RESUMO
A light scalar field framework of dark energy, sometimes referred to as quintessence, introduces a fifth force between normal matter objects. Screening mechanisms, such as the chameleon model, allow the scalar field to be almost massless on cosmological scales while simultaneously evading laboratory constraints. We explore the ability of existing mechanical systems to directly detect the fifth force associated with chameleons in an astrophysically viable regime where it could be dark energy. We provide analytical expressions for the weakest accessible chameleon model parameters in terms of experimentally tunable variables and apply our analysis to two mechanical systems: levitated microspheres and torsion balances, showing that the current generation of these experiments have the sensitivity to rule out a significant portion of the proposed chameleon parameter space. We also indicate regions of theoretically well-motivated chameleon parameter space to guide future experimental work.
RESUMO
The National Institute of Standards and Technology administers quality assurance programs devoted to improving measurements of nutrients and related metabolites in foods, dietary supplements, and serum and plasma samples. These programs have been developed in collaboration with the National Institutes of Health to assist measurement communities in their efforts to achieve accurate results that are comparable among different laboratories and over time. Targeted analytes include micronutrients, botanical markers, nutritional elements, contaminants, fatty acids, and vitamin D metabolites.
Assuntos
Suplementos Nutricionais/análise , Ácidos Graxos/sangue , Análise de Alimentos/normas , Micronutrientes/sangue , Suplementos Nutricionais/normas , Ácidos Graxos/normas , Análise de Alimentos/métodos , Humanos , Micronutrientes/normas , National Institutes of Health (U.S.) , Controle de Qualidade , Reprodutibilidade dos Testes , Sensibilidade e Especificidade , Estados UnidosRESUMO
A suite of three green tea-containing Standard Reference Materials (SRMs) has been issued by the National Institute of Standards and Technology (NIST): SRM 3254 Camellia sinensis (Green Tea) Leaves, SRM 3255 Camellia sinensis (Green Tea) Extract, and SRM 3256 Green Tea-Containing Solid Oral Dosage Form. The materials are characterized for catechins, xanthine alkaloids, theanine, and toxic elements. As many as five methods were used in assigning certified and reference values to the constituents, with measurements carried out at NIST and at collaborating laboratories. The materials are intended for use in the development and validation of new analytical methods, and for use as control materials as a component in the support of claims of metrological traceability.
Assuntos
Camellia sinensis/química , Análise de Alimentos/normas , Chá/química , Análise de Alimentos/métodos , Padrões de ReferênciaRESUMO
A new multivitamin/multielement dietary supplement Standard Reference Material (SRM) has been issued by the National Institute of Standards and Technology (NIST), with certified and reference concentration values for 13 vitamins, 24 elements, and 2 carotenoids. The constituents have been measured by multiple analytical methods with data contributed by NIST and by collaborating laboratories. This effort included the first use of isotope dilution mass spectrometry for value assignment of both fat-soluble vitamins (FSVs) and water-soluble vitamins (WSVs). Excellent agreement was obtained among the methods, with relative expanded uncertainties for the certified concentration values typically ranging from <2% to 15% for vitamins.
Assuntos
Carotenoides/normas , Suplementos Nutricionais/análise , Suplementos Nutricionais/normas , Vitaminas/normas , Carotenoides/análise , Carotenoides/química , Carotenoides/isolamento & purificação , Controle de Qualidade , Padrões de Referência , Comprimidos , Vitaminas/análise , Vitaminas/química , Vitaminas/isolamento & purificaçãoRESUMO
BACKGROUND: Blunt cerebrovascular injuries (BCVI) in trauma patients are rare but potentially devastating injuries, particularly if the diagnosis is delayed. Conventional angiography (CA) has been the screening and diagnostic modality of choice for identifying BCVI. With the advent of high-resolution computed tomography (CT), CT angiography has become a common modality for the screening of BCVI. A liberalized screening approach has suggested that cerebrovascular injuries are missed in many patients; however, no standard BCVI screening protocol exists. Early diagnosis of the BCVI can prevent long-term sequelae. METHODS: In this prospective study, all patients received a CT angiogram (16-slice or 64-slice) at the time of injury assessment and followed 24 hours to 48 hours later with CA of the cerebrovasculature. RESULTS: A total of 158 patients were enrolled in the study. CA identified 32 injuries to the cerebrovasculature in 27 patients; CT detected only 13 true injuries (40.6%) in 12 patients. Of the 32 injuries, 11 were carotid artery injuries and 21 were of the vertebral artery. Seventy-four patients were screened with the 16-slice CT scanner with an overall sensitivity of 29%, and 84 patients were screened with the 64-slice CT scanner with an overall sensitivity of 54%. The combined specificity and sensitivity of 16- and 64-slice CT in detecting BCVI were 0.97 (95% confidence interval: 0.92-0.99) and 0.41 (95% confidence interval: 0.22-0.61), respectively. CONCLUSION: Neither 16- nor 64-slice CT angiography is as accurate as CA as a screening tool for BCVI.
Assuntos
Angiografia Cerebral/métodos , Traumatismo Cerebrovascular/diagnóstico por imagem , Ferimentos não Penetrantes/diagnóstico por imagem , Adulto , Lesões das Artérias Carótidas/diagnóstico por imagem , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Estudos Prospectivos , Sensibilidade e Especificidade , Tomografia Computadorizada por Raios X , Artéria Vertebral/lesõesRESUMO
A suite of three dietary supplement standard reference materials (SRMs) containing bitter orange has been developed, and the levels of five alkaloids and caffeine have been measured by multiple analytical methods. Synephrine, octopamine, tyramine, N-methyltyramine, hordenine, total alkaloids, and caffeine were determined by as many as six analytical methods, with measurements performed at the National Institute of Standards and Technology and at two collaborating laboratories. The methods offer substantial independence, with two types of extractions, two separation methods, and four detection methods. Excellent agreement was obtained among the measurements, with data reproducibility for most methods and analytes better than 5% relative standard deviation. The bitter-orange-containing dietary supplement SRMs are intended primarily for use as measurement controls and for use in the development and validation of analytical methods.
Assuntos
Citrus/química , Suplementos Nutricionais/análise , Padrões de Referência , Alcaloides , Cafeína , Técnicas de Química Analítica/métodos , Citrus/normas , Reprodutibilidade dos TestesRESUMO
Developmental ethanol exposure is a well-known cause of lifelong cognitive deficits, behavioral hyperactivity, emotional dysregulation, and more. In healthy adults, sleep is thought to have a critical involvement in each of these processes. Our previous work has demonstrated that some aspects of cognitive impairment in adult mice exposed at postnatal day 7 (P7) to ethanol (EtOH) correlate with slow-wave sleep (SWS) fragmentation (Wilson et al., 2016). We and others have also previously demonstrated that co-treatment with LiCl on the day of EtOH exposure prevents many of the anatomical and physiological impairments observed in adults. Here we explored cognitive function, diurnal rhythms (activity, temperature), SWS, and parvalbumin (PV) and perineuronal net (PNN)-positive cell densities in adult mice that had received a single day of EtOH exposure on P7 and saline-treated littermate controls. Half of the animals also received a LiCl injection on P7. The results suggest that developmental EtOH resulted in adult behavioral hyperactivity, cognitive impairment, and reduced SWS compared to saline controls. Both of these effects were reduced by LiCl treatment on the day of EtOH exposure. Finally, developmental EtOH resulted in decreased PV/PNN-expressing cells in retrosplenial (RS) cortex and dorsal CA3 hippocampus at P90. As with sleep and behavioral activity, LiCl treatment reduced this decrease in PV expression. Together, these results further clarify the long-lasting effects of developmental EtOH on adult behavior, physiology, and anatomy. Furthermore, they demonstrate the neuroprotective effects of LiCl co-treatment on this wide range of developmental EtOH's long-lasting consequences.
Assuntos
Transtornos do Espectro Alcoólico Fetal/prevenção & controle , Cloreto de Lítio/farmacologia , Fármacos Neuroprotetores/farmacologia , Nootrópicos/farmacologia , Animais , Animais Recém-Nascidos , Córtex Cerebral/efeitos dos fármacos , Córtex Cerebral/crescimento & desenvolvimento , Córtex Cerebral/metabolismo , Córtex Cerebral/patologia , Cognição/efeitos dos fármacos , Disfunção Cognitiva/etiologia , Disfunção Cognitiva/metabolismo , Disfunção Cognitiva/patologia , Disfunção Cognitiva/prevenção & controle , Modelos Animais de Doenças , Feminino , Transtornos do Espectro Alcoólico Fetal/metabolismo , Transtornos do Espectro Alcoólico Fetal/patologia , Transtornos do Espectro Alcoólico Fetal/psicologia , Hipercinese/etiologia , Hipercinese/metabolismo , Hipercinese/patologia , Hipercinese/prevenção & controle , Masculino , Camundongos Endogâmicos C57BL , Parvalbuminas/metabolismo , Sono/efeitos dos fármacos , Privação do Sono/etiologia , Privação do Sono/metabolismo , Privação do Sono/patologia , Privação do Sono/prevenção & controleRESUMO
Mechanistic, clinical, and epidemiological research relevant to dietary supplements (DS) is supported by the U.S. National Institutes of Health. The Office of Dietary Supplements and the National Center for Complementary and Integrative Health promote the development and appropriate use of rigorous and comprehensive DS analyses which are critical for research reproducibility, particularly when the investigational DS include chemically complex natural products with unclear mechanisms of action.
Assuntos
Produtos Biológicos/análise , Suplementos Nutricionais/análise , National Institutes of Health (U.S.) , Humanos , Reprodutibilidade dos Testes , Projetos de Pesquisa , Estados UnidosRESUMO
Several tight-binding mutants of the lactose repressor protein have been characterized with respect to their fluorescence properties and their inducer, operator and nonspecific DNA-binding constants. The tryptophan fluorescence emission spectra for the mutants and the wild-type repressor are quite similar. However, alterations in the Stern-Volmer constants for iodide quenching of the tryptophans in the mutant proteins compared to wild-type suggest differences in the local environment or solvent accessibility for these amino acids in the tight-binding repressors. The inducer-binding affinities and association rate constants of the mutant proteins and protein-operator DNA fragment complexes are also altered compared to wild-type. The extents of these changes vary among the different mutant repressors. The nonspecific DNA-binding affinities of the mutant proteins are 2--3-fold greater than the wild-type repressor, and the affinities of the tight-binding proteins for a 29 base-pair operator DNA fragment are also increased, though to a varying extent depending upon the mutant. The phenotypic behavior of these proteins in vivo can be partially explained by these results obtained in vitro; however, it is likely that there are additional factors responsible for the tight-binding behavior of the proteins that were not detectable in these experiments.
Assuntos
Escherichia coli/genética , Proteínas Repressoras/metabolismo , Fatores de Transcrição/metabolismo , Alelos , DNA Bacteriano/metabolismo , Cinética , Mutação , Ligação Proteica , Proteínas Repressoras/genética , Especificidade da Espécie , Espectrometria de FluorescênciaRESUMO
Five tight-binding (Itb) mutants of the Escherichia coli lactose (lac) repressor have been characterized with regard to their non-specific affinity for DNA and their specific affinity for the wild-type operator and several sequence-altered (pseudo-) operators. Repressor-operator association rates were determined in the presence or absence of competitor DNA, dissociation rates of repressor from various DNA fragments were measured, and equilibrium competition for repressor binding was examined for several pseudo-operator DNAs. The mutant repressors exhibited increased non-specific affinity for DNA, and variable increases in affinity for sequence-altered operators. The known positions of amino acid substitutions for three of these Itb repressors support suggestions that residues 51 to 64 are important for operator recognition in addition to residues 1 to 50.
Assuntos
Escherichia coli/genética , Óperon Lac , Proteínas Repressoras/genética , Fatores de Transcrição/genética , Sequência de Aminoácidos , Sequência de Bases , DNA Bacteriano/metabolismo , Cinética , Mutação , Plasmídeos , Proteínas Repressoras/metabolismoRESUMO
Using both general recombination and molecular cloning techniques, 13I-, I-d and Itb missense mutations in the lacI gene were transferred from F'lacIq episomes to ColE1 derivative plasmids. Two deletion derivatives of the lacI genes encoding the wild-type (wt) and the tight-binding (Itb) B3 and B5 repressors were also constructed. The mutant repressors were examined for polypeptide size and stability, and for binding to the inducer isopropyl-beta-D-thiogalactoside (IPTG). Several of the I-d repressors were shown to be partially degraded in vivo, in confirmation of earlier results based on [14C]IPTG binding [Miwa and Sadler, J. Mol. Biol. 117 (1977) 843-868]. The sizes of polypeptides produced by lacI deletion derivatives were consistent with expectations based on the extent of deletion and the location of termination sites within the plasmid sequence. The first 400 bp of several mutant lacI genes were sequenced. Our wt lacI gene differs from another wt lacI sequence (Farabaugh, 1978), containing a single bp change that results in an Ala to Thr substitution at amino acid (aa) 109. We identified bp substitutions and the resultant aa changes for two Itb and two I-d genes; the positions correlated with prior genetic mapping data. Three of these new changes were in the N-terminal domain (headpiece) of repressor, with one change in the core domain at aa 99.
Assuntos
Proteínas Repressoras/genética , Fatores de Transcrição/genética , Sequência de Bases , Deleção Cromossômica , Clonagem Molecular , Genes Dominantes , Isopropiltiogalactosídeo/metabolismo , Peso Molecular , Mutação , Conformação Proteica , Desnaturação Proteica , Proteínas Repressoras/metabolismoRESUMO
The specific binding of dominant-negative (I-d) lactose (lac) repressors to wild-type (wt) as well as mutant (Oc) lac operators has been examined to explore the sequence-specific interaction of the lac repressor with its target. Mutant lacI genes encoding substitutions in the N-terminal 60 amino acids (aa) were cloned in a derivative of plasmid pBR322. Twelve of these lacI-d missense mutations were transferred from F'lac episomes using general genetic recombination and molecular cloning, and nine lacI missense mutations were recloned from M13-lacI phages [Mott et al., Nucl. Acids Res. 12 (1984) 4139-4152]. The mutant repressors were examined for polypeptide size and stability, for binding the inducer isopropyl-beta-D-thiogalactoside (IPTG), as well as binding to wt operator. The mutant repressors' affinities for wt operator ranged from undetectable to about 1% that of wt repressor, and the mutant repressors varied in transdominance against repressor expressed from a chromosomal lacIq gene. Six of the I-d repressors were partially degraded in vivo. All repressors bound IPTG with approximately the affinity of wt repressor. Repressors having significant affinity for wt operator or with substitutions in the presumed operator recognition helix (aa 17-25) were examined in vivo for their affinities for a series of single site Oc operators. Whereas the Gly-18-, Ser-18- and Leu-18-substituted repressors showed altered specificity for position 7 of the operator [Ebright, Proc. Natl. Acad. Sci. USA 83 (1986) 303-307], the His-18 repressor did not affect specificity. This result may be related to the greater side-chain length of histidine compared to the other amino acid substitutions.
Assuntos
Proteínas de Bactérias/genética , Genes Dominantes , Óperon Lac , Supressão Genética , Sequência de Aminoácidos , Bacteriófagos/genética , Sequência de Bases , Escherichia coli/genética , Vetores Genéticos , Dados de Sequência Molecular , PlasmídeosRESUMO
Starting with one strand of the 40-bp synthetic operator (Sadler et al., 1978), we have constructed and cloned a 66-bp, palindromic DNA segment with the following sequence (Formula: see text), where the horizontal arrows indicate the locations of the two 21-bp "core" operator sequences in this segment and the vertical arrow designates the dyad axis of symmetry. Upon denaturation and rapid renaturation, each strand of this fragment forms a hairpin molecule still retaining an EcoRI cohesive end. Two hairpin molecules can be joined with T4 DNA ligase to form a duplex DNA molecule having no ends (dumbbell form A). Denaturation and rapid renaturation of dumbbell A yields a mixture of two dumbbell forms: dumbbell A which is a substrate for Eco RI, and a new form, dumbbell B, which is not a substrate. Each of the conformations of this DNA fragment have been purified and all are active in binding lactose repressor in vitro.
Assuntos
Óperon Lac , Óperon , Sequência de Bases , Clonagem Molecular/métodos , DNA Bacteriano/síntese química , DNA Bacteriano/genética , DNA Recombinante/metabolismo , Escherichia coli/genética , Conformação de Ácido Nucleico , Plasmídeos , Proteínas Repressoras/metabolismoRESUMO
We have analyzed lac repressor binding in vivo and in vitro to several symmetric lac operator sequences. Two features of the operator appear to be important for repressor binding: sequence, both of the operator and of its extended regions, and the spacing of the operator halves. Host mutations that alter DNA superhelical density (topA, gyrB) did not change the relative affinity of cloned symmetric operator sequences for repressor. Analysis by dimethylsulfate methylation and DNaseI digestion of repressor-operator complexes indicated that repressor makes symmetric contacts with the symmetric operator, in contrast to its contacts with the two halves of the natural operator.
Assuntos
Escherichia coli/genética , Óperon Lac , Proteínas Repressoras/metabolismo , Fatores de Transcrição/metabolismo , Sequência de Bases , Sítios de Ligação , Clonagem Molecular , DNA Super-Helicoidal/genética , Dados de Sequência Molecular , MutaçãoRESUMO
Up to 12 tandem copies of the lactose operator sequence AATTCCACATGTGGAATTGTGAGCGGATAACAATTTGTGG (3') GGTGTACACCTTAACACTCGCCTATTGTTAAACACCTTAA (5') have been cloned in the EcoRI site of plasmid pMB9. A 12-operator plasmid is about 8% operator by weight and represents a rich source of this DNA segment. A procedure for the rapid and convenient isolation of operator in mg quantities is presented. The lifetimes of complexes formed between repressor and oligo-operator plasmids increased with increasing numbers of tandem operators per plasmid. Evidence is presented indicating that only one tetrameric repressor molecule binds strongly to a segment of four (or fewer) tandem operators, but that two repressor molecules can be accommodated on segments containing at least six tandem operators.
Assuntos
DNA Recombinante/análise , Óperon Lac , Plasmídeos , Sequência de Bases , Enzimas de Restrição do DNA/metabolismo , Eletroforese , Escherichia coli/genéticaRESUMO
A plasmid-borne Herpes simplex virus type 1 (HSV-1) thymidine kinase (TK) gene (tk) was expressed in Escherichia coli by inserting a 203-bp lacL8/UV5 promoter-operator segment, in frame, 53 bp 5' to the native tk translational start codon. The hybrid gene created by this fusion encodes a polypeptide which has 25 additional amino acids on the amino terminus of the HSV-1 TK protein and phenotypically complements a tdk- mutation of E. coli. This fusion polypeptide has been characterized by maxicell, immunoprecipitation, and native gel techniques, and its activity is inhibited by anti-HSV-1 antibody. In a tk expressor strain containing a F' lacIq (which overproduces the lactose repressor), the isopropyl-beta-D-thiogalactoside (IPTG) causes greater than 1000-fold coordinate induction of the plasmid-encoded TK and chromosomal beta-galactosidase activities. Pulse-chase induction demonstrates the fused TK polypeptide to be as stable as beta-galactosidase. HSV-1 tk-specific RNA isolated from this bacterial strain has a short half-life characteristic of bacterial messages.
Assuntos
Escherichia coli/metabolismo , Regulação da Expressão Gênica , Simplexvirus/genética , Timidina Quinase/biossíntese , Proteínas Virais/biossíntese , Clonagem Molecular , Escherichia coli/genética , RNA Bacteriano/metabolismo , RNA Mensageiro/metabolismo , Simplexvirus/enzimologia , Timidina Quinase/genética , Proteínas Virais/genéticaRESUMO
16 single-site mutations and a 1-bp deletion in the lac operator have been cloned and examined with regard to repressor binding. A 13-bp, central 'core' operator sequence, bp 5-17 of the natural operator, was also synthesized and cloned. Repressor affinity was assessed in vivo by quantitating the level of beta-galactosidase activity resulting from chromosomal operon derepression and in vitro by measuring the stability of repressor-operator complexes. Our results support the general conclusion that the repressor-operator interaction is asymmetric, particularly across the center of the operator sequence, with little or no specific contact at position 12. Some sequence changes in the right side of the operator markedly reduced repressor affinity, indicating that although binding to this half of the sequence has been suggested to be less important than the left half, it still significantly contributes to the binding affinity.
Assuntos
Óperon Lac , Regiões Operadoras Genéticas , Proteínas Repressoras/metabolismo , Fatores de Transcrição/metabolismo , Clonagem Molecular , DNA Bacteriano/metabolismo , Proteínas de Ligação a DNA/metabolismo , Escherichia coli/genética , Técnicas In Vitro , Metilação , Mutação , Conformação de Ácido Nucleico , Relação Estrutura-AtividadeRESUMO
A 40 base, mainly duplex DNA segment, with the following sequence pAATTCCACATGTGGAATTGTGAGCGGATAACAATTTGTT (3') GGTGTACACCTTAACACTCGCCTATTGTTAAACACCTTAAp (5') has been synthesized by combination of chemical and enzymatic methods. It consists of a wild-type lactose operator sequence (boxed) bracketed by "linker" sequences which permit excision of the segment from plasmid vehicles by the EcoRI restriction endonuclease. This segment has been ligated into the pMB9 plasmid and the resulting operator plasmids used to transform E. coli K-12. Among the transformant products were strains carrying plasmids with one, two, three, or four operator segments in tandem. Derepression of the lactose operon effected by these plasmids in vivo as well as the lifetimes of complexes formed between repressor and these plasmids in vitro increase with increasing numbers of operators per plasmid.
Assuntos
DNA Bacteriano/síntese química , DNA Recombinante , Óperon Lac , Sequência de Bases , Escherichia coli/genética , Plasmídeos , Proteínas Repressoras , Transformação BacterianaRESUMO
Recombinant DNA molecules, constructed from the ColE1-Mk5 hybrid plasmid PMB9 and a chemically synthesized wild-type lactose operator segment, have been used to transform Escherichia coli. Up to 10% of the transformants (selected for the tetracycline-resistance property of PMB9) are partially constitutive for the lactose operon enzyme beta-galactosidase. In vitro studies demonstrate that these partially constitutive transformants contain plasmid DNA molecules which carry one or more lactose operators, and which will bind purified lactose repressor. Preliminary results with some modified operator sequences are also presented.
Assuntos
DNA Recombinante , DNA/síntese química , Lactose/genética , Óperon , Colífagos/genética , DNA Viral , Escherichia coli/genética , Transformação GenéticaRESUMO
We report on a solid and cystic papillary epithelial neoplasm of the pancreas containing the unbalanced chromosome translocation der(17)t(13;17)(q14;p11), resulting in loss of 13q14-->qter and 17p11-->pter. Although the clinical and pathologic characteristics of this case are largely typical of this uncommon pancreatic neoplasm, the presence of cellular pleomorphism, tumor giant cells, and a DNA tetraploid tumor population suggest that this tumor may have an increased metastatic potential. The unbalanced translocation between chromosomes 13 and 17 and the genes flanking the breakpoints may prove to be markers for solid and cystic papillary epithelial neoplasm of the pancreas and provide insight into its histogenesis.