RESUMO
The DNA G-quadruplex is known for forming a range of topologies and for the observed lability of the assembly, consistent with its transient formation in live cells. The stabilization of a particular topology by a small molecule is of great importance for therapeutic applications. Here, we show that the ruthenium complex Λ-[Ru(phen)2(qdppz)]2+ displays enantiospecific G-quadruplex binding. It crystallized in 1:1 stoichiometry with a modified human telomeric G-quadruplex sequence, GGGTTAGGGTTAGGGTTTGGG (htel21T18), in an antiparallel chair topology, the first structurally characterized example of ligand binding to this topology. The lambda complex is bound in an intercalation cavity created by a terminal G-quartet and the central narrow lateral loop formed by T10-T11-A12. The two remaining wide lateral loops are linked through a third K+ ion at the other end of the G-quartet stack, which also coordinates three thymine residues. In a comparative ligand-binding study, we showed, using a Klenow fragment assay, that this complex is the strongest observed inhibitor of replication, both using the native human telomeric sequence and the modified sequence used in this work.
Assuntos
Quadruplex G , Rutênio , Dicroísmo Circular , DNA/química , Humanos , Rutênio/química , Telômero/metabolismoRESUMO
Λ-[Ru(TAP)2(dppz)]2+ was crystallised with the G-quadruplex-forming heptamer d(TAGGGTT). Surprisingly, even though there are four unique binding sites, the complex is not in contact with any G-quartet surface. Two complexes stabilise cavities formed from terminal T·A and T·T mismatched pairs. A third shows kinking by a TAP ligand between T·T linkages, while the fourth shows sandwiching of a dppz ligand between a T·A/T·A quadruplex and a T·T mismatch, stabilised by an additional T·A base pair stacking interaction on a TAP surface. Overall, the structure shows an unexpected affinity for thymine, and suggests models for G-quadruplex loop binding.