of foliage, maroon stems and petioles, and drooping. Plants infected in later growth stages exhibit intense green foliage with leaf rugosity, moderate to severe stunting, shortened internodes, and increased boll shedding/abortion, resulting in poor boll retention. These symptoms are variable and are probably influenced by the time of infection, plant growth stage, varieties, soil health, and geographical location. CLRDV is also often detected in symptomless plants. CONTROL: Vector management with the application of chemical insecticides is ineffective. Some host plant varieties grown in South America are resistant, but all varieties grown in the United States are susceptible. Integrated disease management strategies, including weed management and removal of volunteer stalks, could reduce the abundance of virus inoculum in the field.

Persistent, and Asymptomatic Viral Infections and Whitefly-Transmitted Viruses Impacting Cantaloupe and Watermelon in Georgia, USA.

Cucurbits in Southeastern USA have experienced a drastic decline in production over the years due to the effect of economically important viruses, mainly those transmitted by the sweet potato whitefly (Bemisia tabaci Gennadius). In cucurbits, these viruses can be found as a single or mixed infection, thereby causing significant yield loss. During the spring of 2021, surveys were conducted to evaluate the incidence and distribution of viruses infecting cantaloupe (n = 80) and watermelon (n = 245) in Georgia. Symptomatic foliar tissues were collected from six counties and sRNA libraries were constructed from seven symptomatic samples. High throughput sequencing (HTS) analysis revealed the presence of three different new RNA viruses in Georgia: cucumis melo endornavirus (CmEV), cucumis melo amalgavirus (CmAV1), and cucumis melo cryptic virus (CmCV). Reverse transcription-polymerase chain reaction (RT-PCR) analysis revealed the presence of CmEV and CmAV1 in 25% and 43% of the total samples tested, respectively. CmCV was not detected using RT-PCR. Watermelon crinkle leaf-associated virus 1 (WCLaV-1), recently reported in GA, was detected in 28% of the samples tested. Furthermore, RT-PCR and PCR analysis of 43 symptomatic leaf tissues collected from the fall-grown watermelon in 2019 revealed the presence of cucurbit chlorotic yellows virus (CCYV), cucurbit yellow stunting disorder virus (CYSDV), and cucurbit leaf crumple virus (CuLCrV) at 73%, 2%, and 81%, respectively. This finding broadens our knowledge of the prevalence of viruses in melons in the fall and spring, as well as the geographical expansion of the WCLaV-1 in GA, USA.

Wild Radish (Raphanus raphanistrum L.) Is a Potential Reservoir Host of Cucurbit Chlorotic Yellows Virus.

Cucurbit chlorotic yellows virus (CCYV) belongs to the genus Crinivirus and is part of a complex of whitefly-transmitted viruses that cause yellowing disease in cucurbits. In the southeastern USA, heavy incidences of CCYV have been observed on all cucurbits grown in the fall. CCYV was detected from wild radish (Raphanus raphanistrum L.), a common weed that grows in the southeastern USA by high-throughput sequencing as well as RT-PCR. CCYV sequence from wild radish was 99.90% and 99.95%, identical to RNA 1 and RNA 2 of cucurbit isolates of CCYV from the region. Transmission assays using whiteflies demonstrated that wild radish is a good host for CCYV. Whiteflies were also able to acquire CCYV from wild radish and transmit the virus to cucurbit hosts, which developed typical symptoms associated with CCYV. Using quantitative PCR, the titer of CCYV in wild radish was also estimated to be on par with that of cucurbit hosts of the virus. Whitefly bioassays revealed that wild radish is an acceptable feeding and reproductive host plant. These results indicate that wild radish could serve as a reservoir host for CCYV in the USA and other parts of the world where similar conditions exist.