RESUMO
Caenorhabditis elegans serves as a model for understanding adiposity and its connections to aging. Current methodologies do not distinguish between fats serving the energy needs of the parent, akin to mammalian adiposity, from those that are distributed to the progeny, making it difficult to accurately interpret the physiological implications of fat content changes induced by external perturbations. Using spectroscopic coherent Raman imaging, we determine the protein content, chemical profiles and dynamics of lipid particles in live animals. We find fat particles in the adult intestine to be diverse, with most destined for the developing progeny. In contrast, the skin-like epidermis contains fats that are the least heterogeneous, the least dynamic and have high triglyceride content. These attributes are most consistent with stored somatic energy reservoirs. These results challenge the prevailing practice of assessing C. elegans adiposity by measurements that are dominated by the intestinal fat content.
Assuntos
Caenorhabditis elegans/fisiologia , Lipídeos/química , Análise Espectral Raman/métodos , Animais , Metabolismo dos Lipídeos/fisiologiaRESUMO
Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K+-induced conformational transition from an initial hairpin structure to the final G4(II) structure. Moreover, a single-base C-to-T mutation at either position C4 or C7 of WT22m could lock the intermediate G4(I) structure without further conformational change to the final G4(II) structure. Surprisingly, we found that the intermediate G4(I) structure is an atypical G4 structure, which differs from a typical hybrid G4 structure of the final G4(II) structure. Further studies of modified cytosine analogues associated with epigenetic regulation indicated that slight modification on a cytosine could modulate G4 structure. A simplified four-state transition model was introduced to describe such conformational transition and disclose the possible mechanism for G4 structural selection caused by cytosine modification.
Assuntos
Citosina/química , Quadruplex G , Regiões Promotoras Genéticas , Proteína Wnt1/genética , Citosina/metabolismo , Metilação de DNA , Epigênese Genética , Ressonância Magnética Nuclear BiomolecularRESUMO
Time-gated fluorescence lifetime imaging microscopy with the o-BMVC fluorescent probe provides a visualizing method for the study of exogenous G-quadruplexes (G4s) in live cancer cells. Previously, imaging results showed that the parallel G4s are accumulated and that nonparallel G4s are not detected in the lysosomes of CL1-0 live cells. In this work, the detection of the G4 signals from exogenous GTERT-d(FN) G4s in the lysosomes may involve a structural change in live cells from intramolecular nonparallel G4s to intermolecular parallel G4s. Moreover, the detection of the G4 signals in the lysosomes after the 48 h incubation of HT23 G4s with CL1-0 live cells indicates the occurrence of structural conversion from the nonparallel G4s to the parallel G4s of HT23 in the live cells. In addition, the detection of much stronger G4 signals from ss-GTERT-d(FN) than ss-HT23 in the lysosomes of CL1-0 live cells may be explained by the quick formation of the intermolecular parallel G4s of ss-GTERT-d(FN) and the degradation of ss-HT23 before its intramolecular parallel G4 formation. This work provides a new approach to studying G4-lysosome interactions in live cells.
Assuntos
Quadruplex G , Neoplasias , Microscopia , Corantes Fluorescentes/química , LisossomosRESUMO
Ligands that bind to and stabilize guanine-quadruplex (G4) structures to regulate DNA replication have therapeutic potential for cancer and neurodegenerative diseases. Because there are several G4 topologies, ligands that bind to their specific types may have the ability to preferentially regulate the replication of only certain genes. Here, we demonstrated that binding ligands stalled the replication of template DNA at G4, depending on different topologies. For example, naphthalene diimide derivatives bound to the G-quartet of G4 with an additional interaction between the ligand and the loop region of a hybrid G4 type from human telomeres, which efficiently repressed the replication of the G4. Thus, these inhibitory effects were not only stability-dependent but also topology-selective based on the manner in which G4 structures interacted with G4 ligands. Our original method, referred to as a quantitative study of topology-dependent replication (QSTR), was developed to evaluate correlations between replication rate and G4 stability. QSTR enabled the systematic categorization of ligands based on topology-dependent binding. It also demonstrated accuracy in determining quantitatively how G4 ligands control the intermediate state of replication and the kinetics of G4 unwinding. Hence, the QSTR index would facilitate the design of new drugs capable of controlling the topology-dependent regulation of gene expression.
Assuntos
Quadruplex GRESUMO
BMVC is the first fluorescent probe designed to detect G-quadruplexes (G4s) in vivo. The MYC oncogene promoter forms a G4 (MycG4) which acts as a transcription silencer. Here, we report the high-affinity and specific binding of BMVC to MycG4 with unusual slow-exchange rates on the NMR timescale. We also show that BMVC represses MYC in cancer cells. We determined the solution structures of the 1:1 and 2:1 BMVC-MycG4 complexes. BMVC first binds the 5'-end of MycG4 to form a 1:1 complex with a well-defined structure. At higher ratio, BMVC also binds the 3'-end to form a second complex. In both complexes, the crescent-shaped BMVC recruits a flanking DNA residue to form a BMVC-base plane stacking over the external G-tetrad. Remarkably, BMVC adjusts its conformation to a contracted form to match the G-tetrad for an optimal stacking interaction. This is the first structural example showing the importance of ligand conformational adjustment in G4 recognition. BMVC binds the more accessible 5'-end with higher affinity, whereas sequence specificity is present at the weaker-binding 3'-site. Our structures provide insights into specific recognition of MycG4 by BMVC and useful information for design of G4-targeted anticancer drugs and fluorescent probes.
Assuntos
Carbazóis/química , Carbazóis/farmacocinética , Quadruplex G/efeitos dos fármacos , Regiões Promotoras Genéticas , Proteínas Proto-Oncogênicas c-myc/genética , Compostos de Piridínio/química , Compostos de Piridínio/farmacocinética , Sítios de Ligação/efeitos dos fármacos , Dicroísmo Circular , DNA/química , DNA/efeitos dos fármacos , DNA/metabolismo , Corantes Fluorescentes/química , Corantes Fluorescentes/farmacocinética , Humanos , Ligantes , Espectroscopia de Ressonância Magnética , Modelos Moleculares , Conformação de Ácido Nucleico/efeitos dos fármacos , Regiões Promotoras Genéticas/efeitos dos fármacos , Proteínas Proto-Oncogênicas c-myc/química , Proteínas Proto-Oncogênicas c-myc/efeitos dos fármacos , Especificidade por SubstratoRESUMO
Guanine-rich oligonucleotides (GROs) can self-associate to form G-quadruplex (G4) structures that have been extensively studied in vitro. To translate the G4 study from in vitro to in live cells, here fluorescence lifetime imaging microscopy (FLIM) of an o-BMVC fluorescent probe is applied to detect G4 structures and to study G4 dynamics in CL1-0 live cells. FLIM images of exogenous GROs show that the exogenous parallel G4 structures that are characterized by the o-BMVC decay times (≥2.4 ns) are detected in the lysosomes of live cells in large quantities, but the exogenous nonparallel G4 structures are hardly detected in the cytoplasm of live cells. In addition, similar results are also observed for the incubation of their single-stranded GROs. In the study of G4 formation by ssHT23 and hairpin WT22, the analyzed binary image can be used to detect very small increases in the number of o-BMVC foci (decay time ≥ 2.4 ns) in the cytoplasm of live cells. However, exogenous ssCMA can form parallel G4 structures that are able to be detected in the lysosomes of live CL1-0 cells in large quantities. Moreover, the photon counts of the o-BMVC signals (decay time ≥ 2.4 ns) that are measured in the FLIM images are used to reveal the transition of the G4 formation of ssCMA and to estimate the unfolding rate of CMA G4s with the addition of anti-CMA into live cells for the first time. Hence, FLIM images of o-BMVC fluorescence hold great promise for the study of G4 dynamics in live cells.
Assuntos
Quadruplex G , Oligonucleotídeos/química , Carbazóis/química , Linhagem Celular Tumoral , Corantes Fluorescentes/química , Humanos , Lisossomos/metabolismo , Microscopia de Fluorescência/métodos , Oligonucleotídeos/metabolismo , Compostos de Piridínio/químicaRESUMO
Fungal infections, particularly Candida species, have increased worldwide and caused high morbidity and mortality rates. The toxicity and development of resistance in present antifungal drugs justify the need of new drugs with different mechanism of action. BMVC-12C-P, a carbazole-type compound, has been found to dysfunction mitochondria. BMVC-12C-P displayed the strongest antifungal activities among all of the BMVC derivatives. The minimal inhibitory concentration (MIC) of BMVC-12C-P against Candida species ranged from 1 to 2 µg/ml. Fluconazole-resistant clinical isolates of Candida species were highly susceptible to BMVC-12C-P. The potent fungicidal activity of BMVC-12C-P relates to its impairing mitochondrial function. Furthermore, we found that the hyphae growth and biofilm formation were suppressed in C. albicans survived from BMVC-12C-P treatment. This study demonstrates the potential of BMVC-12C-P as an antifungal agent for treating Candida infections.
Assuntos
Antifúngicos/farmacologia , Candida/efeitos dos fármacos , Carbazóis/química , Carbazóis/farmacologia , Farmacorresistência Fúngica , Compostos de Piridínio/química , Compostos de Piridínio/farmacologia , Antifúngicos/química , Biofilmes/efeitos dos fármacos , Biofilmes/crescimento & desenvolvimento , Candida/classificação , Fluconazol/farmacologia , Hifas/efeitos dos fármacos , Testes de Sensibilidade Microbiana , Mitocôndrias/efeitos dos fármacos , Mitocôndrias/patologiaRESUMO
Identification of the existence of G-quadruplex (G4) structure, from a specific G-rich sequence in cells, is critical to the studies of structural biology and drug development. Accumulating evidence supports the existence of G4 structure in vivo. Particularly, time-gated fluorescence lifetime imaging microscopy (FLIM) of a G4 fluorescent probe, 3,6-bis(1-methyl-2-vinylpyridinium) carbazole diiodide (o-BMVC), was used to quantitatively measure the number of G4 foci, not only in different cell lines, but also in tissue biopsy. Here, circular dichroism spectra and polyacrylamide gel electrophoresis assays show that the use of antisense oligonucleotides unfolds their G4 structures in different percentages. Using antisense oligonucleotides, quantitative measurement of the number of o-BMVC foci in time-gated FLIM images provides a method for identifying which G4 motifs form G4 structures in fixed cells. Here, the decrease of the o-BMVC foci number, upon the pretreatment of antisense sequences, (CCCTAA)3CCCTA, in fixed cells and at the end of metaphase chromosomes, allows us to identify the formation of telomeric G4 structures from TTAGGG repeats in fixed cells.
Assuntos
Quadruplex G , Hibridização in Situ Fluorescente/métodos , Metáfase/genética , Oligonucleotídeos Antissenso , Telômero , Carbazóis , Corantes Fluorescentes , Células HeLa , Humanos , Microscopia de Fluorescência , Estrutura Molecular , Conformação de Ácido Nucleico , Oligonucleotídeos Antissenso/química , Compostos de Piridínio , Telômero/químicaRESUMO
G-quadruplexes (G4) are considered new drug targets for human diseases such as cancer. More than 10,000 G4s have been discovered in human chromatin, posing challenges for assessing the selectivity of a G4-interactive ligand. 3,6-bis(1-Methyl-4-vinylpyridinium) carbazole diiodide (BMVC) is the first fluorescent small molecule for G4 detection in vivo. Our previous structural study shows that BMVC binds to the MYC promoter G4 (MycG4) with high specificity. Here, we utilize high-throughput, large-scale custom DNA G4 microarrays to analyze the G4-binding selectivity of BMVC. BMVC preferentially binds to the parallel MycG4 and selectively recognizes flanking sequences of parallel G4s, especially the 3'-flanking thymine. Importantly, the microarray results are confirmed by orthogonal NMR and fluorescence binding analyses. Our study demonstrates the potential of custom G4 microarrays as a platform to broadly and unbiasedly assess the binding selectivity of G4-interactive ligands, and to help understand the properties that govern molecular recognition.
Assuntos
Carbazóis/metabolismo , Corantes Fluorescentes/metabolismo , Quadruplex G , Proteínas Proto-Oncogênicas c-myc/genética , Compostos de Piridínio/metabolismo , Carbazóis/química , Fluorescência , Corantes Fluorescentes/química , Humanos , Ligantes , Análise em Microsséries , Regiões Promotoras Genéticas , Proteínas Proto-Oncogênicas c-myc/metabolismo , Compostos de Piridínio/químicaRESUMO
A G-rich sequence containing three loops to connect four G-tracts with each ≥2 guanines can possibly form G-quadruplex structures. Given that all G-quadruplex structures comprise the stacking of G-quartets, the loop sequence plays a major role on their folding topology and thermal stability. Here circular dichroism, NMR, and PAGE are used to study the effect of loop length and base composition in the middle loop, and a single base difference in loop 1 and 3 on G-quadruplex formation of (G3HG3NmG3HG3) sequences with and without flanking nucleotides, where H is T, A, or C and N is T, A, C, or G. In addition, melting curve for G-quadruplex unfolding was used to provide relatively thermal stability of G-quadruplex structure after the addition of K+ overnight. We further studied the effects of K+ concentration on their stability and found structural changes in several sequences. Such (G3HG3NmG3HG3) configuration can be found in a number of native DNA sequences. The study of structural diversity and similarity from these sequences may allow us to establish the correlation between model sequences and native sequences. Moreover, several sequences upon interaction with a G-quadruplex ligand, BMVC, show similar spectral change, implying that structural similarity is crucial for drug development.
Assuntos
DNA/química , Modelos Moleculares , Nucleotídeos/química , Sequência de Bases , Dicroísmo Circular , Eletroforese em Gel de Poliacrilamida , Quadruplex G , Ligantes , Espectroscopia de Ressonância Magnética , Conformação de Ácido Nucleico , Potássio/químicaRESUMO
DNA secondary structures and methylation are two well-known mechanisms that regulate gene expression. The catalytic subunit of telomerase, human telomerase reverse transcriptase (hTERT), is overexpressed in â¼90% of human cancers to maintain telomere length for cell immortalization. Binding of CCCTC-binding factor (CTCF) to the first exon of the hTERT gene can down-regulate its expression. However, DNA methylation in the first exon can prevent CTCF binding in most cancers, but the molecular mechanism is unknown. The NMR analysis showed that a stretch of guanine-rich sequence in the first exon of hTERT and located within the CTCF-binding region can form two secondary structures, a hairpin and a quadruplex. A key finding was that the methylation of cytosine at the specific CpG dinucleotides will participate in quartet formation, causing the shift of the equilibrium from the hairpin structure to the quadruplex structure. Of further importance was the finding that the quadruplex formation disrupts CTCF protein binding, which results in an increase in hTERT gene expression. Our results not only identify quadruplex formation in the first exon promoted by CpG dinucleotide methylation as a regulator of hTERT expression but also provide a possible mechanistic insight into the regulation of gene expression via secondary DNA structures.
Assuntos
Telomerase/genética , Sequência de Bases , Sítios de Ligação/genética , Fator de Ligação a CCCTC/metabolismo , Linhagem Celular , Ilhas de CpG , DNA/química , DNA/genética , Metilação de DNA , Éxons , Quadruplex G , Expressão Gênica , Humanos , Sequências Repetidas Invertidas , Cinética , Mutagênese , Ressonância Magnética Nuclear Biomolecular , Conformação de Ácido Nucleico , Regiões Promotoras Genéticas , TermodinâmicaRESUMO
The folding topology of DNA G-quadruplexes (G4s) depends not only on their nucleotide sequences but also on environmental factors and/or ligand binding. Here, a G4 ligand, 3,6-bis(1-methyl-4-vinylpyridium iodide)-9-(1-(1-methyl-piperidinium iodide)-3,6,9-trioxaundecane) carbazole (BMVC-8C3O), can induce topological conversion of non-parallel to parallel forms in human telomeric DNA G4s. Nuclear magnetic resonance (NMR) spectroscopy with hydrogen-deuterium exchange (HDX) reveals the presence of persistent imino proton signals corresponding to the central G-quartet during topological conversion of Tel23 and Tel25 G4s from hybrid to parallel forms, implying that the transition pathway mainly involves local rearrangements. In contrast, rapid HDX was observed during the transition of 22-CTA G4 from an anti-parallel form to a parallel form, resulting in complete disappearance of all the imino proton signals, suggesting the involvement of substantial unfolding events associated with the topological transition. Site-specific imino proton NMR assignments of Tel23 G4 enable determination of the interconversion rates of individual guanine bases and detection of the presence of intermediate states. Since the rate of ligand binding is much higher than the rate of ligand-induced topological conversion, a three-state kinetic model was evoked to establish the associated energy diagram for the topological conversion of Tel23 G4 induced by BMVC-8C3O.
Assuntos
Quadruplex G , Telômero/química , Acetonitrilas/química , Carbazóis/química , DNA/química , Humanos , Cinética , Ligantes , Ressonância Magnética Nuclear BiomolecularRESUMO
The differential transcriptional expression of CLIC4 between tumor cells and the surrounding stroma during cancer progression has been suggested to have a tumor-promoting effect. However, little is known about the transcriptional regulation of CLIC4. To better understand how this gene is regulated, the promoter region of CLIC4 was analyzed. We found that a high GC content near the transcriptional start site (TSS) might form an alternative G-quadruplex (G4) structure. Nuclear magnetic resonance spectroscopy (NMR) confirmed their formation in vitro. The reporter assay showed that one of the G4 structures exerted a regulatory role in gene transcription. When the G4-forming sequence was mutated to disrupt the G4 structure, the transcription activity dropped. To examine whether this G4 structure actually has an influence on gene transcription in the chromosome, we utilized the CRISPR/Cas9 system to edit the G4-forming sequence within the CLIC4 promoter in the cell genome. The pop-in/pop-out strategy was adopted to isolate the precisely-edited A375 cell clone. In CRISPR-modified A375 cell clones whose G4 was disrupted, there was a decrease in the endogenous CLIC4 messenger RNA (mRNA) expression level. In conclusion, we found that the G4 structure in the CLIC4 promoter might play an important role in regulating the level of transcription.
Assuntos
Canais de Cloreto/química , Canais de Cloreto/genética , Regulação para Baixo , Regiões Promotoras Genéticas , Linhagem Celular Tumoral , Regulação Neoplásica da Expressão Gênica , Humanos , Modelos Moleculares , Mutação , Ressonância Magnética Nuclear Biomolecular , Conformação de Ácido NucleicoRESUMO
G-quadruplex (G4) structures have recently received increasing attention as a potential target for cancer research. We used time-gated fluorescence lifetime imaging microscopy (FLIM) with a G4 fluorescent probe, 3,6-bis(1-methyl-2-vinylpyridinium) carbazole diiodide (o-BMVC), to measure the number of o-BMVC foci, which may represent G4 foci, in cells as a common signature to distinguish cancer cells from normal cells. Here, the decrease in the number of o-BMVC foci in the pretreatment of cancer cells with TMPyP4, BRACO-19 and BMVC4 suggested that they directly bind to G4s in cells. In contrast, the increase in the number of o-BMVC foci in the pretreatment of cells with PDS and Hoechst 33258 (H33258) suggested that they do not inhabit the binding site of o-BMVC to G4s in cells. After the H33258 was removed, the gradual decrease of H33258-induced G4 foci may be due to DNA repair. The purpose of this work is to introduce o-BMVC foci as an indicator not only to verify the direct binding of potential G4 ligands to G4 structures but also to examine the possible effect of some DNA binding ligands on DNA integrity by monitoring the number of G4 foci in cells.
Assuntos
Carbazóis/química , DNA/química , Corantes Fluorescentes/química , Quadruplex G , Microscopia de Fluorescência , Compostos de Piridínio/química , Dicroísmo Circular , DNA/metabolismo , Corantes Fluorescentes/metabolismo , Humanos , LigantesRESUMO
G-quadruplex (G4) is a promising target for anti-cancer treatment. In this paper, we provide the first evidence supporting the presence of G4 in the mitochondrial DNA (mtDNA) of live cells. The molecular engineering of a fluorescent G4 ligand, 3,6-bis(1-methyl-4-vinylpyridinium) carbazole diiodide (BMVC), can change its major cellular localization from the nucleus to the mitochondria in cancer cells, while remaining primarily in the cytoplasm of normal cells. A number of BMVC derivatives with sufficient mitochondrial uptake can induce cancer cell death without damaging normal cells. Fluorescence studies of these anti-cancer agents in live cells and in isolated mitochondria from HeLa cells have demonstrated that their major target is mtDNA. In this study, we use fluorescence lifetime imaging microscopy to verify the existence of mtDNA G4s in live cells. Bioactivity studies indicate that interactions between these anti-cancer agents and mtDNA G4 can suppress mitochondrial gene expression. This work underlines the importance of fluorescence in the monitoring of drug-target interactions in cells and illustrates the emerging development of drugs in which mtDNA G4 is the primary target.
Assuntos
Antineoplásicos/química , Carbazóis/química , DNA Mitocondrial/química , Corantes Fluorescentes/química , Quadruplex G , Compostos de Piridínio/química , Animais , Antineoplásicos/toxicidade , Carbazóis/toxicidade , Linhagem Celular , Células HeLa , Humanos , Camundongos Endogâmicos BALB C , Microscopia de Fluorescência , Compostos de Piridínio/toxicidadeRESUMO
Understanding the mechanism of Na(+)/K(+)-dependent spectral conversion of human telomeric G-quadruplex (G4) sequences has been limited not only because of the structural polymorphism but also the lack of sufficient structural information at different stages along the conversion process for one given oligonucleotide. In this work, we have determined the topology of the Na(+) form of Tel23 G4, which is the same hybrid form as the K(+) form of Tel23 G4 despite the distinct spectral patterns in their respective nuclear magnetic resonance (NMR) and circular dichroism spectra. The spectral difference, particularly the well-resolved imino proton NMR signals, allows us to monitor the structural conversion from Na(+) form to K(+) form during Na(+)/K(+) exchange. Time-resolved NMR experiments of hydrogen-deuterium exchange and hybridization clearly exclude involvement of the global unfolding for the fast Na(+)/K(+) spectral conversion. In addition, the K(+) titration monitored by NMR reveals that the Na(+)/K(+) exchange in Tel23 G4 is a two-step process. The addition of K(+) significantly stabilizes the unfolding kinetics of Tel23 G4. These results offer a possible explanation of rapid spectral conversion of Na(+)/K(+) exchange and insight into the mechanism of Na(+)/K(+) structural conversion in human telomeric G4s.
Assuntos
DNA/química , Quadruplex G , Potássio/química , Sódio/química , Telômero/química , Dicroísmo Circular , Humanos , Ressonância Magnética Nuclear BiomolecularRESUMO
WNT1 encodes a multifunctional signaling glycoprotein that is highly expressed in several malignant tumors. Patients with Wnt1-positive cancer are usually related to advanced metastasis. Here, we found that a stretch of G-rich sequences located at the WNT1 promoter region is capable of forming G-quadruplex structures. The addition of G-quadruplex structure stabilizers, BMVC and BMVC4, raises the melting temperature of the oligonucleotide formed by the WNT1 promoter G-rich sequences. Significantly, the expression of WNT1 was repressed by BMVC or BMVC4 in a G-quadruplex-dependent manner, suggesting that they can be used to modulate WNT1 expression. The role of G-quadruplex stabilizers on Wnt1-mediated cancer migration and invasion was further analyzed. The protein levels of ß-catenin, a mediator of the Wnt-mediated signaling pathway, and the downstream targets MMP7 and survivin were down-regulated upon BMVC or BMVC4 treatments. Moreover, the migration and invasion activities of cancer cells were inhibited by BMVC and BMVC4, and the inhibitory effects can be reversed by WNT1-overexpression. Thus the Wnt1 expression and its downstream signaling pathways can be regulated through the G-quadruplex sequences located at its promoter region. These findings provide a novel approach for future drug development to inhibit migration and invasion of cancer cells.
Assuntos
Carbazóis/farmacologia , Movimento Celular/efeitos dos fármacos , Quadruplex G/efeitos dos fármacos , Pirazinas/farmacologia , Compostos de Piridínio/farmacologia , Proteína Wnt1/genética , Linhagem Celular Tumoral , Regulação Neoplásica da Expressão Gênica/efeitos dos fármacos , Humanos , Immunoblotting , Proteínas Inibidoras de Apoptose/genética , Metaloproteinase 7 da Matriz/genética , Invasividade Neoplásica , Oligonucleotídeos/química , Oligonucleotídeos/genética , Regiões Promotoras Genéticas/genética , Reação em Cadeia da Polimerase Via Transcriptase Reversa , Transdução de Sinais/efeitos dos fármacos , Transdução de Sinais/genética , Survivina , beta Catenina/metabolismoRESUMO
The role of G-quadruplexes (G4s) in biological systems has been widely studied. It is found that they have an important function in gene transcription and regulation. In this work, we have identified two topologies of hairpin and G4 structures formed by a native G-rich sequence (WT22: 5'-GGGCCACCGGGCAGGGGGCGGG-3') from the WNT1 promoter region using nuclear magnetic resonance (NMR) spectroscopy. With the help of site-specific isotope labeling, the topologies of these two structures are unambiguously characterized. Circular dichroism and NMR results are analyzed to determine the kinetics associated with the potassium ion-induced hairpin-to-G4 transition, which is very slow-on the time scale of 4800 s-compared to the previously reported folding kinetics of G4 formation. In addition, the free energies of the unfolding of these two structures are obtained using differential scanning calorimetry. Combining the kinetic and thermodynamic data, we have established the free energy landscape of this two-state folding system. Considering that similar conformational change may exist in other native G-rich sequences, this work highlights an important hairpin to G4 conformational transition which can be used in manipulation of gene regulation or ligand modulation in vivo.
Assuntos
Quadruplex G , Regiões Promotoras Genéticas/genética , Proteína Wnt1/genética , Ressonância Magnética Nuclear Biomolecular , Conformação de Ácido NucleicoRESUMO
Guanine-rich oligonucleotides (GROs) are promising therapeutic candidate for cancer treatment and other biomedical application. We have introduced a G-quadruplex (G4) ligand, 3,6-bis(1-methyl-4-vinylpyridinium) carbazole diiodide, to monitor the cellular uptake of naked GROs and map their intracellular localizations in living cells by using confocal microscopy. The GROs that form parallel G4 structures, such as PU22, T40214 and AS1411, are detected mainly in the lysosome of CL1-0 lung cancer cells after incubation for 2 h. On the contrary, the GROs that form non-parallel G4 structures, such as human telomeres (HT23) and thrombin binding aptamer (TBA), are rarely detected in the lysosome, but found mainly in the mitochondria. Moreover, the fluorescence resonant energy transfer studies of fluorophore-labeled GROs show that the parallel G4 structures can be retained in CL1-0 cells, whereas the non-parallel G4 structures are likely distorted in CL1-0 cells after cellular uptake. Of interest is that the distorted G4 structure of HT23 from the non-parallel G4 structure can reform to a probable parallel G4 structure induced by a G4 ligand in CL1-0 living cells. These findings are valuable to the design and rationale behind the possible targeted drug delivery to specific cellular organelles using GROs.
Assuntos
Quadruplex G , Oligodesoxirribonucleotídeos/química , Carbazóis/química , Linhagem Celular Tumoral , DNA/química , Transferência Ressonante de Energia de Fluorescência , Corantes Fluorescentes , Guanina/química , Humanos , Ligantes , Microscopia Confocal , Imagem Óptica , Compostos de Piridínio/químicaRESUMO
We reported that non-targeting siRNA (NT-siRNA) stress induces non-selenocysteine containing phospholipid hydroperoxide glutathione peroxidase (NPGPx) expression to cooperate with exoribonuclease XRN2 for releasing the stress [Wei,P.C., Lo,W.T., Su,M.I., Shew,J.Y. and Lee,W.H. (2011) Non-targeting siRNA induces NPGPx expression to cooperate with exoribonuclease XRN2 for releasing the stress. Nucleic Acids Res., 40, 323-332]. However, how NT-siRNA stress inducing NPGPx expression remains elusive. In this communication, we showed that the proximal promoter of NPGPx contained a mixed G-quadruplex (G4) structure, and disrupting the structure diminished NT-siRNA induced NPGPx promoter activity. We also demonstrated that nucleolin (NCL) specifically bonded to the G4-containing sequences to replace the originally bound Sp1 at the NPGPx promoter on NT-siRNA stress. Consistently, overexpression of NCL further increased NPGPx promoter activity, whereas depletion of NCL desensitized NPGPx promoter to NT-siRNA stress. These results suggest that the cis-element with mixed G4 structure at the NPGPx promoter plays an essential role for its transactivation mediated by NCL to release cells from NT-siRNA stress.