RESUMO
Morocco is considered as an important producer of fish with more than one million tons of small pelagic fish caught per year, along more than 3400 km of coastline. Otherwise, few studies have investigated the zoonotic parasites of fish. The purpose of this study is to determine the prevalence of Anisakis nematodes larvae in two fish species, namely sardines Sardina pilchardus and mackerel Scomber scombrus. These two species are widely consumed in Marrakesh due to their availability and their affordable prices. A total of 948 fish, including 546 sardines and 402 mackerel, were purchased from the wholesale market of Marrakesh, from January 2016 to December 2018. Sampling was performed on the days of fish arrival from the fishing areas (Dakhla, Essaouira, Safi and Sidi Ifni). The samples were examined visually for the presence of Anisakis larvae. We obtained a prevalence of 8.4% in mackerel with different rates depending on their origins (Safi: 13.23%; Essaouira: 11.66%; Sidi Ifni: 2.5%; Dakhla: 0%) and the seasons. However, no larvae were detected in the sardines after meticulous visual inspection. The detected larvae were morphologically and genetically identified. We identified the larvae by the PCR-RFLP technique using the primers LSU5-F (TAGGTCGACCCGCTGAAYTTAAGCA) and IR16-R (ATTCACACCCATTGACTCGCG) from the 28S rDNA region. The analysis showed that all larvae belong to Anisakis simplex sensu-stricto (s.s.). According to our results mackerel presents a higher risk of contamination than sardine, while statistical studies show that there is no impact of season and fishing origin on the prevalence.
Assuntos
Anisakis/isolamento & purificação , Larva , Perciformes/parasitologia , Animais , Peixes/parasitologia , Marrocos , Alimentos Marinhos/parasitologia , Estações do AnoRESUMO
The association between the parasitic illnesses and the consumption of contaminated water has been largely reported. However, there is still a lack of studies investigating the extent of parasitic contamination in water in Morocco. This is the first study in Morocco that aimed at assessing the presence of protozoan parasites, namely Cryptosporidium spp., Giardia duodenalis, and Toxoplasma gondii, in drinking water consumed in the region of Marrakech. Samples processing was performed by membrane filtration and qPCR detection. A total of 104 drinking water samples (tap water, well, and spring waters) was collected between 2016 and 2020. The analysis revealed an overall protozoa contamination rate of 67.3% (70/104), of which 35 samples were positive for Giardia duodenalis, 18 for Toxoplasma gondii, and 17 for both parasites, whereas no sample was positive for Cryptosporidium spp. This first study showed that drinking water in the region of Marrakech contained parasites which could represent a risk for consumers. For a better understanding and estimation of the risk encountered by local inhabitants, further studies concerned with (oo)cyst viability, infectivity, and genotype identification need to be performed.