Attenuation of Leishmania infantum chagasi metacyclic promastigotes by sterol depletion.

The infectious metacyclic promastigotes of Leishmania protozoa establish infection in a mammalian host after they are deposited into the dermis by a sand fly vector. Several Leishmania virulence factors promote infection, including the glycosylphosphatidylinositol membrane-anchored major surface protease (MSP). Metacyclic Leishmania infantum chagasi promastigotes were treated with methyl-beta-cyclodextrin (MßCD), a sterol-chelating reagent, causing a 3-fold reduction in total cellular sterols as well as enhancing MSP release without affecting parasite viability in vitro. MßCD-treated promastigotes were more susceptible to complement-mediated lysis than untreated controls and reduced the parasite load 3-fold when inoculated into BALB/c mice. Paradoxically, MßCD-treated promastigotes caused a higher initial in vitro infection rate in human or murine macrophages than untreated controls, although their intracellular multiplication was hindered upon infection establishment. There was a corresponding larger amount of covalently bound C3b than iC3b on the parasite surfaces of MßCD-treated promastigotes exposed to healthy human serum in vitro, as well as loss of MSP, a protease that enhances C3b cleavage to iC3b. Mass spectrometry showed that MßCD promotes the release of proteins into the extracellular medium, including both MSP and MSP-like protein (MLP), from virulent metacyclic promastigotes. These data support the hypothesis that plasma membrane sterols are important for the virulence of Leishmania protozoa at least in part through retention of membrane virulence proteins.

Serial quantitative PCR assay for detection, species discrimination, and quantification of Leishmania spp. in human samples.

The Leishmania species cause a variety of human disease syndromes. Methods for diagnosis and species differentiation are insensitive and many require invasive sampling. Although quantitative PCR (qPCR) methods are reported for leishmania detection, no systematic method to quantify parasites and determine the species in clinical specimens is established. We developed a serial qPCR strategy to identify and rapidly differentiate Leishmania species and quantify parasites in clinical or environmental specimens. SYBR green qPCR is mainly employed, with corresponding TaqMan assays for validation. The screening primers recognize kinetoplast minicircle DNA of all Leishmania species. Species identification employs further qPCR set(s) individualized for geographic regions, combining species-discriminating probes with melt curve analysis. The assay was sufficient to detect Leishmania parasites, make species determinations, and quantify Leishmania spp. in sera, cutaneous biopsy specimens, or cultured isolates from subjects from Bangladesh or Brazil with different forms of leishmaniasis. The multicopy kinetoplast DNA (kDNA) probes were the most sensitive and useful for quantification based on promastigote standard curves. To test their validity for quantification, kDNA copy numbers were compared between Leishmania species, isolates, and life stages using qPCR. Maxicircle and minicircle copy numbers differed up to 6-fold between Leishmania species, but the differences were smaller between strains of the same species. Amastigote and promastigote leishmania life stages retained similar numbers of kDNA maxi- or minicircles. Thus, serial qPCR is useful for leishmania detection and species determination and for absolute quantification when compared to a standard curve from the same Leishmania species.

Leishmania infantum chagasi: a genome-based approach to identification of excreted/secreted proteins.

The parasitic protozoan, Leishmania, survives in harsh environments within its mammalian and sand fly hosts. Secreted proteins likely play critical roles in the parasite's interactions with its environment. As a preliminary identification of the spectrum of potential excreted/secreted (ES) proteins of Leishmania infantum chagasi (Lic), a causative agent of visceral leishmaniasis, we used standard algorithms to screen the annotated L. infantum genome for genes whose predicted protein products have an N-terminal signal peptide and lack transmembrane domains and membrane anchors. A suite of 181 candidate ES proteins were identified. These included several that were documented in the literature to be released by other Leishmania spp. Six candidate ES proteins were selected for further validation of their expression and release by different parasite stages. We found both amastigote-specific and promastigote-specific released proteins. The ES proteins of Lic are candidates for future studies of parasite virulence determinants and host protective immunity.

Differential expression of a protease gene family in African trypanosomes.

During their life cycle African trypanosomes must quickly adapt to the different environments of the tsetse fly midgut and the mammalian bloodstream by modulating expression of many of their genes. One group of these differentially expressed genes encodes different forms of a major surface protease. Using a luciferase reporter gene transiently or permanently transfected into trypanosomes, we show here that the 3'-UTRs of these protease genes are responsible for their differential expression. Deletion analysis of the 389-bp 3'-UTR of one of the protease genes, MSP-B, demonstrated that it contains a U-rich regulatory region of about 23bp (UCGUCUGUUAUUUCUUAGUCCAG), which suppresses expression of the reporter protein in bloodstream trypanosomes by as much as 25-fold, but has little effect on the reporter expression in procyclic (tsetse fly) trypanosomes. Replacing the entire 3'-UTR with just this 23-bp element mimicked most of the suppression effect of the complete 3'-UTR. Northern blots showed that the 23-bp element influences the steady state RNA level, but not enough to account for the 25-fold suppression effect. Polysome analyses showed that in procyclic trypanosomes more of the total protease mRNA is associated with intermediate-sized and large polysomes than in bloodstream trypanosomes. Thus, the 23-bp element of this protease gene affects both the level of RNA and its translation.

A function for a specific zinc metalloprotease of African trypanosomes.

The Trypanosoma brucei genome encodes three groups of zinc metalloproteases, each of which contains approximately 30% amino acid identity with the major surface protease (MSP, also called GP63) of Leishmania. One of these proteases, TbMSP-B, is encoded by four nearly identical, tandem genes transcribed in both bloodstream and procyclic trypanosomes. Earlier work showed that RNA interference against TbMSP-B prevents release of a recombinant variant surface glycoprotein (VSG) from procyclic trypanosomes. Here, we used gene deletions to show that TbMSP-B and a phospholipase C (GPI-PLC) act in concert to remove native VSG during differentiation of bloodstream trypanosomes to procyclic form. When the four tandem TbMSP-B genes were deleted from both chromosomal alleles, bloodstream B (-/-) trypanosomes could still differentiate to procyclic form, but VSG was removed more slowly and in a non-truncated form compared to differentiation of wild-type organisms. Similarly, when both alleles of the single-copy GPI-PLC gene were deleted, bloodstream PLC (-/-) cells could still differentiate. However, when all the genes for both TbMSP-B and GPI-PLC were deleted from the diploid genome, the bloodstream B (-/-) PLC (-/-) trypanosomes did not proliferate in the differentiation medium, and 60% of the VSG remained on the cell surface. Inhibitors of cysteine proteases did not affect this result. These findings demonstrate that removal of 60% of the VSG during differentiation from bloodstream to procyclic form is due to the synergistic activities of GPI-PLC and TbMSP-B.

Trypanin is a cytoskeletal linker protein and is required for cell motility in African trypanosomes.

The cytoskeleton of eukaryotic cells is comprised of a complex network of distinct but interconnected filament systems that function in cell division, cell motility, and subcellular trafficking of proteins and organelles. A gap in our understanding of this dynamic network is the identification of proteins that connect subsets of cytoskeletal structures. We previously discovered a family of cytoskeleton-associated proteins that includes GAS11, a candidate human tumor suppressor upregulated in growth-arrested cells, and trypanin, a component of the flagellar cytoskeleton of African trypanosomes. Although these proteins are intimately associated with the cytoskeleton, their function has yet to be determined. Here we use double-stranded RNA interference to block trypanin expression in Trypanosoma brucei, and demonstrate that this protein is required for directional cell motility. Trypanin(minus sign) mutants have an active flagellum, but are unable to coordinate flagellar beat. As a consequence, they spin and tumble uncontrollably, occasionally moving backward. Immunofluorescence experiments demonstrate that trypanin is located along the flagellum/flagellum attachment zone and electron microscopic analysis revealed that cytoskeletal connections between the flagellar apparatus and subpellicular cytoskeleton are destabilized in trypanin(minus sign) mutants. These results indicate that trypanin functions as a cytoskeletal linker protein and offer insights into the mechanisms of flagellum-based cell motility.

Different trans RNA splicing events in bloodstream and procyclic Trypanosoma brucei.

Most trypanosomatid genes are transcribed into polycistronic precursor RNAs that are processed into monocistronic mRNAs possessing a 39-nucleotide spliced leader (SL) at their 5'-ends and polyadenylation at their 3'-ends. We show here that precursor RNA derived from a luciferase gene integrated in reverse orientation at the rDNA locus of Trypanosoma brucei is processed into three major SL-containing RNAs in bloodstream cells and a single SL-containing RNA in procyclic RNAs. This difference in trans RNA splicing between bloodstream and procyclic cells is independent of the 5'- and 3'-UTRs flanking the luciferase coding region. Thus, bloodstream cells can recognize some sequences in precursor RNA as a SL addition site that procyclic cells do not. These alternative SL addition sites may be aberrant or they might be utilized to expand the number of gene products from individual genes. Future experiments on endogenous genes will be necessary to examine the latter possibility.

The major surface protease (MSP or GP63) in the intracellular amastigote stage of Leishmania chagasi.

The Leishmania spp. protozoa have an abundant surface metalloprotease called MSP (major surface protease), which in Leishmania chagasi is encoded by three distinct gene classes (MSPS, MSPL, MSPC). Although MSP has been characterized primarily in extracellular promastigotes, it also facilitates survival of intracellular amastigotes. Promastigotes express MSPS, MSPL, and two forms of MSPC RNAs, whereas amastigotes express only MSPL RNA and one MSPC transcript. We confirmed the presence of MSPC protein in both promastigotes and amastigotes by liquid chromatography-tandem mass spectrometry (LC-MS/MS). More than 10 MSP isoforms were visualized in both amastigotes and promastigotes using two-dimensional immunoblots, but amastigote MSPs migrated at a more acidic pI. Promastigote MSPs were N-glycosylated, whereas most amastigote MSPs were not. Immuno-electron microscopy showed that two-thirds of the promastigote MSP is distributed along the cell surface. In contrast, most amastigote MSP localized at the flagellar pocket, the major site of leishmania endocytosis/exocytosis. Biochemical analyses indicated that most amastigote MSP is soluble in the cytosol, vesicles or organelles, whereas most promastigote MSP is membrane-associated and GPI anchored. Activity gels and immunoblots confirmed the presence of a novel proteolytically active amastigote MSP of higher Mr than the promastigote MSPs. Furthermore, promastigote MSP is shed extracellularly whereas MSP is not shed from axenic amastigotes. We conclude that amastigotes and promastigotes both express multiple MSP isoforms, but these MSPs differ biochemically and localize differently in the two parasite stages. We hypothesize that MSP plays different roles in the extracellular versus intracellular forms of Leishmania spp.

The sequence and analysis of Trypanosoma brucei chromosome II.

We report here the sequence of chromosome II from Trypanosoma brucei, the causative agent of African sleeping sickness. The 1.2-Mb pairs encode about 470 predicted genes organised in 17 directional clusters on either strand, the largest cluster of which has 92 genes lined up over a 284-kb region. An analysis of the GC skew reveals strand compositional asymmetries that coincide with the distribution of protein-coding genes, suggesting these asymmetries may be the result of transcription-coupled repair on coding versus non-coding strand. A 5-cM genetic map of the chromosome reveals recombinational 'hot' and 'cold' regions, the latter of which is predicted to include the putative centromere. One end of the chromosome consists of a 250-kb region almost exclusively composed of RHS (pseudo)genes that belong to a newly characterised multigene family containing a hot spot of insertion for retroelements. Interspersed with the RHS genes are a few copies of truncated RNA polymerase pseudogenes as well as expression site associated (pseudo)genes (ESAGs) 3 and 4, and 76 bp repeats. These features are reminiscent of a vestigial variant surface glycoprotein (VSG) gene expression site. The other end of the chromosome contains a 30-kb array of VSG genes, the majority of which are pseudogenes, suggesting that this region may be a site for modular de novo construction of VSG gene diversity during transposition/gene conversion events.

Regulation of genes encoding the major surface protease of Leishmania chagasi via mRNA stability.

The intercoding regions between many Leishmania sp. genes regulate their mRNA expression. The MSPL mRNA, encoding a subclass of the major surface protease (MSP) of Leishmania chagasi, increases in abundance, when protein synthesis is arrested, while alpha-tubulin (alpha-TUB) mRNA and most other mRNAs do not. We found that the intercoding region between MSPL-coding regions, when cloned downstream of the beta-galactosidase reporter gene (beta-GAL), caused beta-GAL mRNA to increase 8- to 10-fold after inhibiting protein synthesis with cycloheximide. Stable L. chagasi transfectants containing hybrid MSPL/alpha-TUB intercoding regions cloned downstream of beta-GAL were made. The alpha-TUB intercoding region induced high-level baseline beta-GAL mRNA that increased only 1.3-fold after incubation with cycloheximide. In contrast, the MSPL intercoding region, as well as constructs containing nucleotides 303-505 from the MSPL 3'UTR, caused steady-state beta-GAL mRNA levels in the absence of cycloheximide that were approximately 10% of alpha-TUB constructs. These levels increased between 4.4- and 13.2-fold after cycloheximide was added. Constructs containing half of this region (303-394 or 395-505) produced intermediate levels of beta-GAL mRNA and intermediate levels of cycloheximide induction. The kinetics of cycloheximide induction of beta-GAL mRNA was similar with region 303-505 constructs as with constructs bearing the entire endogenous MSPL intercoding region. Furthermore, region 303-505 increased reporter mRNA abundance after cycloheximide by increasing mRNA half-life. Hence, we have identified a 202-nucleotide region within the MSPL 3'UTR that is in part responsible for cycloheximide induction. We hypothesize that this region may interact with labile regulatory protein factor(s).

Internal and surface subpopulations of the major surface protease (MSP) of Leishmania chagasi.

Major surface protease (MSP) facilitates Leishmania promastigote evasion of complement-mediated lysis in the mammalian host and enhances host macrophage phagocytosis of the promastigotes. We previously showed that the steady-state abundance of MSP protein increases 14-fold during in vitro cultivation of L. chagasi promastigotes from logarithmic to stationary phase, despite the fact that the total amount of MSP mRNA does not increase. Furthermore, 10 major MSP isoforms are differentially expressed in different promastigote growth phases, and attenuation of parasites by long-term in vitro cultivation influences MSP isoform expression. Herein, we report that although about two-thirds of newly synthesized MSP becomes surface localized, the rest of the MSP does not reach the promastigote surface. This internal MSP is stable without detectable decrease in abundance up to 6 days after biosynthesis. Furthermore, surface-localized MSP is released at different rates from logarithmic and stationary phase virulent Leishmania promastigotes. These data are consistent with the hypothesis that the major mechanism regulating MSP abundance is the rate of loss of surface-localized MSP from the promastigote surface, and that internally localized MSP is very stable.

The major surface protease (MSP or GP63) of Leishmania sp. Biosynthesis, regulation of expression, and function.

Leishmania sp. are digenetic protozoa that cause an estimated 1.5-2 million new cases of leishmaniasis per year worldwide. Among the molecular factors that contribute to Leishmania sp. virulence and pathogenesis is the major surface protease, alternately called MSP, GP63, leishmanolysin, EC3.4.24.36, and PSP, which is the most abundant surface protein of leishmania promastigotes. Recent studies using gene knockout, antisense RNA and overexpression mutants have demonstrated a role for MSP in resistance of promastigotes to complement-mediated lysis and either a direct or indirect role in receptor-mediated uptake of leishmania. The MSP gene clusters in different Leishmania sp. include multiple distinct MSPs that tend to fall into three classes, which can be distinguished by their sequences and by their differential expression in parasite life stages. Regulated expression of MSP class gene products during the parasite life cycle occurs at several levels involving both mRNA and protein metabolism. In this review we summarize advances in MSP research over the past decade, including organization of the gene families, crystal structure of the protein, regulation of mRNA and protein expression, biosynthesis and possible functions. The MSPs exquisitely demonstrate the multiple levels of post-transcriptional gene regulation that occur in Leishmania sp. and other trypanosomatid protozoa.

Surface glycoprotein PSA (GP46) expression during short- and long-term culture of Leishmania chagasi.

The mRNAs encoding promastigote surface antigen (PSA) of Leishmania chagasi have previously been shown to increase about 30-fold as in vitro cultured parasites progress from logarithmic to stationary phase, growth phases that are, respectively associated with parasites having low and high infectivity to mammals. Experiments reported here establish by western blot analysis that PSA proteins of 44 and 66 kDa also increase about 30-fold as parasite cultures reach stationary phase. Serial passage of parasite cultures resulted in a progressive reduction in PSA protein and RNA abundance to levels less than 3% that of cultures newly-initiated with parasites derived from a parasitized rodent. Loss of PSA mRNA abundance in serially passaged cells was not due to reduced PSA gene transcription rates, as determined by nuclear run-on assays. Neither was the loss associated with a marked decrease in PSA mRNA stability. Analysis of PSA RNA stability in the presence of actinomycin D, an inhibitor of transcription elongation, failed to detect a difference in fully processed cytosolic PSA mRNA stability regardless of the number of times a culture was passaged or the growth phase of the culture. Based on the lack of detectable difference in (cytosolic) mature PSA mRNA stability during promastigote development, the data indirectly suggest that the regulated expression of PSA in cells from low-passage cultures and the loss of PSA expression in high-passage cultures may be mediated by nuclear events that occur after transcription of the PSA genes and before arrival of the mature mRNAs in the cytoplasm.

Multiple products of the Leishmania chagasi major surface protease (MSP or GP63) gene family.

The major surface protease (MSP or GP63) of the Leishmania spp. protozoa facilitates parasite evasion of complement-mediated killing, phagocytosis by macrophages, and intracellular survival in macrophage phagolysosomes. Immunoblots of several Leishmania species have shown there are distinct MSP isoforms, but the biochemical bases for these differences are unknown. Northern blots show that transcripts of the three tandem gene classes encoding Leishmania chagasi MSP (MSPS, MSPL, MSPC) are differentially expressed during parasite growth in vitro. Cell-associated MSPs increase in abundance during growth, correlating directly with parasite virulence. We examined whether distinct products of these >18 MSP genes are either differentially expressed or differentially processed during parasite growth. Two-dimensional gel electrophoresis and immunoblots delineated more than 10 MSP isoforms in stationary phase L. chagasi, distributed between pIs of 5.2-6.1 and masses of 58-63 kDa. Post-translational modifications including N-glycosylation, GPI anchor addition and phosphorylation did not account for all differences among the isoforms. MALDI-TOF mass spectrometry demonstrated that at least some L. chagasi MSPs were the products of different MSP genes. One isoform was not available for surface biotinylation, suggesting it could be located internally. Parasites in logarithmic growth expressed only four MSP isoforms, and an attenuated strain of L. chagasi (L5) did not express one of the MSP classes (MSPS). These data demonstrate that the products of individual MSP genes are differentially expressed during Leishmania development. We hypothesize they may play different roles during parasite migration through its two hosts.

Tests of cytoplasmic RNA interference (RNAi) and construction of a tetracycline-inducible T7 promoter system in Trypanosoma cruzi.

The technique of RNA interference (RNAi) is exceedingly useful for knocking down the expression of a specific mRNA in African trypanosomes and other organisms for the purpose of examining the function of its gene. However, when we attempted to apply RNAi in the Latin American trypanosome, Trypanosoma cruzi, to diminish expression of mRNA encoding the surface protein amastin, we found that the amastin double-stranded RNA (dsRNA) was not efficiently degraded in either epimastigotes or amastigotes, and the level of amastin mRNA remained unchanged. We generated a strain of T. cruzi CL-Brener in which the T7 promoter and tetracycline operator could be used to maximize tetracycline-regulated dsRNA synthesis and constructed plasmids that direct dsRNA against four different T. cruzi endogenous genes (encoding beta-tubulin, GP72 (flagellar adhesion protein), ribosomal protein P0 and amastin) and an exogenously added gene (GFP; green fluorescent protein). After either stable or transient transfection of these plasmids into T. cruzi, the expected RNAi phenotype was not observed for any of the five genes, although the T. cruzi beta-tubulin RNAi plasmid did give the expected FAT cell phenotype in the African trypanosome, Trypanosoma brucei. These data indicate that, similar to Leishmania, T. cruzi lacks one or more components necessary for the RNAi pathway and that these components will need to be engineered into T. cruzi, or compensated for, before RNAi can be used to study gene function in this organism.

Biosynthesis of the major surface protease GP63 of Leishmania chagasi.

The protozoan Leishmania chagasi expresses a surface metalloprotease, GP63, whose abundance increases 14-fold as parasites grow from logarithmic to stationary phase. L. chagasi GP63 is encoded by three classes of MSP genes that are differentially expressed during parasite growth. Using metabolic labeling and immunoprecipitation, we found L. chagasi GP63 first appeared as a 66-kDa band that was replaced by a 63-kDa protein. This pattern also occurred in transfected L. donovani harboring detectable products of only one MSP gene, suggesting a precursor-product relationship. The half-life of GP63 increased from 29 h in logarithmic phase to >72 h in stationary phase promastigotes. GP63 loss from the cell was complemented by the appearance of a 63-kDa GP63 in extracellular medium in both membrane-associated and -free forms. Calculations suggested that the long and lengthening T(1/2) of cell-associated GP63 accounts in part for its progressive accumulation in the cell during promastigote growth. The current findings add yet another level of complexity to post-transcriptionally regulated expression of an abundant surface molecule in a trypanosomatid protozoan.

Antigenic variation and the African trypanosome genome.

African trypanosomes are protozoan parasites that reside in the mammalian bloodstream where they constantly confront the immune responses directed against them. They keep one-step-ahead of the immune system by continually switching from the expression of one variant surface glycoprotein (VSG) on their surface to the expression of another immunologically distinct VSG-a phenomenon called antigenic variation. About 1000 VSG genes (VSGs) and pseudo-VSGs are scattered throughout the trypanosome genome, all of which are transcriptionally silent except for one. Usually, the active VSG has been recently duplicated and translocated to one of about 20 potential bloodstream VSG expression sites (B-ESs). Each of the 20 potential B-ESs is adjacent to a chromosomal telomere, but only one B-ES is actively transcribed in a given organism. Recent evidence suggests the active B-ES is situated in an extra-nucleolar body of the nucleus where it is transcribed by RNA polymerase I. Members of another group of about 20 telomere-linked VSG expression sites (the M-ESs) are expressed only during the metacyclic stage of the parasite in its tsetse fly vector. Progress in sequencing the African trypanosome genome has led to additional insights on the organization of genes within both groups of ESs that may ultimately suggest better ways to control or eliminate this deadly pathogen.

Mapping of VSG similarities in Trypanosoma brucei.

The protozoan parasite Trypanosoma brucei switches its variant surface glycoprotein (VSG) to subvert its mammalian hosts' immune responses. The T. brucei genome contains as many as 1600 VSG genes (VSGs), but most are silent noncoding pseudogenes. Only one functional VSG, located in a telomere-linked expression site, is transcribed at a time. Silent VSGs are copied into a VSG expression site through gene conversion. Truncated gene conversion events can generate new mosaic VSGs with segments of sequence identity to other VSGs. To examine the VSG family sub-structure within which these events occur, we combined the available VSG sequences and annotations with scripted BLAST searches to map the relationships among VSGs in the T. brucei genome. Clusters of related VSGs were visualized in 2- and 3-dimensions for different N- and C-terminal regions. Five types of N-termini (N1-N5) were observed, within which gene recombinational events are likely to occur, often with fully-coding 'functional' or 'atypical'VSGs centrally located between more dissimilar VSGs. Members of types N1, N3 and N4 are most closely related in the middle of the N-terminal region, whereas type N2 members are more similar near the N-terminus. Some preference occurs in pairing between specific N- and C-terminal types. Statistical analyses indicated no overall tendency for more related VSGs to be located closer in the genome than less related VSGs, although exceptions were noted. Many potential mosaic gene formation events within each N-terminal type were identified, contrasted by only one possible mosaic gene formation between N-terminal types (N1 and N2). These data suggest that mosaic gene formation is a major contributor to the overall VSG diversity, even though gene recombinational events between members of different N-terminal types occur only rarely.

Differential protein expression throughout the life cycle of Trypanosoma congolense, a major parasite of cattle in Africa.

Trypanosoma congolense is an important pathogen of livestock in Africa. To study protein expression throughout the T. congolense life cycle, we used culture-derived parasites of each of the three main insect stages and bloodstream stage parasites isolated from infected mice, to perform differential protein expression analysis. Three complete biological replicates of all four life cycle stages were produced from T. congolense IL3000, a cloned parasite that is amenable to culture of major life cycle stages in vitro. Cellular proteins from each life cycle stage were trypsin digested and the resulting peptides were labeled with isobaric tags for relative and absolute quantification (iTRAQ). The peptides were then analyzed by tandem mass spectrometry (MS/MS). This method was used to identify and relatively quantify proteins from the different life cycle stages in the same experiment. A search of the Wellcome Trust's Sanger Institute's semi-annotated T. congolense database was performed using the MS/MS fragmentation data to identify the corresponding source proteins. A total of 2088 unique protein sequences were identified, representing 23% of the ∼9000 proteins predicted for the T. congolense proteome. The 1291 most confidently identified proteins were prioritized for further study. Of these, 784 yielded annotated hits while 501 were described as "hypothetical proteins". Six proteins showed no significant sequence similarity to any known proteins (from any species) and thus represent new, previously uncharacterized T. congolense proteins. Of particular interest among the remainder are several membrane molecules that showed drastic differential expression, including, not surprisingly, the well-studied variant surface glycoproteins (VSGs), invariant surface glycoproteins (ISGs) 65 and 75, congolense epimastigote specific protein (CESP), the surface protease GP63, an amino acid transporter, a pteridine transporter and a haptoglobin-hemoglobin receptor. Several of these surface disposed proteins are of functional interest as they are necessary for survival of the parasites.

The effects of macrophage source on the mechanism of phagocytosis and intracellular survival of Leishmania.

Leishmania spp. protozoa are obligate intracellular parasites that replicate in macrophages during mammalian infection. Efficient phagocytosis and survival in macrophages are important determinants of parasite virulence. Macrophage lines differ dramatically in their ability to sustain intracellular Leishmania infantum chagasi (Lic). We report that the U937 monocytic cell line supported the intracellular replication and cell-to-cell spread of Lic during 72 h after parasite addition, whereas primary human monocyte-derived macrophages (MDMs) did not. Electron microscopy and live cell imaging illustrated that Lic promastigotes anchored to MDMs via their anterior ends and were engulfed through symmetrical pseudopods. In contrast, U937 cells bound Lic in diverse orientations, and extended membrane lamellae to reorient and internalize parasites through coiling phagocytosis. Lic associated tightly with the parasitophorous vacuole (PV) membrane in both cell types. PVs fused with LAMP-1-expressing compartments 24 h after phagocytosis by MDMs, whereas U937 cell PVs remained LAMP-1 negative. The expression of one phagocytic receptor (CR3) was higher in MDMs than U937 cells, leading us to speculate that parasite uptake proceeds through dissimilar pathways between these cells. We hypothesize that the mechanism of phagocytosis differs between primary versus immortalized human macrophage cells, with corresponding differences in the subsequent intracellular fate of the parasite.