RAE1 promotes gastric carcinogenesis and epithelial-mesenchymal transition.

AIMS: The purpose of this study was to explore the role of RAE1 in the invasion and metastasis of gastric cancer (GC) cells. MATERIALS AND METHODS: RAE1 expression in GC cells was determined by reverse-transcription polymerase chain reaction (qRT-PCR) and Western blotting (WB). Cell models featuring RAE1 gene silencing and overexpression were constructed by lentiviral transfection; The proliferation, migration, and invasion ability of cells were detected by cell counting, colony formation assay, would healing assay, and transwell invasion and migration test. WB analysis of ERK/MAPK signaling pathway (ERK1/2, p-ERK1/2, c-Myc) and EMT-related molecules (ZEB1, E-cadherin, N-cadherin, and Vimentin). RESULTS: The expression level of RAE1 in GC was notably higher than in adjacent tissues. Elevated RAE1 expression correlated with an unfavorable prognosis for GC patients. Knockdown of RAE1, as compared to the control group, resulted in a significant inhibition of proliferation, migration, and invasion abilities in GC cell lines. Furthermore, RAE1 knockdown led to a substantial decrease in the expression of N-cadherin, vimentin, ZEB1, p-ERK1/2, and c-Myc proteins, coupled with a marked increase in E-cadherin expression. The biological effects of RAE1 in GC cells were effectively reversed by the inhibition of the ERK/MAPK signaling pathway using SCH772984. Additionally, RAE1 knockdown demonstrated a suppressive effect on GC tumor size in vivo. Immunohistochemistry (IHC) results revealed significantly lower expression of Ki-67 in RAE1 knockout mice compared to the control group. CONCLUSIONS: RAE1 promotes GC cell migration and invasion through the ERK/MAPK pathway and is a potential therapeutic target for GC therapy.

Abnormalities of regional spontaneous brain activity in poststroke aphasia: a meta-analysis.

Poststroke aphasia is an acquired language disorder and has been proven to have adverse effects on patients' social skills and quality of life. However, there are some inconsistencies in the neuroimaging studies investigating poststroke aphasia from the perspective of regional alterations. A meta-analysis has been employed to examine the common pattern of abnormal regional spontaneous brain activity in poststroke aphasia in the current study. Specifically, the Anisotropic effect-size version of seed-based d mapping was utilized, and 237 poststroke aphasia patients and 242 healthy controls (HCs) from 12 resting-state functional magnetic resonance imaging studies using amplitude of low-frequency fluctuations (ALFF), fractional ALFF, or regional homogeneity were included. The results showed that compared with HCs, patients with poststroke aphasia demonstrated increased regional spontaneous brain activity in the right insula, right postcentral gyrus, left cerebellar lobule IX, left angular gyrus, right caudate nucleus, left parahippocampal gyrus, and right supplementary motor area, and decreased regional spontaneous brain activity in the left cerebellar lobule VI, left median cingulate and paracingulate gyri, right cerebellar crus I, and left supplementary motor area. The study could provide further evidence for pathophysiological mechanism of poststroke aphasia and help find targets for treatment.

GPR143 mutations in an X-linked infantile nystagmus syndrome cohort in Southeast China.

Purpose: Infantile nystagmus syndrome (INS), or congenital nystagmus (CN), refers to a group of ocular motor disorders characterized by rapid to-and-fro oscillations of the eyes. GPR143 is the causative gene of ocular albinism type 1 (OA1), which is a special type of INS that manifests as reduced vision, nystagmus, and iris and fundus hypopigmentation. Here, we explored the genetic spectrum of INS and the genotype-phenotype correlation. Methods: A total of 98 families with INS from Southeast China were recruited for this study. A sample from each participant was subjected to PCR-based DNA direct sequencing of GPR143. Varied bioinformatics analysis was subsequently used in a mutation assessment. All participants received detailed ophthalmic examinations. Results: Genetic analysis identified 11 GPR143 mutations in 11.2% (11/98) of the X-linked INS families. These included seven novel mutations (c.899 C>T, c.886-2 A>G, c.1A>G, c.633_643del CCTGTTCCAAA, c.162_198delCGCGGGCCCCGGGTCCCCCGCGACGTCCCCGCCGGCC, c.628C>A, and c.178_179insGGGTCCC) and four known mutations. Patients who carried a GPR143 mutation were found to present a typical or atypical phenotype of OA1. All patients with GPR143 mutations manifested foveal hypoplasia; thus, about 45.8% (11/24) of the families with total X-linked INS exhibited foveal hypoplasia. Conclusions: We discovered seven novel mutations and four previously reported mutations of GPR143 in a cohort of families with X-linked INS and enlarged the Chinese genetic spectrum of INS. These findings offer new insights for developing genetic screening strategies and shed light on the importance of conducting genetic analysis in confirming the clinical diagnosis in unresolved patients and atypical phenotypes.

Type 2 diabetes mellitus plays a protective role against osteoporosis --mendelian randomization analysis.

BACKGROUND: Type 2 diabetes mellitus (DM2) and osteoporosis (OP) are currently the two most significant causes of mortality and morbidity in older adults, according to clinical evidence. The intrinsic link between them is yet unknown, despite reports of their coexistence. By utilizing the two-sample Mendelian randomization (MR) approach, we sought to evaluate the causal impact of DM2 on OP. METHODS: The aggregate data of the whole gene-wide association study (GWAS) were analyzed. A two-sample MR analysis was performed using single-nucleotide polymorphisms (SNPs), which are strongly associated with DM2, as instrumental variables (IVs) to evaluate the causal analysis of DM2 on OP risk with OR values, using inverse variance weighting, MR-egger regression, and weighted median methods, respectively. RESULT: A total of 38 single nucleotide polymorphisms were included as tool variables. According to the results of inverse variance-weighted (IVW), we found that there was a causal relationship between DM2 and OP, in which DM2 had a protective effect on OP. For each additional case of DM2, there is a 0.15% decrease in the odds of developing OP (OR = 0.9985;95%confidence interval:0.9974,0.9995; P value = 0.0056). There was no evidence that the observed causal effect between DM2 and the risk of OP was affected by genetic pleiotropy (P = 0.299). Using Cochran Q statistics and MR-Egger regression in the IVW approach, the heterogeneity was calculated; P > 0.05 shows that there is a significant amount of heterogeneity. CONCLUSION: A causal link between DM2 and OP was established by MR analysis, which also revealed that DM2 decreased the occurrence of OP.

Functional Connectivity Changes in Multiple-Frequency Bands in Acute Basal Ganglia Ischemic Stroke Patients: A Machine Learning Approach.

Purpose: Several functional magnetic resonance imaging (fMRI) studies have investigated the resting-state functional connectivity (rs-FC) changes in the primary motor cortex (M1) in patients with acute basal ganglia ischemic stroke (BGIS). However, the frequency-specific FC changes of M1 in acute BGIS patients are still unclear. Our study was aimed at exploring the altered FC of M1 in three frequency bands and the potential features as biomarkers for the identification by using a support vector machine (SVM). Methods: We included 28 acute BGIS patients and 42 healthy controls (HCs). Seed-based FC of two regions of interest (ROI, bilateral M1s) were calculated in conventional, slow-5, and slow-4 frequency bands. The abnormal voxel-wise FC values were defined as the features for SVM in different frequency bands. Results: In the ipsilesional M1, the acute BGIS patients exhibited decreased FC with the right lingual gyrus in the conventional and slow-4 frequency band. Besides, the acute BGIS patients showed increased FC with the right medial superior frontal gyrus (SFGmed) in the conventional and slow-5 frequency band and decreased FC with the left lingual gyrus in the slow-5 frequency band. In the contralesional M1, the BGIS patients showed lower FC with the right SFGmed in the conventional frequency band. The higher FC values with the right lingual gyrus and left SFGmed were detected in the slow-4 frequency band. In the slow-5 frequency band, the BGIS patients showed decreased FC with the left calcarine sulcus. SVM results showed that the combined features (slow-4+slow-5) had the highest accuracy in classification prediction of acute BGIS patients, with an area under curve (AUC) of 0.86. Conclusion: Acute BGIS patients had frequency-specific alterations in FC; SVM is a promising method for exploring these frequency-dependent FC alterations. The abnormal brain regions might be potential targets for future researchers in the rehabilitation and treatment of stroke patients.

Frequency-Specific Changes of Amplitude of Low-Frequency Fluctuations in Patients with Acute Basal Ganglia Ischemic Stroke.

Objective: The purpose of this study was to investigate the characteristics of different frequency bands in the spontaneous brain activity among patients with acute basal ganglia ischemic stroke (BGIS). Methods: In the present study, thirty-four patients with acute BGIS and forty-four healthy controls were examined by resting-state functional magnetic resonance imaging (rs-fMRI) from May 2019 to December 2020. Two amplitude methods including amplitude of low-frequency fluctuations (ALFF) and fractional ALFF (fALFF) calculated in three frequency bands (conventional frequency band: 0.01-0.08 Hz; slow-5 frequency band: 0.01-0.027 Hz; and slow-4 frequency band: 0.027-0.073 Hz) were conducted to evaluate the spontaneous brain activity in patients with acute BGIS and healthy controls (HCs). Gaussian Random Field Theory (GRF, voxel p < 0.01 and cluster p < 0.05) correction was applied. The correlation analyses were performed between clinical scores and altered metrics values. Results: Compared to HCs, patients with acute BGIS showed decreased ALFF in the right supramarginal gyrus (SMG) in the conventional and slow-4 bands, increased fALFF in the right middle frontal gyrus (MFG) in the conventional and slow-4 bands, and increased fALFF in the bilateral caudate in the slow-5 frequency band. The fALFF value of the right caudate in the slow-5 frequency band was negatively correlated with the clinical scores. Conclusion: In conclusion, this study showed the alterations in ALFF and fALFF in three frequency bands between patients with acute BGIS and HCs. The results reflected that the abnormal LFO amplitude might be related with different frequency bands and promoted our understanding of pathophysiological mechanism in acute BGIS.

Simultaneous multipolarization and high-resolution oxygen A-band spectrometer optical design with the astigmatism-corrected method.

Simultaneous multipolarization and high-resolution oxygen A-band spectrometer (SPHABS) is proposed. The astigmatism correction theory is used to separate beams from different fields of view and make it possible to obtain multiple polarization information simultaneously. SPHABS' design and the basic principle of SPHABS and the astigmatism correction theory are elaborated in detail. The ray-tracing results of the model showed that the resolution reached 0.016 nm and information from four fields of view could be obtained simultaneously on the image surface.

Preparation of Sub-50 nm Colloidal Monodispersed Hollow Siloxane-Based Nanoparticles with Controlled Shell Structures.

Hollow siloxane-based nanoparticles (HSNs) have attracted significant attention because of their promising unique properties for various applications. For advanced applications, especially in catalysis, drug delivery systems, and smart coatings, high dispersibility and monodispersity of HSNs with precisely controlled shell structures are important. In this study, we established a simple method for preparing colloidal HSNs with a uniform particle size below 50 nm by the reaction of colloidal silica nanoparticles with bridged organoalkoxysilane [1,2-bis(triethoxysilyl)ethylene: (EtO)3Si-C2H2-Si(OEt)3, BTEE] in the presence of a cationic surfactant. Upon the formation of organosiloxane shells by hydrolysis and polycondensation of BTEE, the core silica nanoparticles were spontaneously dissolved, and a part of the silicate species was incorporated into the organosiloxane shells. The size of the colloidal silica nanoparticles, the amount of BTEE added, and the pH of the reaction mixture greatly affected the formation of HSNs. Importantly, colloidal HSNs having micropores and mesopores in the shells were successfully prepared using silica nanoparticles (20, 30, and 40 nm in diameter) at pH values of 9 and 11, respectively. These HSNs are potentially important for applications in drug delivery systems and catalysis.

Deviation from niche optima affects the nature of plant-plant interactions along a soil acidity gradient.

There is increasing recognition of the importance of niche optima in the shift of plant-plant interactions along environmental stress gradients. Here, we investigate whether deviation from niche optima would affect the outcome of plant-plant interactions along a soil acidity gradient (pH = 3.1, 4.1, 5.5 and 6.1) in a pot experiment. We used the acid-tolerant species Lespedeza formosa Koehne as the neighbouring plant and the acid-tolerant species Indigofera pseudotinctoria Mats. or acid-sensitive species Medicago sativa L. as the target plants. Biomass was used to determine the optimal pH and to calculate the relative interaction index (RII). We found that the relationships between RII and the deviation of soil pH from the target's optimal pH were linear for both target species. Both targets were increasingly promoted by the neighbour as pH values deviated from their optima; neighbours benefitted target plants by promoting soil symbiotic arbuscular mycorrhizal fungi, increasing soil organic matter or reducing soil exchangeable aluminium. Our results suggest that the shape of the curve describing the relationship between soil pH and facilitation/competition depends on the soil pH optima of the particular species.

Long-term symptomatic relief of bullous keratopathy with amniotic membrane transplant.

The purpose of this study was to assess the long-term outcome of patients with symptomatic bullous keratopathy after amniotic membrane transplant. A retrospective cohort study includes that 20 patients with symptomatic bullous keratopathy, who have underwent amniotic membrane transplant at the Department of Ophthalmology & Visual Sciences, The Chinese University of Hong Kong, Prince of Wales Hospital & Alice Ho Miu Ling Hospital, Hong Kong between 04/1998 and 06/2011, were invited back. Clinical examination was performed, including, pain score assessment (pain score out of 10), epithelial healing, and vision. A total of 21 eyes of 20 patients returned for our study. The majority of eyes experienced pain reduction (94 %), with a significant mean pain score difference of 6.8 ± 2.6, 2-tail p < 0.001 (99 % CI 4.9-8.7). The mean pre-operative and post-operative pain scores were 7.3 ± 2.9 and 0.5 ± 1.0, respectively. 16 eyes (76 %) were completely pain free, and 10 eyes (47 %) remained symptom free after a mean follow-up of 39.0 ± 36.3 months (range 5-171 months). The median epithelial healing time was 2 weeks (range 1-20 weeks). Amniotic membrane transplant may be considered as a longer-term treatment for bullous keratopathy patients, especially in patients with poorer visual prognosis, but it may also be used as an interim measure for patients awaiting corneal transplant.

Cardiometabolic index is associated with increased depression: A population-based study.

BACKGROUND AND AIM: Depression is a common and complex psychiatric disorder, and lipid metabolism plays an important role in the development of psychiatric disorders such as depression. Cardiometabolic index (CMI) is a novel index that synthesizes two quantitative indicators of blood lipids (triglyceride(TG)/high-density lipoprotein cholesterol (HDL-C)) and human obesity-related parameters (waist height ratio (WHtR)). This study used NHANES data to explore the correlation between CMI and the incidence of depression. METHODS AND RESULTS: Based on the data of the National Health and Nutrition Examination Survey (NHANES) 2011-2018, multivariate logistic regression, sensitivity analysis, and smooth curve fitting were used to study the relationship between CMI and depression. Subgroup analysis and interaction tests were used to investigate whether the association was stable in different populations. CMI was positively associated with depression in 7229 participants aged >20 years. In the fully adjusted model, each unit increase in CMI was associated with 36 % higher likelihood of depression symptoms [1.36(1.16,1.59)]. Participants in the highest quartile of CMI had a 62 % higher risk of depression than participants in the lowest quartile [1.62(1.17,2.23)]. This positive correlation was more pronounced in those with hypertension. CONCLUSIONS: CMI was associated with a higher PHQ-9 score and an increased likelihood of depression among US adults. Further large-scale prospective studies are still need to analyze the role of CMI in depression.

Association between cardiometabolic index and hepatic steatosis and liver fibrosis: a population-based study.

BACKGROUND: The cardiometabolic index (CMI) is a new type of obesity index that is based on a combination of lipid levels and abdominal obesity indicators. It is closely correlated with the occurrence of diabetes mellitus, atherosclerosis, hypertension, and other diseases, thus playing an important role in the screening of metabolic diseases. This is coupled with hepatic steatosis and fibrosis which are characterized by excessive liver fat deposition. The aim of this study was to investigate the possible association between CMI and hepatic steatosis and liver fibrosis. METHODS: A cross-sectional investigation was conducted using the 2017-2020 National Health and Nutrition Examination Survey (NHANES) dataset to probe the relationship between CMI and hepatic steatosis and liver fibrosis, while multiple linear regression models were used to test the linear association between CMI and controlled attenuation parameter (CAP) and liver stiffness measurement (LSM). Smooth-fit curves and threshold effects analysis were used to describe the nonlinear relationships. Subgroup analyses were performed according to gender, age, body mass index (BMI), hypertension, diabetes, cardiovascular disease, and smoking status. RESULTS: A total of 3084 adults aged 18-80 years were included in this analysis, and after controlling for a variety of variables, there was a significant positive correlation between CMI and CAP [20.38 (16.27,24.49)]. When subgroups were analyzed, this positive correlation was found to be stronger in the female population than in the male (P for interaction = 0.0303). Furthermore, the association between CMI and CAP was nonlinear. Using multiple regression analysis, it was shown that the linear relationship between CMI and liver fibrosis was not significant [-0.09 (-0.47,0.29)]. CONCLUSIONS: The findings suggest that elevated CMI levels are associated with hepatic steatosis, but that CMI is not linked to liver fibrosis. Larger prospective investigations are needed to confirm our findings.

Platelet-rich plasma (PRP) in nerve repair.

Platelet-rich plasma (PRP) has the capability of assisting in the recovery of damaged tissues by releasing a variety of biologically active factors to initiate a hemostatic cascade reaction and promote the synthesis of new connective tissue and revascularization. It is now widely used for tissue engineering repair. In addition, PRP has demonstrated nerve repair and pain relief, and has been studied and applied to the facial nerve, median nerve, sciatic nerve, and central nerve. These suggest that PRP injection therapy has a positive effect on nerve repair. This indicates that PRP has high clinical value and potential application in nerve repair. It is worthwhile for scientists and medical workers to further explore and study PRP to expand its application in nerve repair, and to provide a more reliable scientific basis for the opening of a new approach to nerve repair.

Aggregation-induced emission-active iridium (III)-based mitochondria-targeting nanoparticle for two-photon imaging-guided photodynamic therapy.

The efficacy of imaging-guided photodynamic therapy (PDT) is compromised by the attenuation of fluorescence and decline in reactive oxygen species (ROS) generation efficiency in the physiological environment of conventional photosensitizers, limited near-infrared (NIR) absorption, and high systemic cytotoxicity. This paper presents the synthesis of two cyclometalated Ir (III) complexes (Ir-thpy and Ir-ppy) by using a triphenylamine derivative (DPTPA) as the primary ligand and their encapsulation into an amphiphilic phospholipid to form nanoparticles (NPs). These complexes exhibit aggregation-induced emission features and remarkably enhanced ROS generation compared to Chlorin e6 (Ce6). Moreover, Ir-thpy NPs possess the unique ability to selectively target mitochondria, leading to depolarization of the mitochondrial membrane potential and ultimately triggering apoptosis. Notably, Ir-thpy NPs exhibit exceptional photocytotoxicity even towards cisplatin-resistant A549/DDP tumor cells. In vivo two-photon imaging verified the robust tumor-targeting efficacy of Ir-thpy NPs. The in vivo results unequivocally demonstrate that Ir-thpy NPs exhibit excellent tumor ablation along with remarkable biocompatibility. This study presents a promising approach for the development of multifunctional Ir-NPs for two-photon imaging-guided PDT and provides novel insights for potential clinical applications in oncology.

Identification and validation of a novel glycolysis-related ceRNA network for sepsis-induced cardiomyopathy.

Purpose: Sepsis-induced cardiomyopathy (SIC) is a major life-threatening condition in critically infected patients. Early diagnosis and intervention are important to improve patient prognosis. Recognizing the pivotal involvement of the glycolytic pathway in SIC, this study aims to establish a glycolysis-related ceRNA network and explore novel diagnostic avenues. Materials and methods: SIC-related datasets were carefully filtered from the GEO database. CytoHubba was used to identify differentially expressed genes (DEGs) associated with glycolysis. A predictive method was then used to construct an lncRNA-miRNA-mRNA network. Dual-luciferase reporter assays validated gene interactions, and the specificity of this ceRNA network was confirmed in peripheral blood mononuclear cells (PBMCs) from SIC patients. Logistic analysis was used to examine the correlation between the ceRNA network and SIC. Diagnostic potential was assessed using receiver operating characteristic (ROC) curves, and correlation analysis investigated any associations between gene expression and clinical indicators. Results: IER3 was identified as glycolysis-related DEG in SIC, and a ceRNA network (SNHG17/miR-214-3p/IER3) was established by prediction. Dual luciferase reporter gene assay confirmed the presence of mutual binding between IER3, miR-214-3p and SNHG17. RT-qPCR verified the specific expression of this ceRNA network in SIC patients. Multivariate logistic analysis established the correlation between the ceRNA network and SIC. ROC analysis demonstrated its high diagnostic specificity (AUC > 0.8). Correlation analysis revealed a negative association between IER3 expression and oxygenation index in SIC patients (p < 0.05). Furthermore, miR-214-3p expression showed a negative correlation with NT-proBNP (p < 0.05). Conclusion: In this study, we identified and validated a ceRNA network associated with glycolysis in SIC: SNHG17/miR-214-3p/IER3. This ceRNA network may play a critical role in the onset and development of SIC. This finding is important to further our understanding of the pathophysiological mechanisms underlying SIC and to explore potential diagnostic and therapeutic targets for SIC.

LAMC2 regulates the proliferation, invasion, and metastasis of gastric cancer via PI3K/Akt signaling pathway.

OBJECTIVES: Gastric cancer (GC) is a prevalent malignant tumor widely distributed globally, exhibiting elevated incidence and fatality rates. The gene LAMC2 encodes the laminin subunit gamma-2 chain and is found specifically in the basement membrane of epithelial cells. Its expression is aberrant in multiple types of malignant tumors. This research elucidated a link between LAMC2 and the clinical characteristics of GC and investigated the potential involvement of LAMC2 in GC proliferation and advancement. MATERIALS AND METHODS: LAMC2 expressions were detected in GC cell lines and normal gastric epithelial cell lines via qRT-PCR. Silencing and overexpression of the LAMC2 were conducted by lentiviral transfection. A xenograft mouse model was also developed for in vivo analysis. Cell functional assays were conducted to elucidate the involvement of LAMC2 in cell growth, migration, and penetration. Further, immunoblotting was conducted to investigate the impact of LAMC2 on the activation of signal pathways after lentiviral transfection. RESULTS: In the findings, LAMC2 expression was markedly upregulated in GC cell lines as opposed to normal gastric epithelial cells. In vitro analysis showed that sh-LAMC2 substantially inhibited GC cell growth, migration, and invasion, while oe-LAMC2 displayed a contrasting effect. Xenograft tumor models demonstrated that oe-LAMC2 accelerated tumor growth via high expression of Ki-67. Immunoblotting analysis revealed a substantial decrease in various signaling pathway proteins, PI3K, p-Akt, and Vimentin levels upon LAMC2 knockdown, followed by increased E-cadherin expression. Conversely, its overexpression exhibited contrasting effects. Besides, epithelial-mesenchymal transition (EMT) was accelerated by LAMC2. CONCLUSION: This study provides evidence indicating that LAMC2, by stimulating signaling pathways, facilitated EMT and stimulated the progression of GC cells in laboratory settings and mouse models. Research also explored that the abnormal LAMC2 expression acts as a biomarker for GC.

Brain functional connectivity alterations of Wernicke's area in individuals with autism spectrum conditions in multi-frequency bands: A mega-analysis.

Characterized by severe deficits in communication, most individuals with autism spectrum conditions (ASC) experience significant language dysfunctions, thereby impacting their overall quality of life. Wernicke's area, a classical and traditional brain region associated with language processing, plays a substantial role in the manifestation of language impairments. The current study carried out a mega-analysis to attain a comprehensive understanding of the neural mechanisms underpinning ASC, particularly in the context of language processing. The study employed the Autism Brain Image Data Exchange (ABIDE) dataset, which encompasses data from 443 typically developing (TD) individuals and 362 individuals with ASC. The objective was to detect abnormal functional connectivity (FC) between Wernicke's area and other language-related functional regions, and identify frequency-specific altered FC using Wernicke's area as the seed region in ASC. The findings revealed that increased FC in individuals with ASC has frequency-specific characteristics. Further, in the conventional frequency band (0.01-0.08 Hz), individuals with ASC exhibited increased FC between Wernicke's area and the right thalamus compared with TD individuals. In the slow-5 frequency band (0.01-0.027 Hz), increased FC values were observed in the left cerebellum Crus II and the right lenticular nucleus, pallidum. These results provide novel insights into the potential neural mechanisms underlying communication deficits in ASC from the perspective of language impairments.

"Two-Stage Rocket-Propelled" Strategy Boosting Theranostic Efficacy with Mitochondria-Specific Type I-II Photosensitizers.

Imaging-guided photodynamic therapy (PDT) holds great potential for tumor therapy. However, achieving the synergistic enhancement of the reactive oxygen species (ROS) generation efficiency and fluorescence emission of photosensitizers (PSs) remains a challenge, resulting in suboptimal image guidance and theranostic efficacy. The hypoxic tumor microenvironment also hinders the efficacy of PDT. Herein, we propose a "two-stage rocket-propelled" photosensitive system for tumor cell ablation. This system utilizes MitoS, a mitochondria-targeted PS, to ablate tumor cells. Importantly, MitoS can react with HClO to generate a more efficient PS, MitoSO, with a significantly improved fluorescence quantum yield. Both MitoS and MitoSO exhibit less O2-dependent type I ROS generation capability, inducing apoptosis and ferroptosis. In vivo PDT results confirm that this mitochondrial-specific type I-II cascade phototherapeutic strategy is a potent intervention for tumor downstaging. This study not only sheds light on the correlation between the PS structure and the ROS generation pathway but also proposes a novel and effective strategy for tumor downstaging intervention.

Abnormalities of brain structure and function in cervical spondylosis: a multi-modal voxel-based meta-analysis.

Background: Previous neuroimaging studies have revealed structural and functional brain abnormalities in patients with cervical spondylosis (CS). However, the results are divergent and inconsistent. Therefore, the present study conducted a multi-modal meta-analysis to investigate the consistent structural and functional brain alterations in CS patients. Methods: A comprehensive literature search was conducted in five databases to retrieve relevant resting-state functional magnetic resonance imaging (rs-fMRI), structural MRI and diffusion tensor imaging (DTI) studies that measured brain functional and structural differences between CS patients and healthy controls (HCs). Separate and multimodal meta-analyses were implemented, respectively, by employing Anisotropic Effect-size Signed Differential Mapping software. Results: 13 rs-fMRI studies that used regional homogeneity, amplitude of low-frequency fluctuations (ALFF) and fractional ALFF, seven voxel-based morphometry (VBM) studies and one DTI study were finally included in the present research. However, no studies on surface-based morphometry (SBM) analysis were included in this research. Due to the insufficient number of SBM and DTI studies, only rs-fMRI and VBM meta-analyses were conducted. The results of rs-fMRI meta-analysis showed that compared to HCs, CS patients demonstrated decreased regional spontaneous brain activities in the right lingual gyrus, right middle temporal gyrus (MTG), left inferior parietal gyrus and right postcentral gyrus (PoCG), while increased activities in the right medial superior frontal gyrus, bilateral middle frontal gyrus and right precuneus. VBM meta-analysis detected increased GMV in the right superior temporal gyrus (STG) and right paracentral lobule (PCL), while decreased GMV in the left supplementary motor area and left MTG in CS patients. The multi-modal meta-analysis revealed increased GMV together with decreased regional spontaneous brain activity in the left PoCG, right STG and PCL among CS patients. Conclusion: This meta-analysis revealed that compared to HCs, CS patients had significant alterations in GMV and regional spontaneous brain activity. The altered brain regions mainly included the primary visual cortex, the default mode network and the sensorimotor area, which may be associated with CS patients' symptoms of sensory deficits, blurred vision, cognitive impairment and motor dysfunction. The findings may contribute to understanding the underlying pathophysiology of brain dysfunction and provide references for early diagnosis and treatment of CS. Systematic review registration: https://www.crd.york.ac.uk/PROSPERO/, CRD42022370967.

Ideal cardiovascular health index and high-normal blood pressure in elderly people: evidence based on real-world data.

Limited information is available on the cardiovascular health (CVH) index and risk of high-normal blood pressure (HNBP) in elderly people. Randomized cluster sampling, multivariate logistic regression, and mediating effects analysis were used in this study analyze the relationship between CVH index and HNBP in the elderly. 1089 non-hypertensive residents aged 65 years or older completed the study. The positive rate of HNBP was 75.85% (male vs. female: 76.13% vs. 75.64%, P = 0.852); The ideal rate of CVH (ideal CVH index ≥ 5 items) was 14.51% (male vs. female: 15.91% vs. 13.46%, P = 0.256). Compared with people with 0-2 ideal CVH index, the risk of HNBP in people with 4 ideal indexes and ≥ 5 ideal indexes decreased by 50% and 63%, respectively, and their OR (95% CI) were 0.50 (0.31, 0.81) and 0.37 (0.21, 0.66), respectively. The results of the trend test showed that the risk of HNBP decreased by 32% for every increase in the ideal CVH index (trend P < 0.001) and TyG index does not play a mediating role in this relationship. That is, increasing the number of ideal CVH index may effectively reduce the risk of HNBP in elderly by one-third.