Genetic preservation of SLC22A3 in the Admixed and Xhosa populations living in the Western Cape.

BACKGROUND: Amphiphilic solute facilitator organic cation transporters mediate the movement of various endogenous and exogenous organic cations, including crucial drugs like metformin, oxaliplatin, and lamivudine. These transporters are now seen as a potential explanation for inter-individual differences in drug effectiveness, contributing to 15-30% of such variability due to genetic factors.The aim of this study was to determine the baseline minor allele frequency distribution of 18 known coding SNPs in the SLC22A3 gene of 278 Cape Admixed (130) and Xhosa (148) individuals residing in Cape Town, South Africa. METHODS: A convenience sampling method was used for sample collection. DNA extraction and subsequent amplification of target sites was carried out according to standard established methodologies. All genotyping was performed using the SNaPshot™ mini-seuqencing platform. RESULTS: This study found no genetic polymorphisms in the coding region of the SLC22A3 gene of both the Xhosa and Cape Admixed individuals investigated. CONCLUSION: This study has shown that SLC22A3 coding SNPs observed in other populations are absent in the sample of both Cape Admixed and Xhosa individuals studied. The lack of protein sequence variation was consistent with other studies and may reflect the significant physiological role of human organic cation transporter 3 in maintaining cellular and organismal homeostasis.

Cross-sectional study of prevalence and determinants of uncontrolled hypertension among South African adult residents of Mkhondo municipality.

BACKGROUND: Achieving the blood pressure treatment target in individuals with hypertension is a serious global health challenge. Furthermore, the actual burden of uncontrolled hypertension is poorly understood, especially in the developing countries. Therefore, this study comprehensively examined the prevalence and factors associated with uncontrolled hypertension in individuals receiving care at the primary healthcare facilities in the rural areas of Mkhondo Municipality in the Mpumalanga Province, South Africa. METHODS: In this cross-sectional study, 329 individuals attending care for hypertension were recruited from January 2019 to June 2019 at three primary healthcare centres, namely, Piet Retief hospital, Mkhondo town clinic and Thandukukhanya community health centre. Uncontrolled hypertension was defined as systolic blood pressure ≥ 140 mmHg and/or diastolic blood pressure ≥ 90 mmHg in accordance with the South African Hypertension Society guideline (2014). Multiple logistic regression (Forward LR method) analysis was used to identify the significant determinants of uncontrolled hypertension. RESULTS: The majority of the participants were 55 years old and above (69.0%), Zulus (81.2%), non-smokers (84.19%) and had been diagnosed with hypertension for more than a year prior to the study (72.64%). The overall prevalence of uncontrolled hypertension was 56.83% (n = 187) with no significant difference between sexes, 57.38% male versus 56.88% female, respectively. In the multiple logistic regression model analysis after adjusting for confounding variables, obesity (AOR = 2.90; 95% CI 1.66-5.05), physical activity (AOR = 4.79; 95% CI 2.15-10.65) and HDL-C (AOR = 5.66; 95% CI 3.33-9.60) were the significant and independent determinants of uncontrolled hypertension in the cohort. CONCLUSION: The high prevalence of uncontrolled hypertension in the study setting can be largely attributed to obesity, physical activity and dyslipidaemia. Treatment will require the collaborative efforts of individuals, clinicians and health authorities. All these determinants should be addressed decisively so as to achieve the treatment blood pressure targets in the study population.

Glucose-Uptake Activity and Cytotoxicity of Diterpenes and Triterpenes Isolated from Lamiaceae Plant Species.

The prevalence of diabetes mellitus (DM), considered one of the most common metabolic disorders, has dramatically increased and resulted in higher rates of morbidity and mortality around the world in the past decade. It is well known that insulin resistance in target tissues and a deficiency in insulin secretion from pancreatic ß-cells are the main characteristics of type 2 diabetes. The aim of this study was the bio-evaluation of compounds isolated from three selected plant species: namely, Salvia africana-lutea, Leonotis ocymifolia, and Plectranthus madagascariensis, for their glucose-uptake ability. Methanolic extracts were produced from the aerial parts of each plant. Compounds were identified using different spectroscopic techniques. The glucose-uptake ability of each compound was then evaluated in mammalian cells using 2-deoxyglucose-6-phosphate. The cytotoxicity of each compound was established via the MTT assay. Chromatographic purification of the three plant species yielded sixteen pure terpenoids. Compounds 1 (p = 0.0031), 8 (p = 0.0053), and 6 (p = 0.0086) showed a marked increase in glucose uptake, respectively. Additionally, 1, 4, and 6 exhibited cytotoxicity toward mammalian tissue with a decrease in cell viability of ~70%, ~68%, and ~67%, respectively. The results suggested that several compounds demonstrated a marked increase in glucose uptake, while two of the compounds exhibited signs of cytotoxicity. It may, therefore, be suggested that these compounds be considered as potential candidates for novel plant-derived alternative therapies in the treatment of type 2 diabetes.

Pharmacogenomics of amlodipine and hydrochlorothiazide therapy and the quest for improved control of hypertension: a mini review.

Blood pressure (BP) is a complex trait that is regulated by multiple physiological pathways and include but is not limited to extracellular fluid volume homeostasis, cardiac contractility, and vascular tone through renal, neural, or endocrine systems. Uncontrolled hypertension (HTN) has been associated with an increased mortality risk. Therefore, understanding the genetics that underpins and influence BP regulation will have a major impact on public health. Moreover, uncontrolled HTN has been linked to inter-individual variation in the drugs' response and this has been associated with an individual's genetics architecture. However, the identification of candidate genes that underpin the genetic basis of HTN remains a major challenge. To date, few variants associated with inter-individual BP regulation have been identified and replicated. Research in this field has accelerated over the past 5 years as a direct result of on-going genome-wide association studies (GWAS) and the progress in the identification of rare gene variants and mutations, epigenetic markers, and the regulatory pathways involved in the pathophysiology of BP. In this review we describe and enhance our current understanding of how genetic variants account for the observed variability in BP response in patients on first-line antihypertensive drugs, amlodipine and hydrochlorothiazide.

Genetic polymorphisms of the organic cation transporter 1 gene (SLC22A1) within the Cape Admixed population of South Africa.

Human organic cation transporter 1 (hOCT1) is expressed primarily in hepatocytes and mediate the electrogenic transport of various endogenous and exogenous compounds, including clinically important drugs. Genetic polymorphisms in the gene coding for hOCT1, SLC22A1, are increasingly being recognized as a possible mechanism explaining the variable response of individual patients to clinical drugs which are substrates for this transporter. The aim of this study was to investigate the allele and genotype frequencies of single-nucleotide polymorphisms (SNPs) of SLC22A1 in the Cape Admixed population of South Africa. The genotypic and allelic distributions of nineteen nonsynonomous and one intronic SLC22A1 SNPs were determined in 100 healthy Cape Admixed participants, using a SNaPshot(®) multiplex assay. In addition, haplotype structure for SLC22A1 was inferred from the genotypic data. The minor allele frequencies for S14F, P341L, S189L, G220V, V519F, M440I, G465R and the rs622342 intronic variant were 1.0, 0.5, 1.0, 1.0, 1.5, 0.5, 0.5 and 18.0%, respectively. None of the participants carried the variant allele for R61C, C88R, P283L, R287G and G401S. In addition, no variant alleles were observed for A306T, A413V, M420V, I421F, C436F, V501E, and I542V in the population. Twelve haplotypes were inferred from the genotypic data. The frequencies for most common haplotypes CCTCGGCGCGCTAGAGCTGA, CCTCGGCGCGCTAGCGCTGA and CCTCGGCGCGCGAGCGCTGA were 80, 9.9, and 3.5%, respectively.

Genetic polymorphisms and haplotypes of the organic cation transporter 1 gene (SLC22A1) in the Xhosa population of South Africa.

Human organic cation transporter 1 is primarily expressed in hepatocytes and mediates the electrogenic transport of various endogenous and exogenous compounds, including clinically important drugs. Genetic polymorphisms in the gene coding for human organic cation transporter 1, SLC22A1, are increasingly being recognized as a possible mechanism explaining the variable response to clinical drugs, which are substrates for this transporter. The genotypic and allelic distributions of 19 nonsynonymous and one intronic SLC22A1 single nucleotide polymorphisms were determined in 148 healthy Xhosa participants from South Africa, using a SNAPshot(®) multiplex assay. In addition, haplotype structure for SLC22A1 was inferred from the genotypic data. The minor allele frequencies for S14F (rs34447885), P341L (rs2282143), V519F (rs78899680), and the intronic variant rs622342 were 1.7%, 8.4%, 3.0%, and 21.6%, respectively. None of the participants carried the variant allele for R61C (rs12208357), C88R (rs55918055), S189L (rs34104736), G220V (rs36103319), P283L (rs4646277), R287G (rs4646278), G401S (rs34130495), M440I (rs35956182), or G465R (rs34059508). In addition, no variant alleles were observed for A306T (COSM164365), A413V (rs144322387), M420V (rs142448543), I421F (rs139512541), C436F (rs139512541), V501E (rs143175763), or I542V (rs137928512) in the population. Eight haplotypes were inferred from the genotypic data. This study reports important genetic data that could be useful for future pharmacogenetic studies of drug transporters in the indigenous Sub-Saharan African populations.

Reconstruction of major maternal and paternal lineages of the Cape Muslim population.

The earliest Cape Muslims were brought to the Cape (Cape Town - South Africa) from Africa and Asia from 1652 to 1834. They were part of an involuntary migration of slaves, political prisoners and convicts, and they contributed to the ethnic diversity of the present Cape Muslim population of South Africa. The history of the Cape Muslims has been well documented and researched however no in-depth genetic studies have been undertaken. The aim of the present study was to determine the respective African, Asian and European contributions to the mtDNA (maternal) and Y-chromosomal (paternal) gene pool of the Cape Muslim population, by analyzing DNA samples of 100 unrelated Muslim males born in the Cape Metropolitan area. A panel of six mtDNA and eight Y-chromosome SNP markers were screened using polymerase chain reaction-restriction fragment length polymorphisms (PCR-RFLP). Overall admixture estimates for the maternal line indicated Asian (0.4168) and African mtDNA (0.4005) as the main contributors. The admixture estimates for the paternal line, however, showed a predominance of the Asian contribution (0.7852). The findings are in accordance with historical data on the origins of the early Cape Muslims.

Prevalence, patterns and determinants of dyslipidaemia among South African adults with comorbidities.

The present study assessed the prevalence, patterns and determinants of dyslipidaemia among South African adults with multi-morbidities. In this study, 614 individuals with DM and hypertension were recruited. Dyslipidaemia was defined as elevated levels of total cholesterol (TC) ≥ 5.2 mmol/L and/or low-density lipoprotein cholesterol (LDL-C) ≥ 2.6 mmol/L, triglycerides (TG) ≥ 1.8 mmol/L and low high-density lipoprotein cholesterol (HDL-C) < 1 mmol/L for men and < 1.2 mmol/L for women. Multivariate regression model (adjusted) analysis was used to identify the significant determinants of dyslipidaemia. The prevalence of dyslipidaemia was 76.7% (n = 471), with females showing the highest prevalence 357 (75.79%). Elevated TG (62.21%) was the most prevalent form of dyslipidemia. Only 103 (16.77%) participants were on statin therapy. The multivariate logistic regression model analysis (adjusted) showed that, the Zulu ethnicity (AOR = 2.45; 95%CI 1.48-4.05) was associated with high TC. DM (AOR = 2.00; 95%CI 1.30-3.06) and the female sex (AOR = 2.54; 95%CI 1.56-4.12) were associated with low HDL-C. Obesity (AOR = 1.57; 95%CI 1.12-2.21) and the Zulu ethnicity (AOR = 1.60; 95%CI 1.00-2.54) were associated with elevated LDL-C. DM (AOR = 2.32; 95%CI 1.61-3.34) was associated with elevated TG. We found a high prevalence of dyslipidaemia. The study further demonstrated that prevention and treatment of dyslipidaemia should be prioritised among individuals with multi-morbidities.

The determination of the effect(s) of solute carrier family 22-member 2 (SLC22A2) haplotype variants on drug binding via molecular dynamic simulation systems.

Single nucleotide polymorphisms detected in the solute carrier member family-22 has been shown to result in a variable response in the treatment of type 2 diabetes mellitus with Metformin. This study predicted a three-dimensional protein structure for the SLC22A2 protein sequence using AlphaFold 2 and modelled five haplotypes within SLC22A2 protein structure observed in the Xhosa population of South Africa. The protein models were used to determine the effect(s) of haplotype variations on the transport function of Metformin and 10 other drugs by the SLC22A2 protein. Molecular dynamic simulation studies, molecular docking and interaction analysis of the five SLC22A2 haplotypes were performed in complex with the ligand 5RE in a POPC lipid bilayer to understand the mechanism of drug binding. Weakest binding free energy was found between 5RE and haplotype 1. Molecular docking studies indicated the top binding ligands as well as Metformin to bind inside the transport channel in all haplotypes increasing the probability of Metformin inhibition during co-administration of drugs. Metformin showed reduced binding affinity and number of interactions compared to the top four binding molecules. Molecular dynamic simulation analysis indicated that haplotypes 1, 3 and 4 were less stable than 2 and 5. The findings suggest haplotypes 4 and 5 having stronger preference for large inhibitor molecule binding in the active site and this could result in haplotypes 4 and 5 demonstrating reduced Metformin clearance via the SLC22A2 transporter during co-administration of drugs. The current study is the first to investigate the potential effect(s) of haplotype variation on the protein structure of SLC22A2 to assess its ability to transport Metformin in an indigenous South African population.

Single Nucleotide Polymorphisms in Amlodipine-Associated Genes and Their Correlation with Blood Pressure Control among South African Adults with Hypertension.

Objective: This study describes the single nucleotide polymorphisms (SNPs) in amlodipine-associated genes and assesses their correlation with blood pressure control among South African adults with hypertension. Methods: In total, 304 hypertensive patients on amlodipine treatment belonging to the indigenous Swati, Xhosa and Zulu population groups of South Africa were recruited between June 2017 and June 2019. Participants were categorized into: controlled (blood pressure < 140/90 mmHg) and uncontrolled (blood pressure ≥ 140/90 mmHg) hypertension. Thirteen SNPs in amlodipine pharmacogenes with a high PharmGKB evidence base were selected and genotyped using MassArray (Agena BioscienceTM). Logistic regression was fitted to identify significant associations between the SNPs and blood pressure control with amlodipine. Results: The majority of the participants were females (76.6%), older than 45 years (89.1%) and had uncontrolled hypertension (52.3%). Of the 13 SNPs genotyped, five SNPs, rs1042713 (minor allele frequency = 45.9%), rs10494366 (minor allele frequency = 35.3%), rs2239050 (minor allele frequency = 28.7%), rs2246709 (minor allele frequency = 51.6%) and rs4291 (minor allele frequency = 34.4%), were detected among the Xhosa participants, while none were detected among the Swati and Zulu tribal groups. Variants rs1042713 and rs10494366 demonstrated an expression frequency of 97.5% and 79.5%, respectively. Variant TA genotype of rs4291 was significantly associated with uncontrolled hypertension. No association was established between blood pressure response to amlodipine and the remaining four SNPs. Conclusions: This study reports the discovery of five SNPs in amlodipine genes (rs2239050, rs2246709, rs4291, rs1042713 and rs10494366) among the indigenous Xhosa-speaking tribe of South Africa. In addition, the TA genotype of rs4291 was associated with blood pressure control in this cohort. These findings might open doors for more pharmacogenomic studies, which could inform innovations to personalised anti-hypertensive treatment in the ethnically diverse population of South Africa.

Promoter haplotype structure of solute carrier 22 member 2 (SLC22A2) in the Xhosa population of South Africa and their differential effect on gene expression.

SLC22A2 is abundantly expressed in the kidney and facilitates the transport of endogenous and exogenous cationic compounds. It plays a pivotal role in the transport of pharmacologically important compounds such as metformin, cisplatin, lamivudine and cimetidine. Polymorphisms within SLC22A2 could potentially contribute to the inter-individual variable response to drugs. The SLC22A2 gene is known to show polymorphism variability amongst populations of different ethnicities. The present study was undertaken to characterize the promoter haplotype structure of the SLC22A2 gene in the Xhosa population of South Africa. In addition to this, we also investigate the effects of the observed promoter haplotypes on gene expression levels in vitro. We identified six known single nucleotide polymorphisms in the promoter region, namely rs60249401 (G424A), rs113150889 (G289A), rs55920607 (C246T), rs59695691 (A195G), rs572296424 (G156A), rs150063153 (A95C/G) and one novel SNP at location 6:160258967 (A209T). While these polymorphisms appeared in other African and non-African populations, their minor allele frequencies differed considerably from the non-African populations and could be considered to be African specific. A total of nine promoter haplotypes were characterized and the functional significance of each haplotype on promoter activity was determined using a luciferase reporter assay system. Amongst the nine observed haplotypes, three haplotypes (i.e. haplotypes 7, 8 and 9) displayed a significant decrease in expression level when compared to the wild-type with p -values of: 0.0317, <0.0001 and 0.0013 respectively. The data presented here shows African specific promoter haplotypes to cause a decrease in SLC22A2 gene expression levels, which in turn may have an impact on the pharmacokinetic profiles of cationic drugs.

Methylenetetrahydrofolate Reductase Polymorphism (rs1801133) and the Risk of Hypertension among African Populations: A Narrative Synthesis of Literature.

In this review, we have gathered and analyzed the available genetic evidence on the association between the methylenetetrahydrofolate reductase gene (MTHFR), rs1801133 and the risk of Hypertension (HTN) in African populations, which was further compared to the global data evidence. This review was reported following the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) protocol and Human Genome Epidemiology Network (HuGENet) guidelines. Literature was retrieved through major search databases, including PubMed, Scopus, Web of Science, and African Journal Online. We identified 64 potential studies, of which 4 studies were from the African continent and 60 studies were reported globally. Among the studies conducted in Africa, only two (n = 2) reported a significant association between the MTHFR (rs1801133) and the risk of developing HTN. Only one (n = 1) study population was purely composed of black Africans, while others were of other ethnicities. Among studies conducted in other continents (n = 60), forty-seven (n = 47) studies reported a positive association between MTHFR (rs1801133) and the risk of developing HTN, whereas the remaining studies (n = 14) did not show a significant association. Available literature suggests an apparent association between rs1801133 and HTN in global regions; however, such information is still scarce in Africa, especially in the black African population.

The association of MTHFR (rs1801133) with hypertension in an indigenous south African population.

Aims: The current study sought to investigate the association between the methylenetetrahydrofolate reductase (MTHFR) variant (rs1801133) and the risk of developing hypertension (HTN) in an indigenous South African population. Methods: A total of 442 participants (hypertensive, n = 279 and non-hypertensive, n = 163) from the indigenous tribe residing in Mthatha, Eastern Cape (South Africa) were recruited. HTN was defined as a systolic (SBP) and diastolic blood pressure (DBP) of ≥130/80 mmHg following American Heart Association guidelines. The genotyping of MTHFR (rs1801133) was assessed using MassARRAY® System. Thereafter, the association between rs1801133 in various genetic models and HTN was determined by logistic regression model analysis. Furthermore, the interaction between rs1801133 and selected risk factors on HTN was performed using the open-source multifactor dimensionality reduction (MDR). Results: The low frequency of the T allele (5%) was also observed when compared with the C allele (95%) in both cases and controls. After adjusting for confounding factors (gender, smoking status, BMI, and blood glucose levels), there were no significant associations were observed between rs1801133 and the risk of HTN in all genetic models: genotypic (OR 0.75, 95% CI 0.29-1.95, p = 0.56), dominant (OR 0.86, 95% CI 0.35-2.16, p = 0.75), co-dominant (OR 1.33, 95% CI 0.51-3.48, p = 0.55) and allelic (OR 0.80, 95% CI 0.49-1.62, p = 0.70) in logistic regression analysis. However, a significant interaction was reported among rs1801133, age, and gender (p < 0.0001) with the risk of HTN. Conclusion: The present study reports on the lack of association between MTHFR (rs1801133) and the risk of HTN in an indigenous South African tribe. However, an interaction between gender, age, and rs1801133 was observed. Thus, future studies with a large sample size are required to further validate these findings.

Pharmacogenomics and prescription opioid use.

Genome-wide association studies and candidate gene findings suggest that genetic approaches may help in choosing the most appropriate drug and dosage, while preventing adverse drug reactions. This is the field that addresses precision medicine: to evaluate variations in the DNA sequence that could be responsible for different individual analgesic response. We review potential gene biomarkers with best overall convergent functional evidence, for opioid use, in pain management. Polymorphisms can modify pharmacodynamics (i.e., mu opioid receptor, OPRM1) and pharmacokinetics (i.e., CYP2D6 phenotypes) pathways altering opioid effectiveness, consumption, side effects or additionally, prescription opioid use dependence vulnerability. This review provides a summary of these candidate variants for the translation of genotype into clinically useful information in pain medicine.

Cross-sectional study of the association of 5 single nucleotide polymorphisms with enalapril treatment response among South African adults with hypertension.

ABSTRACT: This study investigates the association of 5 single nucleotide polymorphisms (SNPs) in selected genes (ABO, VEGFA, BDKRB2, NOS3, and ADRB2) with blood pressure (BP) response to enalapril. The study further assessed genetic interactions that exist within these genes and their implications in enalapril treatment response among South African adults with hypertension.A total of 284 participants belonging to the Nguni tribe of South Africa on continuous treatment for hypertension were recruited. Five SNPs in enalapril pharmacogenes were selected and genotyped using MassArray. Uncontrolled hypertension was defined as BP ≥140/90 mm Hg. The association between genotypes, alleles, and BP response to treatment was determined by fitting multivariate logistic regression model analysis, and genetic interactions between SNPs were assessed by multifactor dimensionality reduction.Majority of the study participants were female (75.00%), Xhosa (78.87%), and had uncontrolled hypertension (69.37%). All 5 SNPs were exclusively detected among Swati and Zulu participants. In the multivariate (adjusted) logistic model analysis, ADRB2 rs1042714 GC (adjusted odds ratio [AOR] = 2.31; 95% confidence interval [CI] 1.02-5.23; P = .044) and BDKRB2 rs1799722 CT (AOR = 2.74; 95% CI 1.19-6.28; P = .017) were independently associated with controlled hypertension in response to enalapril. While the C allele of VEGFA rs699947 (AOR = 0.37; 95% CI 0.15-0.94; P = .037) was significantly associated with uncontrolled hypertension. A significant interaction between rs699947, rs495828, and rs2070744 (cross-validation consistency = 10/10; P = .0005) in response to enalapril was observed.We confirmed the association of rs1042714 (ADRB2) and rs1799722 (BDKRB2) with controlled hypertension and established an interaction between rs699947 (VEGFA), rs495828 (ABO), and rs2070744 (NOS3) with BP response to enalapril. Our findings have provided substantial evidence for the use of SNPs as predictors for enalapril response among South Africans adults with hypertension.

Single Nucleotide Polymorphisms Associated with Metformin and Sulphonylureas' Glycaemic Response among South African Adults with Type 2 Diabetes Mellitus.

AIMS: To examine the association of polymorphisms belonging to SLC22A1, SP1, PRPF31, NBEA, SCNN1B, CPA6 and CAPN10 genes with glycaemic response to metformin and sulphonylureas (SU) combination therapy among South African adults with diabetes mellitus type 2 (T2DM). METHODS: A total of 128 individuals of Swati (n = 22) and Zulu (n = 106) origin attending chronic care for T2DM were recruited. Nine SNPs previously associated with metformin and SUs were selected and genotyped using MassArray. Uncontrolled T2DM was defined as HbA1c > 7%. The association between genotypes, alleles and glycaemic response to treatment was determined using multivariate logistic regression model analysis. RESULTS: About 85.93% (n = 110) of the study participants were female and 77.34% (n = 99) had uncontrolled T2DM (HbA1c > 7%). In the multivariate (adjusted) logistic regression model analysis, the CC genotype of rs2162145 (CPA6), GG and GA genotypes of rs889299 (SCNN1B) were significantly associated with uncontrolled T2DM. On the other hand, the C allele of rs254271 (PRPF31) and the GA genotype of rs3792269 (CAPN10) were associated with controlled T2DM. A significant interaction between rs2162145 and rs889299 in response to metformin and SU combination therapy was observed. CONCLUSIONS: In this study, we reported the association of rs2162145 (CC) and rs889299 (GG and GA) with uncontrolled T2DM. We also reported the association of rs254271 (C) and rs3792269 (GA) with controlled T2DM in response to metformin and SU combination therapy. Furthermore, an interaction between rs2162145 and rs889299 was established, where the genotype combination GA (rs889299) and TT (rs2162145) was associated with uncontrolled T2DM.

Prevalence of Hypertension and Its Associated Risk Factors in a Rural Black Population of Mthatha Town, South Africa.

Background: The occurrence of hypertension has been increasing alarmingly in both low and middle-income countries. Despite acknowledging hypertension as the most common life-threatening risk factor for cardiovascular disease (CVD), a dearth of data is available on the prevalence, awareness, and determinants of hypertension in rural parts of South Africa. The principal aim of the current study is to determine the prevalence and associated risk factors of hypertension among a black rural African population from the Mtatha town of Eastern Cape Province. Methods: This was a cross-sectional study, and individuals over 18 years of age were randomly screened using a World Health Organization stepwise questionnaire. Sociodemographic information, anthropometric measurements, fasting blood glucose levels, and three independent blood pressure (BP) readings were measured. Blood pressure measurements were classified according to the American Heart Association guidelines. Univariate and multivariate analyses were performed to determine the significant predictors of hypertension. Results: Of the total participants (n = 556), 71% of individuals had BP scores in the hypertensive range. In univariate analysis, age, westernized diet, education, income, and diabetic status, as well as overweight/obese status were positively associated with the prevalence of hypertension. However, in a multivariate logistic regression analysis only, age, body mass index (BMI), diabetic status, and westernized diet were significantly associated with a higher risk of developing hypertension. Gender, age, and BMI were potential factors having a significant association with the treatment of hypertension. Individuals who did not consider the importance of medicine had higher chances of having their hypertension being untreated. Conclusions: Prevalence of hypertension was high among the black rural African population of Mthatha town. Gender, age, westernized diet, education level, income status, diabetic as well as overweight/obese status were the most significant predictors of hypertension.

Hypertension in African Populations: Review and Computational Insights.

Hypertension (HTN) is a persistent public health problem affecting approximately 1.3 billion individuals globally. Treatment-resistant hypertension (TRH) is defined as high blood pressure (BP) in a hypertensive patient that remains above goal despite use of ≥3 antihypertensive agents of different classes including a diuretic. Despite a plethora of treatment options available, only 31.0% of individuals have their HTN controlled. Interindividual genetic variability to drug response might explain this disappointing outcome because of genetic polymorphisms. Additionally, the poor knowledge of pathophysiological mechanisms underlying hypertensive disease and the long-term interaction of antihypertensive drugs with blood pressure control mechanisms further aggravates the problem. Furthermore, in Africa, there is a paucity of pharmacogenomic data on the treatment of resistant hypertension. Therefore, identification of genetic signals having the potential to predict the response of a drug for a given individual in an African population has been the subject of intensive investigation. In this review, we aim to systematically extract and discuss African evidence on the genetic variation, and pharmacogenomics towards the treatment of HTN. Furthermore, in silico methods are utilized to elucidate biological processes that will aid in identifying novel drug targets for the treatment of resistant hypertension in an African population. To provide an expanded view of genetic variants associated with the development of HTN, this study was performed using publicly available databases such as PubMed, Scopus, Web of Science, African Journal Online, PharmGKB searching for relevant papers between 1984 and 2020. A total of 2784 articles were reviewed, and only 42 studies were included following the inclusion criteria. Twenty studies reported associations with HTN and genes such as AGT (rs699), ACE (rs1799752), NOS3 (rs1799983), MTHFR (rs1801133), AGTR1 (rs5186), while twenty-two studies did not show any association within the African population. Thereafter, an in silico predictive approach was utilized to identify several genes including CLCNKB, CYPB11B2, SH2B2, STK9, and TBX5 which may act as potential drug targets because they are involved in pathways known to influence blood pressure. Next, co-expressed genes were identified as they are controlled by the same transcriptional regulatory program and may potentially be more effective as multiple drug targets in the treatment regimens for HTN. Genes belonging to the co-expressed gene cluster, ACE, AGT, AGTR1, AGTR2, and NOS3 as well as CSK and ADRG1 showed enrichment of G-protein-coupled receptor activity, the classical targets of drug discovery, which mediate cellular signaling processes. The latter is of importance, as the targeting of co-regulatory gene clusters will allow for the development of more effective HTN drug targets that could decrease the prevalence of both controlled and TRH.

Genomic Association of Single Nucleotide Polymorphisms with Blood Pressure Response to Hydrochlorothiazide among South African Adults with Hypertension.

This study described single nucleotide polymorphisms (SNPs) in hydrochlorothiazide-associated genes and further assessed their correlation with blood pressure control among South African adults living with hypertension. A total of 291 participants belonging to the Nguni tribes of South Africa on treatment for hypertension were recruited. Nineteen SNPs in hydrochlorothiazide pharmacogenes were selected and genotyped using MassArray. Uncontrolled hypertension was defined as blood pressure ≥140/90 mmHg. The association between genotypes, alleles and blood pressure response to treatment was determined by conducting multivariate logistic regression model analysis. The majority of the study participants were female (73.19%), Xhosa (54.98%) and had blood pressure ≥140/90 mmHg (68.73%). Seventeen SNPs were observed among the Xhosa tribe, and two (rs2070744 and rs7297610) were detected among Swati and Zulu participants. Furthermore, alleles T of rs2107614 (AOR = 6.69; 95%CI 1.42-31.55; p = 0.016) and C of rs2776546 (AOR = 3.78; 95%CI 1.04-13.74; p = 0.043) were independently associated with uncontrolled hypertension, whilst rs2070744 TC (AOR = 38.76; 95%CI 5.54-270.76; p = 0.00023), CC (AOR = 10.44; 95%CI 2.16-50.29; p = 0.003) and allele T of rs7297610 (AOR = 1.86; 95%CI 1.09-3.14; p = 0.023) were significantly associated with uncontrolled hypertension among Zulu and Swati participants. We confirmed the presence of SNPs associated with hydrochlorothiazide, some of which were significantly associated with uncontrolled hypertension in the study sample. Findings open doors for further studies on personalized therapy for hypertension in the country.

Factors associated with glycemic control among South African adult residents of Mkhondo municipality living with diabetes mellitus.

This study examines the rate and the influencing factors of glycemic control among adult residents living with DM in Mkhondo Municipality of South Africa.In this cross-sectional study, 157 individuals attending care for DM were recruited. Glycemic control status was categorized as poor if glycated hemoglobin (HbA1c) > 7% and very poor if HbA1c ≥ 9%. Multivariate regression analysis was used to identify the significant determinants of poor and very poor glycemic control.The majority of the study participants were females (84.71%) and above 45 years old (88.55%). The overall prevalence of poor glycemic control was 77.71% (n = 122), while very poor glycemic control occurred in 50.6% (n = 80) of the study cohort. In the multivariate logistic regression model analysis, African traditional [AOR = 0.15; 95% confidence interval (95% CI) 0.04-0.57], fast food consumption (AOR = 5.89; 95% CI 2.09-16.81), elevated total cholesterol (TC) [odds ratio (OR) = 2.33; 95% CI 1.50-5.17], elevated low-density lipoprotein cholesterol (LDL-C) (AOR = 5.28; 95% CI 1.89-14.69), and triglyceride (TG) (AOR = 4.39; 95% CI 1.48-13.00) were the independent and significant determinants of poor glycemic control. Age (AOR = 0.46; 95% CI 0.23-0.92) was the only independent and significant determinant of very poor glycemic control.We found a high rate of poor glycemic control (77.71%) possibly attributed to religious affiliation, fast food consumption, and dyslipidemia. On the contrary, about half of the study sample had very poor glycemic control (HbA1c ≥9%), which was predominant among younger cohort with diabetes mellitus. Interventions aimed at improving glycemic control in this population must also target religious practice, dietary patterns and dyslipidemia as well as tailored-approach for young people.