Genome-wide analyses based on a novel donkey 40K liquid chip reveal the gene responsible for coat color diversity in Chinese Dezhou donkey.

Dezhou donkey is one of the representative local breeds in China, which is mainly divided into two strains: Sanfen and Wutou. There are obvious differences in coat color between the two strains. The former shows light points around the eyes, around the muzzle and under the belly, while the latter is completely solid black. In this study, genome-wide association analysis was performed for the differences in coat color traits between the Sanfen (n = 97) and Wutou (n = 108) strains using a novel donkey 40K liquid chip developed based on GenoBaits technology, to identify genomic regions and causal genes that could explain this variation. We also used FST and The cross-population composite likelihood ratio test (XPCLR) analyses to explore selected regions related to coat color differences. We identified one significant region on chromosome 15, with the most significant SNP located within the agouti signaling protein (ASIP) gene. At the same time, both FST and XPCLR methods detected the same selected region on chromosome 15, and ASIP was the gene with the strongest signal. ASIP and melanocortin 1 receptor (MC1R) control the ratio of eumelanin to pheomelanin through their protein activity. They are deeply involved in the process of melanosome organation and melanogenesis, thus affecting mammals' coat color variation. We used a range of genome-wide approach to identify the genetic basis of coat color variation in Dezhou donkeys. The results provide a supplement to the color variation study in Chinese donkeys at the genome-wide level, and preliminarily verified the reliability of the Molbreeding Donkey No. 1 40K liquid chip.

Association analysis of IGF2 gene polymorphisms with growth traits of Dezhou donkey.

IGF2 is an insulin-like growth factor that plays an important role in the development of animal embryos. In order to determine whether IGF2 gene is associated with important economic characteristics of donkeys, we investigated the association between single nucleotide polymorphisms (SNPs) of IGF2 gene and body size traits of Chinese Dezhou donkeys and analyzed the expression level of IGF2 gene in different tissues of juvenile and adult Dezhou donkeys. In this study, two SNPs (g.281766 G > A and g.291322 C > T) were detected in IGF2 gene, both of which were in Hardy-Weinberg equilibrium (P > 0.05) and were moderately polymorphic (0.25 < PIC < 0.50). Association analysis showed that the two SNP loci were significantly correlated with body length and rump height (p < 0.05) of female Dezhou donkeys. Quantitative results showed that the expression of IGF2 gene was higher in heart, liver, spleen, lung, kidney, stomach and muscle tissues of juvenile donkeys than that of adult donkeys. Together, IGF2 can be considered as a candidate gene for growth and development of female Dezhou donkey, and its polymorphism can be used as a molecular marker for the Dezhou donkey breeding.

A novel 31bp deletion within the CDKL5 gene is significantly associated with growth traits in Dezhou donkey.

The discovery of molecular markers which associate with livestock economic traits is of great significance for livestock breeding. Selective analysis has found a potential correlation between CDKL5 and growth traits, but there is still a lack of experimental proof. In this study, a 31-bp deletion (g.176595_176626delATGTCACATGTGGTACTGCCATGTGGAATTT) of CDKL5 gene was found by sequencing. The 31-bp indel was then genotyped in 380 individuals of Dezhou donkeys by polyacrylamide gel electrophoresis and there were three genotypes in this population. After the association analysis between growth traits and genotypes, it was found that this 31-bp indel polymorphism was significantly associated with the chest circumference of Dezhou donkeys (p < 0.05), and body length, chest depth and rump width (p < 0.01). In addition, all individuals with DD genotype were better than those with other genotypes in growth traits. This study revealed that a newly identified polymorphic locus in the CDKL5 gene is related to growth traits, which provides a molecular marker for genetic improvement of Dezhou donkey and may lay a solid foundation for the breeding of Dezhou donkey.

Identification of Dezhou donkey muscle development-related genes and long non-coding RNA based on differential expression analysis.

Long non-coding RNAs (lncRNAs) play a critical role in the development of muscles. However, the role of lncRNAs in regulating skeletal muscle development has not been studied systematically in the donkey. In this study, we performed the RNA sequencing for different stages of muscles in donkeys, and investigate their expression profile, which showed that 3215 mRNAs (p-adjust <0.05) and 471 lncRNAs (p-value <0.05) were significantly differently expressed (DE) verified by RT-qPCR. GO and KEGG enrichment analysis indicated that DE genes and target genes of DE lncRNAs were associated with muscle development in the donkey. We also found these four target genes (DCN, ITM2A, MUSTN1, ARRDC2) involved in skeletal muscle growth and development. Combined with transcriptome data, network, and RT-qPCR results showed that four co-expression networks of DCN and lnc-008278, ITM2A and lnc_017247, MUSTN1 and lnc_030153, and ARRDC2 and lnc_033914, which may play an important role in the formation and development of muscle in the donkey.

Analysis of lncRNA and mRNA expression profiling in immature and mature DeZhou donkey (equine Taurus) testes.

Testicular development and spermatogenesis are tightly regulated by the number of genes and noncoding genes, and mRNAs and lncRNAs play vital roles in regulating posttranscriptional gene expression. However, mRNAs and lncRNAs have not been systematically identified in the testes of donkeys. In this study, mRNA and lncRNA expression profiles in the testes of DeZhou donkeys between 2 months and 2 years of age were comprehensively analysed by RNA sequencing. We identified 56,605 lncRNAs and 61,857 mRNAs by gene expression analysis, and 21,845 lncRNAs (p < .05) and 14,109 mRNAs (p < .05) were differentially expressed in the immature (2-month-old, n = 3, noADGW) and mature (2-year-old, n = 3, ADGW) stages. In addition, Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses revealed that the predicted target genes were enriched in the adherens junction, cell cycle, propanoate metabolism and cell adhesion molecule pathways. This study identified and analysed a comprehensive catalogue of lncRNAs and mRNAs in donkey testes, which provides a useful resource for further investigation of biological function in donkey lncRNAs.

Genome-wide analysis reveals selection signatures for body size and drought adaptation in Liangzhou donkey.

Liangzhou donkey is a domestic animal breed distributed on the edge of the Tengger Desert in Gansu Province of China. It has small body size and strong adaptability to dry environments. Here, we sequenced 10 Liangzhou donkey genomes and compared them to the 55 genomes of 8 representative donkey breeds worldwide. The population structure analysis revealed that Liangzhou donkey harboured the ancestry with the Asian domestic donkeys (0.863) and European domestic donkeys (0.137). Three methods (nucleotide diversity, linkage disequilibrium decay and runs of homozygosity) implied the genetic diversity in Liangzhou donkey. In addition, we analyzed the genetic basis of the small body size and drought adaptation of Liangzhou donkey by using Fst, θπ-ratio, XP-EHH, CLR and θπ methods. We found that the NCAPG-LCORL on chromosome 3 may be a candidate region for small body size trait of Liangzhou donkey. The CYP4A11 gene located on chromosome 5 showed strong sign of selection sweep. CYP4A11 can convert arachidonic acid into 19(S)-HETE, which can promote water reabsorption in renal tubule and enhance the ability of Liangzhou donkey to adapt to dry environment. These results contribute to a better understanding of the underlying population structure of Liangzhou donkeys and provides a valuable resource for future research on donkey breeding in response to climate change.

mRNA sequencing provides new insights into the pathogenesis of Hirschsprung's disease in mice.

PURPOSE: The aim of this study is to use RNA sequencing and RT-qPCR to identify the main susceptibility genes linked to the occurrence and development of Hirschsprung disease in the colonic tissues of EDNRBm1yzcm and wild mice. METHODS: RNA was extracted from colon tissues of 3 mutant homozygous mice and 3 wild mice. RNA degradation, contamination concentration, and integrity were then measured. The extracted RNA was then sequenced using the Illumina platform. The obtained sequence data are filtered to ensure data quality and compared to the reference genome for further analysis. DESeq2 was used for gene expression analysis of the raw data. In addition, graphene oxide enrichment analysis and RT-qPCR validation were also performed. RESULTS: This study identified 8354 differentially expressed genes in EDNRBm1yzcm and wild mouse colon tissues by RNA sequencing, including 4346 upregulated genes and 4005 downregulated genes. Correspondingly, the results of RT-qPCR analysis showed good correlation with the transcriptome data. In addition, GO and KEGG enrichment results suggested that there were 8103 terms and 320 pathways in all DEGs. When P < 0.05, 1081 GO terms and 320 KEGG pathways reached a significant level. Finally, through the existing studies and the enrichment results of differentially expressed genes, it was determined that axon guidance and the focal adhesion pathway may be closely related to the occurrence of HSCR. CONCLUSIONS: This study analyzed and identified the differential genes in colonic tissues between EDNRBm1yzcm mice and wild mice, which provided new insight for further mining the potential pathogenic genes of Hirschsprung's disease.

Comparative Genomics Identifies the Evolutionarily Conserved Gene TPM3 as a Target of eca-miR-1 Involved in the Skeletal Muscle Development of Donkeys.

Species within the genus Equus are valued for their draft ability. Skeletal muscle forms the foundation of the draft ability of Equus species; however, skeletal muscle development-related conserved genes and their target miRNAs are rarely reported for Equus. In this study, a comparative genomics analysis was performed among five species (horse, donkey, zebra, cattle, and goat), and the results showed that a total of 15,262 (47.43%) genes formed the core gene set of the five species. Only nine chromosomes (Chr01, Chr02, Chr03, Chr06, Chr10, Chr18, Chr22, Chr27, Chr29, and Chr30) exhibited a good collinearity relationship among Equus species. The micro-synteny analysis results showed that TPM3 was evolutionarily conserved in chromosome 1 in Equus. Furthermore, donkeys were used as the model species for Equus to investigate the genetic role of TPM3 in muscle development. Interestingly, the results of comparative transcriptomics showed that the TPM3 gene was differentially expressed in donkey skeletal muscle S1 (2 months old) and S2 (24 months old), as verified via RT-PCR. Dual-luciferase test analysis showed that the TPM3 gene was targeted by differentially expressed miRNA (eca-miR-1). Furthermore, a total of 17 TPM3 gene family members were identified in the whole genome of donkey, and a heatmap analysis showed that EaTPM3-5 was a key member of the TPM3 gene family, which is involved in skeletal muscle development. In conclusion, the TPM3 gene was conserved in Equus, and EaTPM3-5 was targeted by eca-miR-1, which is involved in skeletal muscle development in donkeys.

Metabolomic profiling of Dezhou donkey seminal plasma related to freezability.

Donkeys are indispensable livestock in China because they have transport function and medicinal value. With the popularization of artificial insemination on donkeys, semen cryopreservation technology has gradually become a research hotspot. Seminal plasma is a necessary medium for transporting sperm and provides energy and nutrition for sperm. Seminal plasma metabolites play an important role in the process of sperm freezing, and also have an important impact on sperm motility and fertilization rate after freezing and thawing. In this study, liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis was used to compare the metabolic characteristics of seminal plasma of high freezability (HF) and low freezability (LF) male donkeys. We identified 672 metabolites from donkey seminal plasma, of which 33 metabolites were significantly different between the two groups. Metabolites were identified and categorized according to their major chemical classes, including homogeneous non-metal compounds, nucleosides, nucleotides, and analogues, organosulphur compounds, phenylpropanoids and polyketide, organoheterocyclic compounds, organic oxygen compounds, benzenoids, organic acids and derivatives, lipids and lipid-like molecules, organooxygen compounds, alkaloids and derivatives, organic nitrogen compounds. The results showed that the contents of phosphatidylcholine, piceatannol and enkephalin in donkey semen of HF group were significantly higher than those of LF group (p < .05), while the contents of taurocholic and lysophosphatidic acid were significantly lower than those of LF group (p < .05). The different metabolites were mainly related to sperm biological pathway response and oxidative stress. These metabolites may be considered as candidate biomarkers for different fertility in jacks.

Changes in sperm metabolites of Dezhou donkey after cryopreservation.

Sperm cryopreservation technology has laid the foundation for promoting the popularity of artificial insemination in donkey reproduction, but the freeze-thaw process can cause sperm damage, and the viability of frozen sperm is greatly reduced, resulting in low insemination ability. Sperm metabolites play an important role in the freezing process of spermatozoa and have a major influence on the freezability of spermatozoa. The aim of this study was to explore the differential metabolites in donkey spermatozoa before and after cryopreservation by liquid chromatography-tandem mass spectrometry (LC-MS/MS). We analysed ejaculate samples from male donkeys obtained before and after freezing and identified 1323 metabolites. Compared with fresh sperm (F), the metabolites of cryopreserved sperm (CRY) were significantly changed, and 570 metabolites were significantly different between the two groups (p < .05). Among them, 277 metabolites were higher in frozen sperm, while the opposite was true for 293 metabolites. These metabolites mainly include phospholipids, lysophospholipids and amino acids., most of which are associated with oxidative stress and sperm capacitation. We describe significantly different metabolites before and after freezing that are significantly associated with decreased sperm motility post-freezing and can be used as biomarkers of decreased sperm motility post-freezing.

Identification of novel alternative splicing of bovine lncRNA lncFAM200B and its effects on preadipocyte proliferation.

Adipogenesis is closely related to human health, livestock growth, and meat quality. A previous study identified that bovine lncFAM200B promoter has high activity in 3T3-L1 mice preadipocytes. Thus, lncFAM200B was a candidate gene for regulating adipogenesis. This study aimed to uncover the role of lncFAM200B in bovine adipogenesis and identify novel genetic variations within the bovine lncFAM200B gene. An expression analysis found that lncFAM200B was expressed higher in fat than that in muscle, but the difference was not related to the total methylation level of the promoter active region. Moreover, the expression of lncFAM200B exhibited a significant positive correlation with the expression of C/EBPa during bovine adipocyte differentiation. To uncover the function of lncFAM200B, the full-length lncFAM200B was cloned, and four kinds of transcript variants were found. Protein-coding potential prediction and prokaryotic expression system analysis showed that these four transcript variants were noncoding RNAs. The quantitative reverse-transcription polymerase chain reaction and 5-ethynyl-2'-deoxyuridine assay showed that the transcript variants decreased the messenger RNA expression of Cyclin D1 and inhibited the proliferation of bovine preadipocytes. Considering the important role of lncFAM200B in adipogenesis, we identified genetic variations in lncFAM200B. Three single-nucleotide polymorphisms (SNPs) were revealed, and two of them (SNP1 and SNP3) were associated with Nanyang cattle body measurement traits. In conclusion, this study found that bovine lncFAM200B inhibited preadipocyte proliferation, and two genetic variations of lncFAM200B could be used in cattle breeding.

Whole genome analyses revealed genomic difference between European taurine and East Asian taurine.

European taurine and East Asian taurine are two main clades in Bos taurus, but their genomic differences are not clearly elucidated. Here, we sequenced 16 Mongolian cattle genomes and compared them to the 92 genomes of 10 representative breeds worldwide. We found the highest LD level in Mishima cattle and the fastest LD decay in European taurine. Phylogenetic analysis revealed that Mongolian, Hanwoo and Mishima cattle were clustered into East Asian taurine. From selective sweep, gene annotation, functional enrichment and differential expression analysis, we identified selective signals including genes and/or pathways related to rapid growth and large body size in European taurine, and superior meat quality in East Asian taurine. Our findings will help us understand the evolutionary history and formation process of the breeds and provide theoretical materials regarding the genetic mechanism underlying breed characteristics and molecular breeding programmes of the taurine clades in the future.

Exploring genotype-phenotype relationships of the CRABP2 gene on growth traits in beef cattle.

Cellular retinoic acid binding protein 2 (CRABP2) is essential to myoblast differentiation. However, there was no report about the function of CRABP2 gene in cattle. This study explored the association of CRABP2 gene polymorphisms with growth traits in cattle breeds by several methods, such as DNA sequencing, PCR, PCR-RFLP and forced PCR-RFLP. Two sequence variants were determined. There were 621 individuals in six cattle breeds from China for the experiment, and three breeds were used to test validation of polymorphisms and extent of linkage disequilibrium (LD). The results showed that both SNPs (SNP1, g.2458 G > T, SNP2, g.3878 G > A) were in intron1. Two SNPs were in low linkage disequilibrium. Association analysis suggested that SNP1 had the significant difference on growth traits with body height, height at hip cross and body slanting length (P < .05), while SNP2 showed a significant difference in growth traits with body height, height at hip cross and body slanting length(P < .05). The results of this investigation displayed that the CRABP2 gene is an available candidate gene and may be used for breed selection and conservation.

Determination of genetic effects of SERPINA3 on important growth traits in beef cattle.

Serine protease inhibitor protein 3 (serpin peptidase inhibitor, clade A, member 3, SERPINA3) is a member of the serpin superfamily, probably related to the yield and quality of muscle. This study focuses on the relationship between SERPINA3 gene polymorphism and growth traits in beef cattle. The study first uses sequencing pooled DNA samples (Pool-Seq), PCR-RFLP and Tetra-primer ARMS-PCR techniques to determine the genetic polymorphisms of SERPINA3 in 765 beef cattle. Then, the polymorphic loci were correlated with the growth characters of cattle. Five SNPs (SNP1:A-648G, SNP2:T6496A, SNP3:G2495A, SNP4:T2595A, SNP5:A2615G) were found, located in the promoter, introns 5 and SNP 3, 4, 5 were in exons 2, respectively. The observed He was from 0.44 to 0.5, Ne were approaching 2 (1.78 to 2.00). The maximum and minimum PIC (polymorphism information content) values were 0.37 and 0.34, respectively. The association analysis results showed that the SNPs had a significant height in the chest girth and body length. (p < 0.05 or p < 0.01). This will provide important information for the rapid breeding of Chinese yellow cattle and the establishment of a molecular genetic marker database.

Multiple domestication of swamp buffalo in China and South East Asia.

The domestication of swamp buffalo (Bubalus bubalis carabanesis) has been discussed for years and still remained unclear. To obtain a better understanding of where, when and how the swamp buffaloes were domesticated, the complete mitochondrial DNA D-loop sequences of 1,788 individuals from China, Vietnam, Laos, Thailand, Burma, Bangladesh and India were investigated. Our results revealed swamp buffalo with abundant genetic diversity. The lineage SA of swamp buffalo may be first domesticated in Lower Yangtze and then migrated following two different routes: one migrated along the Upper Yangtze to Southwest China (L1); the other migrated to Southeast China to Southeast Asia through Guangxi province (L2). During the migration process several later domestication events may be inspired in the Upper Yangtze (SB3), Southwest China and North of Southeast Asia (SB1 and SB2). In this study, we proposed a non-independent multiple domestication pattern in swamp buffalo.

MiRNAs Expression Profiling of Bovine (Bos taurus) Testes and Effect of bta-miR-146b on Proliferation and Apoptosis in Bovine Male Germline Stem Cells.

Spermatogenesis is a complex biological process regulated by well-coordinated gene regulation, including MicroRNAs (miRNAs). miRNAs are endogenous non-coding ribonucleic acids (ncRNAs) that mainly regulate the gene expression at post-transcriptional levels. Several studies have reported miRNAs expression in bull sperm and the process of spermatogenic arrest in cattle and yak. However, studies for the identification of differential miRNA expression and its mechanisms during the developmental stages of testis still remain uncertain. In the current study, we comprehensively analyzed the expression of miRNA in bovine testes at neonatal (3 days after birth, n = 3) and mature (13 months, n = 3) stages by RNA-seq. Moreover, the role of bta-miR-146b was also investigated in regulating the proliferation and apoptosis of bovine male germline stem cells (mGSCs) followed by a series of experiments. A total of 652 miRNAs (566 known and 86 novel miRNAs) were identified, whereas 223 miRNAs were differentially expressed between the two stages. Moreover, an elevated expression level of bta-miR-146b was found in bovine testis among nine tissues, and the functional studies indicated that the overexpression of bta-miR-146b inhibited the proliferation of bovine mGSCs and promoted apoptosis. Conversely, regulation of bta-miR-146b inhibitor promoted bovine mGSCs proliferation. This study provides a basis for understanding the regulation roles of miRNAs in bovine testis development and spermatogenesis.

Analysis of Genetic Diversity and Structure of Guanzhong Horse Using Microsatellite Markers.

To determine the genetic diversity and validate the pedigree record of Chinese Guanzhong horse, 67 individuals were genotyped with eight microsatellite markers. In our study, the mean observed and expected heterozygosities were 0.51 and 0.66, respectively. The mean observed number of alleles for the Guanzhong horse was 3.88. Nonetheless, the total value of FST multiloci clearly indicates that about 0.5% of overall genetic variation is due to line founder differences, while differences among individuals are responsible for the remaining 99.5%. In addition, the polymorphic information content (PIC) result showed that five loci (HTG7, HMS7, HMS2, AHT4, and HMS6) were highly polymorphic (PIC > 0.5) and three loci (HMS3, HTG6, and COR071) were moderate polymorphic (PIC > 0.25). Genetic distances and cluster analysis showed that the genetic relationship among 67 Guanzhong horse was generally consistent with pedigree recorded. Our results not only evaluated the genetic diversity of Chinese Guanzhong horse, but also suggested that the eight microsatellite markers might be used as subservient markers for parentage verification and individual identification in the Guanzhong horse.

Identification of a Novel Polymorphism in Bovine lncRNA ADNCR Gene and Its Association with Growth Traits.

Adipocyte differentiation-associated long noncoding RNA (ADNCR) is a newly discovered lncRNA. It plays function by targeting miR-204 to significantly regulates the expression of the target SIRT1 gene in preadipocytes both at the level of mRNA and protein, thereby inhibiting adipogenesis. The tetra-primer amplification refractory mutation system PCR (T-ARMS-PCR) strategy is fast and accuracy at a negligible cost for SNP genotyping in large samples. In the study, a novel SNP g.1263T>A in intron 1 of bovine ADNCR gene was found. Herein, the T-ARMS-PCR assay was applied to detect the genotypes of the novel SNP of bovine ADNCR gene in 1017 individuals from seven cattle breeds and validated the accuracy by DNA sequencing assay of ninety animals representing three different genotypes. The concordance between two different methods was 100%. The association analysis indicated that this locus was significantly associated with the body weight (P = 0.010), chest girth (P = 0.014) and rump length (P = 0.038) in Jinnan cattle, hucklebone width (P = 0.032) in Qinchuan cattle, the cannon circumference (P = 0.019) in Jinjiang cattle, respectively. These novel findings may be used for marker-assisted selection (MAS) and contribute to the performance of beef cattle in the future.

Polymorphisms in MX2 Gene Are Related with SCS in Chinese Dairy Cows.

Viral infections can play direct or indirect roles in the etiology of the bovine mastitis. Mx dynamin-like GTPase 2 (MX2) gene is a main effector of the antiviral innate immune defense mediated by type I interferon (IFN I), which was demonstrated to confer positive antiviral responses to many viruses. Given the importance of the MX2 in modulating the host immune response, MX2 gene may be a suitable candidate gene for studying disease resistance in dairy cattle. Here, we scanned the sequence variation of the MX2 gene in Chinese indigenous cattle breeds. Twenty-three previously reported SNPs were identified. To further analyze the effects of SNPs detected on mastitis disease, analysis of two SNPs (g.787527 C > T and g.787610 T > C) from 297 Chinese Holstein cows revealed a significant association with somatic cell score (SCS). Although functional studies are necessary to ascertain whether these two SNPs are causal polymorphisms or merely in linkage with the true causal SNPs, implementation of these two SNPs as genetic markers in the dairy industry may be beneficial in selecting individuals with lower SCS.

Detection of Insertions/Deletions Within SIRT1, SIRT2 and SIRT3 Genes and Their Associations with Body Measurement Traits in Cattle.

Growth traits are complex quantitative traits controlled by numerous candidate genes, and they can be well-evaluated using body measurement traits. As the members of the nicotinamide adenine dinucleotide-dependent family of histone deacetylases, class I sirtuin genes (including SIRT1, SIRT2 and SIRT3) play crucial roles in regulating lipid metabolism, cellular growth and metabolism, suggesting that they are potential candidate genes affecting body measurement traits in animals. Hence, the objective of this work aimed to detect novel insertions/deletions (indels) of SIRT1, SIRT2 and SIRT3 genes in 955 cattle belonging to five breeds, as well as to evaluate their effects on body measurement traits. Herein, the novel 12-bp indel of SIRT1 gene, the 7-bp indel of SIRT2 gene and the 26-bp indel of SIRT3 gene were firstly reported, respectively. The association analysis indicated that the indels within SIRT1 and SIRT2 genes were significantly associated with body measurement traits such as body weight, chest circumference, height at hip cross, hip width, body height, etc. (P < 0.05 or P < 0.01). Therefore, based on these findings, the two novel indel variants within bovine SIRT1 and SIRT2 genes could be considered as potential molecular markers for growth traits in cattle selection practices and breeding.