PARP inhibitor and immune checkpoint inhibitor have synergism efficacy in gallbladder cancer.

Gallbladder cancer (GBC) is an aggressive cancer with poor prognosis. PARP inhibitors (PARPi) target PARP enzymes and have shown efficacy in patients with breast cancer gene (BRCA) mutations. Immunotherapy, especially immune checkpoint inhibitors (ICIs), has transformed cancer treatment. However, the combined impact of PARPi and ICIs in GBC remains unclear. We present a groundbreaking case of a GBC patient with BRCA2 mutations who received combination therapy with PARPi and ICIs after failing multiple lines of treatment. Next-generation sequencing (NGS-Seq) identified BRCA gene mutations. To further investigate potential mechanisms, we developed a PARP1-BRCA1-BRCA2 pathway-related risk score (PBscore) system to evaluate the impact of PARPi on the tumor immune microenvironment via RNA-Seq data. Gene expression and functional analysis identified potential mechanisms associated with the PBscore. Experimental validation assessed the impact of the combination therapy on the tumor microenvironment using multiplexed immunofluorescence imaging and immunohistochemistry in patients with BRCA gene wild type or mutations. RNA-Seq analysis revealed correlations between PBscore, immune checkpoint levels, tumor-infiltrating immune cells (TIICs), and the cancer-immunity cycle. Multiplexed immunofluorescence imaging validated that low PBscore patients might have an active tumor microenvironment. Furthermore, upon drug resistance, we observed an upregulation of negative immune checkpoints such as CEACAM1, indicating that the tumor immune microenvironment becomes suppressed after resistance. Our study revealed that PBscore could serve as a biomarker to predict immunotherapy efficacy, offering a promising alternative for BRCA2-mutated GBC patients.

1D-Guided Differential Rescaling of a Contour Plot in Comprehensive 2D Gas Chromatography.

A 1D-guided differential rescaling algorithm for a contour plot is developed based on our recently proposed comprehensive two-dimensional gas chromatography (GC × GC) system with a first-dimensional (1D) detector added. Chromatograms obtained from 1D and second-dimensional (2D) detectors are both incorporated during the data processing. As compared to the conventional contour plot methods using only 2D data, our algorithm can significantly improve precision and consistency of GC × GC results in terms of retention times, peak widths, and peak areas or volumes, regardless of modulation time selection, modulation phase shift fluctuations, and modulation duty cycle. The peak identification, quantification, and capacity can therefore be enhanced. Furthermore, the 1D-guided differential rescaling method is shown to better handle the coelution and missing peak issues often encountered in the conventional methods. Finally, the new method exhibits high versatility in 1D and 2D detector selection, which greatly broadens GC × GC utility. Our method can easily be adapted to other two-dimensional chromatography systems that have direct access to 1D chromatograms.

Development, Validation, and Clinical Application of an Ultra-High-Performance Liquid Chromatography Coupled With Tandem Mass Spectrometry Method for the Determination of 10 Antituberculosis Drugs in Human Serum.

INTRODUCTION: Linezolid, moxifloxacin, rifapentine, rifabutin, cycloserine, clofazimine, bedaquiline, levofloxacin, prothionamide, and ethionamide are commonly used second-line antituberculosis (anti-TB) drugs. To support therapeutic drug monitoring in regular clinical practice, the authors sought to develop a method based on ultra-high-performance liquid chromatography coupled with tandem mass spectrometry (UHPLC-MS/MS) that would allow for the simultaneous quantification of multiple second-line anti-TB drugs in human serum. METHODS: Analytes were extracted from human serum by protein precipitation. UHPLC-MS/MS was performed using a gradient at a flow rate of 0.3 mL/min, and each sample was taken for 7.5 minutes. The mass spectrometry scanning mode used was electrospray ionization with multiple reaction monitoring in the positive mode. RESULTS: Validation showed that endogenous substances in the sample did not interfere with the assay, and the relationship between X and Y was highly linear, with a coefficient of determination (R 2 ) >0.9954 for each curve. The accuracy (85.0%-114.7%) and precision (intraday: 0.27%-9.32%; interday: 0.20%-7.66%) were less than 15.0%, and the internal standard-normalized matrix effects were consistent (coefficient of variation ≤4.40%). The analytes were stable in the final extract and human serum under various storage conditions (recovery: 87.0%-115.0%). The clinical applicability of the method was demonstrated by quantitative determination of analytes in serum samples obtained from patients with TB. Reproducibility of the drug concentrations measured in clinical samples was confirmed by incurred sample reanalysis. CONCLUSIONS: A simple and reliable analytical method was developed and validated for the simultaneous determination of 10 anti-TB drugs in human serum using UHPLC-MS/MS. Quantitation of anti-TB drugs in clinical samples confirmed that the assay is suitable for therapeutic drug monitoring in regular clinical practice.

Identification of a novel waikavirus infecting Pittosporum tobira in China.

A novel waikavirus, tentatively named "Pittosporum tobira waikavirus" (PtWV), was identified in Pittosporum tobira plants exhibiting mosaic and ringspot symptoms on foliage in Yunnan, China. The full-length genomic sequence was determined by high-throughput sequencing and rapid amplification of cDNA ends. The genome of PtWV is 12,709 nt in length and has a large open reading frame (ORF) of 11,010 nt, encoding a polyprotein, and a small ORF that encodes a 13.2-kDa bellflower vein chlorosis virus (BVCV)-like protein. Phylogenetic analysis and sequence alignment revealed that PtWV is closely related to actinidia yellowing virus 1 (AcYV1), which shares the highest amino acid (aa) sequence similarity (50.1% identity) in the Pro-RdRp region. To the best of our knowledge, this is the first report of a novel waikavirus in P. tobira.

Application of Biotechniques for In Vitro Virus and Viroid Elimination in Pome Fruit Crops.

Sustainable production of pome fruit crops is dependent upon having virus-free planting materials. The production and distribution of plants derived from virus- and viroid-negative sources is necessary not only to control pome fruit viral diseases but also for sustainable breeding activities, as well as the safe movement of plant materials across borders. With variable success rates, different in vitro-based techniques, including shoot tip culture, micrografting, thermotherapy, chemotherapy, and shoot tip cryotherapy, have been employed to eliminate viruses from pome fruits. Higher pathogen eradication efficiencies have been achieved by combining two or more of these techniques. An accurate diagnosis that confirms complete viral elimination is crucial for developing effective management strategies. In recent years, considerable efforts have resulted in new reliable and efficient virus detection methods. This comprehensive review documents the development and recent advances in biotechnological methods that produce healthy pome fruit plants. [Formula: see text] Copyright © 2024 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license.

Improving the multi-functionality of optical tweezers with FPGA integration.

The development of optical tweezers aims to extend their operating function and pattern. However, excessive programming can lead to a decrease in the system's operating speed and introduce bugs or data transmission delays. In this study, we present a time-shared optical tweezers system that allows for parallel operation of multiple functions. To enable efficient data transmission, we employ a queue structure and a buffer. To assess the system's performance, we utilize a biological sample in conjunction with the optical tweezers system and scanning imaging technique. We quantify the trapping parameter while concurrently running power stabilization programs. As a result, the standard deviation of the measured stiffness is reduced by 60% in the x and y directions and 30% in the z direction, indicating a significant improvement in calibration precision. Throughout the program execution, the system maintains an operating rate of 110 kHz, and the data are continuously updated in real time on the host. The system's performance demonstrates its potential for quantification and morphological reconstruction of biological samples.

Colorectal Cancer Diagnosis through Breath Test Using a Portable Breath Analyzer-Preliminary Data.

Screening methods available for colorectal cancer (CRC) to date are burdened by poor reliability and low patient adherence and compliance. An altered pattern of volatile organic compounds (VOCs) in exhaled breath has been proposed as a non-invasive potential diagnostic tool for distinguishing CRC patients from healthy controls (HC). The aim of this study was to evaluate the reliability of an innovative portable device containing a micro-gas chromatograph in enabling rapid, on-site CRC diagnosis through analysis of patients' exhaled breath. In this prospective trial, breath samples were collected in a tertiary referral center of colorectal surgery, and analysis of the chromatograms was performed by the Biomedical Engineering Department. The breath of patients with CRC and HC was collected into Tedlar bags through a Nafion filter and mouthpiece with a one-way valve. The breath samples were analyzed by an automated portable gas chromatography device. Relevant volatile biomarkers and discriminant chromatographic peaks were identified through machine learning, linear discriminant analysis and principal component analysis. A total of 68 subjects, 36 patients affected by histologically proven CRC with no evidence of metastases and 32 HC with negative colonoscopies, were enrolled. After testing a training set (18 CRC and 18 HC) and a testing set (18 CRC and 14 HC), an overall specificity of 87.5%, sensitivity of 94.4% and accuracy of 91.2% in identifying CRC patients was found based on three VOCs. Breath biopsy may represent a promising non-invasive method of discriminating CRC patients from HC.

Recent advances in bimetallic nanoscale zero-valent iron composite for water decontamination: Synthesis, modification and mechanisms.

The environmental pollution of water is one of the problems that have plagued human society. The bimetallic nanoscale zero-valent iron (BnZVI) technology has increased wide attention owing to its high performance for water treatment and soil remediation. In recent years, the BnZVI technology based on the development of nZVI has been further developed. The material chemistry, synthesis methods, and immobilization or surface stabilization of bimetals are discussed. Further, the data of BnZVI (Fe/Ni, Fe/Cu, Fe/Pd) articles that have been studied more frequently in the last decade are summarized in terms of the types of contaminants and the number of research literatures on the same contaminants. Five contaminants including trichloroethylene (TCE), Decabromodi-phenyl Ether (BDE209), chromium (Cr(VI)), nitrate and 2,4-dichlorophenol (2,4-DCP) were selected for in-depth discussion on their influencing factors and removal or degradation mechanisms. Herein, comprehensive views towards mechanisms of BnZVI applications including adsorption, hydrodehalogenation and reduction are provided. Particularly, some ambiguous concepts about formation of micro progenitor cell, production of hydrogen radicals (H·) and H2 and the electron transfer are highlighted. Besides, in-depth discussion of selectivity for N2 from nitrates and co-precipitation of chromium are emphasized. The difference of BnZVI is also discussed.

Ultrathin Silica Integration for Enhancing Reliability of Microfluidic Photoionization Detectors.

Microfluidic photoionization detectors (µPIDs) based on silicon chips can rapidly and sensitively detect volatile compounds. However, the applications of µPID are limited by the manual assembly process using glue, which may outgas and clog the fluidic channel, and by the short lifetime of the vacuum ultraviolet (VUV) lamps (especially, argon lamps). Here, we developed a gold-gold cold welding-based microfabrication process to integrate ultrathin (10 nm) silica into µPID. The silica coating enables direct bonding of the VUV window to silicon under amicable conditions and works as a moisture and plasma exposure barrier for VUV windows that are susceptible to hygroscopicity and solarization. Detailed characterization of the silica coating was conducted, showing that the 10 nm silica coating allows 40-80% VUV transmission from 8.5 to 11.5 eV. It is further shown that the silica-protected µPID maintained 90% of its original sensitivity after 2200 h of exposure to ambient (dew point = 8.0 ± 1.8 °C), compared to 39% without silica. Furthermore, argon plasma inside an argon VUV lamp was identified as the dominant degradation source for the LiF window with color centers formation in UV-vis and VUV transmission spectra. Ultrathin silica was then also demonstrated effective in protecting the LiF from argon plasma exposure. Lastly, thermal annealing was found to bleach the color centers and restore VUV transmission of degraded LiF windows effectively, which will lead to future development of a new type of VUV lamp and the corresponding µPID (and PID in general) that can be mass produced with a high yield, a longer lifetime, and better regenerability.

Genomic characterization of a novel torradovirus infecting Arctium lappa L. in China.

Burdock (Arctium lappa L.) is not only a popular vegetable crop but also an important medicinal plant. In burdock plants with symptoms of leaf mosaic, a novel torradovirus tentatively named "burdock mosaic virus" (BdMV) was identified by high-throughput sequencing. The complete genomic sequence of BdMV was further determined using RT-PCR and the rapid amplification of cDNA ends (RACE) method. The genome is composed of two positive-sense single-stranded RNAs. RNA1 (6991 nt) encodes a polyprotein of 2186 aa, and RNA2 (4700 nt) encodes a protein of 201 aa and a polyprotein of 1212 aa that is predicted to be processed into one movement protein (MP) and three coat proteins (CPs). The Pro-Pol region of RNA1 and the CP region of RNA2 shared the highest amino acid sequence identity of 74.0% and 70.6%, respectively, with the corresponding sequences of lettuce necrotic leaf curl virus (LNLCV) isolate JG3. Phylogenetic analysis based on the amino acid sequences of the Pro-Pol and CP regions showed that BdMV clustered with other non-tomato-infecting torradoviruses. Taken together, these results suggest that BdMV is a new member of the genus Torradovirus.

Identification and complete genome sequence of a novel sadwavirus discovered in chrysanthemum (Chrysanthemum morifolium Ramat.).

The complete genome sequence of a putative novel member of the genus Sadwavirus was determined by high-throughput sequencing of a chrysanthemum from an orchard of the Tongxiang Agricultural Science Institute in Tongxiang, Zhejiang province. The complete genome sequence was confirmed using RT-PCR and the rapid amplification of cDNA ends (RACE) method. The predicted genome of the putative virus is composed of two RNA molecules, 7016 and 6772 nucleotides in length, excluding their poly-A tails. The new virus was tentatively named "chrysanthemum sadwavirus" (ChSV). The Pro-Pol region of RNA1 and the CP region of RNA2 of ChSV shared the highest amino acid sequence identity (53.01% and 36.40%, respectively) with the corresponding sequences of lettuce secovirus 1 (LSV-1). Phylogenetic analysis showed that ChSV clustered with members of the subgenus Stramovirus (genus Sadwavirus). Taken together, these results suggest that ChSV is a new member of the genus Sadwavirus.

Born approximation of trapping forces by acoustical Bessel and vortex fields.

Acoustic radiation forces have been used to trap various objects for fundamental studies and practical applications. Born approximation method, originally introduced to solve quantum scattering problems, is herein extended to analyze trapping forces exerted by two- and three-dimensional acoustic Bessel and vortex fields on spherical and nonspherical objects of arbitrary size. The results are compared with the conventional models like the partial wave expansion and Gorkov force potential. It is shown that for weakly scattering objects (such as common soft biological particles surrounded by fluids), the Born approximation can make predictions for the trapping forces on objects whose characteristic lengths are even up to multiple wavelengths of the sound beams. With the aid of the approximation, the Gorkov force potential is applied to analyze and gain insights into trapping forces on large objects far beyond the original Rayleigh scattering regime. The effects caused by the beam parameters, object shape, and orientation on the trapping behaviors are revealed. This work is useful for the further study of acoustic radiation forces and will guide the experiment of simplified acoustic tweezers on arbitrary-shaped particles.

First report of grapevine asteroid mosaic-associated virus in grapevines in China.

Grapevine asteroid mosaic-associated virus (GAMaV), a member of the genus Marafivirus of the family Tymoviridae, was first described to infect grapevines in California (Abou Ghanem-Sabanadzovic et al. 2003). Since then, GAMaV has been reported from Greece, Japan, Canada, Uruguay, France, Hungary, Italy, Spain, Switzerland and Russia, and also in some free-living grapevines in North America (Kyriakopoulou, 1991; Morán et al., 2021; Reynard et al., 2022; Shvets et al., 2022; Thompson et al., 2021). GAMaV may be associated with grapevine asteroid mosaic disease (Martelli 2014). In August 2022, a grapevine cv. Cabernet Sauvignon exhibiting chlorotic mottling was collected in Ningxia, China. Total RNAs were extracted using RNAprep Pure Plant Plus Kit (DP441, TIANGEN BIOTECH, Beijing), and the ribosomal RNA were removed by the Epicentre Ribo-Zero rRNA Removal Kit (Epicentre, Madison, WI, USA). The ribosomal RNA-depleted RNAs were then used to construct a cDNA library using a TruSeq RNA Sample Prep Kit (Illumina, San Diego, CA, USA), which was sequenced on an Illumina NovaSeq 6000 platform (Biomarker Biology Technology), resulting in 39,297,567 paired-end clean reads (150 nt × 2). Reads mapping to the grapevine genome (GenBank accession no PN40024) were removed using hisat2 2.1.0 software. The 15,003,158 unmapped reads were de novo assembled into 70,512 contigs using the rnaviralSPAdes method in the SPAdes v3.15.3 software with default parameters and analyzed through BLASTn and BLASTx analysis. Five viruses and two viroids were identified: GAMaV (5 contigs), grapevine Pinot gris virus (3 contigs), grapevine berry inner necrosis virus (3 contigs) , grapevine rupestris stem pitting-associated virus (4 contigs), grapevine red globe virus (2 contigs), grapevine yellow speckle 1 viroid (4 contigs) and hop stunt viroid (3 contigs). The five contigs of GAMaV were 352 nt~2, 224 nt in length, which were assembled from 3, 308 reads and shared 85.56%~91.81% nt identity with the genome of the GAMaV isolate GV30 (KX354202) with 93.3% coverage. To further confirm the infection of GAMaV, we designed two pairs of primers, GAMaV-mel1a/1b (5'-CACCTCGCCCCCTACCTTGAC-3'/5'-AAGAGGACGCCTTTGCGGGAG-3') and GAMaV-cp1a/1b (5'-CTAGCGACGACCGCACTGATC-3'/5'-GTCGGTGTACGAGATTTGGTC-3'), which were used to amplify the 329-bp and 440-bp fragments in the helicase (Hel) domain and coat protein (CP) gene of GAMaV genome in RT-PCR, respectively. The amplified PCR products were cloned and sequenced and the two sequences (OQ676951 and OQ676958) showed 91.2% and 93.4% nt identity with the isolate GV30, respectively. Furthermore, 429 grapevine samples of 71 cultivars were collected from 21 provinces and tested by RT-PCR using the above primer pairs. The results showed that 1.4% (6/429) of the samples tested positive, including one 'Autumn seedless' grapevine (Liaoning province), two 'Dawuhezi' (Liaoning), one 'Cabernet Gernischt' (Liaoning) and two 'Cabernet Sauvignon' (Tianjing and Shandong respectively). The partial sequences of the Hel domain (OQ676952-57) and CP gene (OQ676959-61) obtained from the positive samples by sequencing showed 89.1% to 84.5% and 93.6% to 93.9% nt identity with the isolate GV30, respectively. Because these GAMaV-positive grapevines did not show distinct symptoms, GAMaV pathogenicity remains challenging to confirm. This is the first report of GAMaV in grapevines in China, extending the information on its geographical distribution.

Retention Time Trajectory Matching for Peak Identification in Chromatographic Analysis.

Retention time drift caused by fluctuations in physical factors such as temperature ramping rate and carrier gas flow rate is ubiquitous in chromatographic measurements. Proper peak matching and identification across different chromatograms is critical prior to any subsequent analysis but is challenging without using mass spectrometry. The purpose of this work was to describe and validate a peak matching and identification method called retention time trajectory (RTT) matching that can be used in targeted analyses free of mass spectrometry. This method uses chromatographic retention times as the only input and identifies peaks associated with any subset of a predefined set of target compounds. An RTT is a two-dimensional (2D) curve formed uniquely by the retention times of the chromatographic peaks. The RTTs obtained from the chromatogram of a sample under test and those pre-installed in a library are matched and statistically compared. The best matched pair implies identification. Unlike most existing peak-alignment methods, no mathematical warping or transformation is involved. Based on the experimentally characterized RTT, an RTT hybridization method was also developed to rapidly generate more RTTs and expand the library without performing actual time-consuming chromatographic measurements, which enables successful peak matching even for chromatograms with severe retention time drifts. Additionally, 3.15 × 105 tests using experimentally obtained gas chromatograms and 2 × 1012 tests using two publicly available fruit metabolomics datasets validated the proposed method, demonstrating real-time peak/interferent identification.

Integrated Transcriptome and Metabolome Dissecting Interaction between Vitis vinifera L. and Grapevine Fabavirus.

Grapevine fabavirus (GFabV) is a novel member of the Fabavirus genus associated with chlorotic mottling and deformation symptoms in grapevines. To gain insights into the interaction between GFabV and grapevines, V. vinifera cv. 'Summer Black' infected with GFabV was investigated under field conditions through physiological, agronomic, and multi-omics approaches. GFabV induced significant symptoms on 'Summer Black', and caused a moderate decrease in physiological efficiency. In GFabV-infected plants, alterations in carbohydrate- and photosynthesis-related genes might trigger some defense responses. In addition, secondary metabolism involved in plant defense was progressively induced by GFabV. Jasmonic acid and ethylene signaling were down-regulated in GFabV-infected leaves and berries along with the expression of proteins related to LRR and protein kinases, suggesting that GFabV can block the defense in healthy leaves and berries. Furthermore, this study provided biomarkers for early monitoring of GFabV infection in grapevines, and contributed to a better understanding of the complex grapevine-virus interaction.

Rapid and Quantitative In Vitro Evaluation of SARS-CoV-2 Neutralizing Antibodies and Nanobodies.

Neutralizing monoclonal antibodies and nanobodies have shown promising results as potential therapeutic agents for COVID-19. Identifying such antibodies and nanobodies requires evaluating the neutralization activity of a large number of lead molecules via biological assays, such as the virus neutralization test (VNT). These assays are typically time-consuming and demanding on-lab facilities. Here, we present a rapid and quantitative assay that evaluates the neutralizing efficacy of an antibody or nanobody within 1.5 h, does not require BSL-2 facilities, and consumes only 8 µL of a low concentration (ng/mL) sample for each assay run. We tested the human angiotensin-converting enzyme 2 (ACE2) binding inhibition efficacy of seven antibodies and eight nanobodies and verified that the IC50 values of our assay are comparable with those from SARS-CoV-2 pseudovirus neutralization tests. We also found that our assay could evaluate the neutralizing efficacy against three widespread SARS-CoV-2 variants. We observed increased affinity of these variants for ACE2, including the ß and γ variants. Finally, we demonstrated that our assay enables the rapid identification of an immune-evasive mutation of the SARS-CoV-2 spike protein, utilizing a set of nanobodies with known binding epitopes.

A method for scattering angle calibration in the rainbow region using a droplet stream.

Accurate quantification of scattering angle versus detector pixel strongly determines the measurement accuracy of rainbow refractometry. This is an emerging measurement technique operating at backscatter angles and characterizing droplets or complex droplets in terms of size and refractive index. A novel method for calibration of the rainbow scattering angle using a monodisperse droplet stream is introduced and the achievable accuracy is estimated. The assumption of a linear pixel-to-angle relation is derived, and a calibration procedure is proposed based on global fit of calibration data to the theoretically known rainbow signal. The accuracy of this method was examined by simulations and experiments, where the uncertainties of a priori parameters of droplets were also considered and validated using shadowgraphy as a ground truth. The results confirm the feasibility of this method with a maximum absolute error of 0.032°and 3.9E-5°/pixel respectively for the intercept and slope of the linear relationship. These values translate into maximum uncertainties in diameter and refractive index of approx. 0.67% and 2.8 × 10-4.

First report of Vitis cryptic virus from grapevines in China.

Vitis cryptic virus (VCV) was recently identified on wild Vitis coignetiae in Japan in 2021, and was tentatively classified as a new member of the genus Deltapartitivirus, which is consistent with the two-segmented genome encoding RdRp and CP (Nabeshima et al., 2021). In June 2020, a grapevine cv. Jinhuanghou in a vineyard exhibiting chlorotic mottling (Figure S1) was collected in Xingcheng, Liaoning province of China. Total RNAs were extracted using RNAprep Pure Plant Plus Kit (DP441, TIANGEN BIOTECH, Beijing), and the ribosomal RNA were removed by the Epicentre Ribo-Zero rRNA Removal Kit (Epicentre, Madison, WI, USA). The ribosomal RNA-depleted RNA was then used to construct a cDNA library using a TruSeq RNA Sample Prep Kit (Illumina, San Diego, CA, USA), which was sequenced on an Illumina NovaSeq 6000 platform (Biomarker Biology Technology), resulting 60,208,348 paired-end clean reads (150 nt × 2). Reads mapping to the grapevine genome (PN40024 assembly 12X) were removed by hierarchical indexing using hisat2 2.1.0 software (Kim et al., 2019). The unmapped reads were de novo assembled into 116,809 contigs using the rnaviralSPAdes method in the SPAdes v3.15.3 software with default parameters (Prjibelski et al., 2020) and analyzed through BLAST analysis. Two viruses and two viroids were identified: VCV (2 contigs), grapevine emaravirus A (GEVA; 5 contigs), grapevine yellow speckle viroid 1 (GYSVd1; 1 contig) and hop stunt viroid (HSVd; 1 contig). The two contigs of VCV had lengths of 1575 nt and 1563 nt, and shared 95% and 90% nt identity with RNA1 and RNA2 genomes of the VCV isolate H1 (GenBank accession nos. LC602838-39) with 99% and 96% coverage respectively. To further confirm the infection of VCV, we designed two pairs of primers VCV-RP1a/1b (5'- TGGTCGAGAAGTTACTATACTCG -3'/5'- AGACCACAATATTGCTTTGGCTC -3') and VCV-CP1a/1b (5'-TTACGAAGTCCGCACTATTGC-3'/5'- AGCATACGGATAGCTCCTGAC-3'), which were to amplify the 297-bp and 279-bp fragments in the RdRp and CP gene encoded by RNA1 and RNA2 genomes of VCV respectively. The amplified PCR products were cloned and sequenced and the two sequences (OM460075-76) showed 93% and 91% nt identity with the genomic segments of the VCV isolate H1 respectively. The graft transmissibility of VCV was assessed in July 2021 by grafting the VCV-infected grapevine buds onto 2-year-old VCV-free 'Beta'grapevine seedlings with four replicates, the leaves of the first bud below the grafting site behaved chlorotic mottling symptoms (Figure S2) and tested positive for VCV two months after grafting. To further determine the incidence and distribution of VCV in China, 470 grapevine samples of 71 cultivars were collected from 21 provinces and tested by RT-PCR using primers VCV-RP1a/1b and VCV-CP1a/1b. The results showed that 2.6% (12/470) of the samples tested positive with both primers, including 10 'Jinhuanghou' grapevines (Jilin province), 1 'Zuoyouhong' (Jilin province) and 1 'Куртсет' grapevine (Liaoning province). This is the second report of VCV in the world, and confirm the graft transmissibility of VCV for the first time. Given the VCV infectivity in the two important cultivars in Jilin province and strong graft transmissibility, it is necessary to further study its pathogenicity and its effect on grapes. Unveiling the presence of VCV in China contributes to understanding the occurrence of the virus and developing management measures should they become necessary.

A Microcolumn DC Graphene Sensor for Rapid, Sensitive, and Universal Chemical Vapor Detection.

Nearly all existing direct current (DC) chemical vapor sensing methodologies are based on charge transfer between sensor and adsorbed molecules. However, the high binding energy at the charge-trapped sites, which is critical for high sensitivity, significantly slows sensors' responses and makes the detection of nonpolar molecules difficult. Herein, by exploiting the incomplete screening effect of graphene, we demonstrate a DC graphene electronic sensor for rapid (subsecond) and sensitive (ppb) detection of a broad range of vapor analytes, including polar, nonpolar, organic, and inorganic molecules. Molecular adsorption induced capacitance change in the graphene transistor is revealed to be the main sensing mechanism. A novel sensor design, which integrates a centimeter-scale graphene transistor and a microfabricated flow column, is pioneered to enhance the fringing capacitive gating effect. Our work provides an avenue for a broad spectrum real-time gas sensing technology and serves as an ideal testbed for probing molecular physisorption on graphene.

Genetic diversity analysis of grapevine rupestris stem pitting-associated virus from grapevine by colony PCR-SSCP and -RFLP.

We have developed methods for detecting the genetic diversity of grapevine rupestris stem pitting-associated virus (GRSPaV) based on restriction fragment length polymorphism (RFLP) and single stranded conformational polymorphism (SSCP) in the 905 nt 3' sequence. The amplicons were cloned from six grapevine cultivars, and colony polymerase chain reaction (colony PCR) using recombination bacteria was subsequently analyzed by RFLP and SSCP. Four haplotypes of SSCP and six haplotypes of Sac I RFLPs were defined. The two methods had a 40% discrepancy rate in showing the degree of diversity. All clones were sequenced and were used to construct a phylogenetic tree with seven previously reported GRSPaV sequences. In the tree, all the newly acquired sequences were divided into three clusters, I, II, and III, which corresponded to haplotypes I, II, and III of SSCP, respectively. Haplotype IV of SSCP was grouped into cluster II. A recombination analysis showed that haplotype IV has undergone a recombination event. Together, these results indicate that the SSCP assay is useful for the rapid identification of genetic diversity of GRSPaV. This is the first report of an analysis of the large fragment of GRSPaV by colony PCR-SSCP. Keywords: grapevine; grapevine rupestris stem pitting-associated virus (GRSPaV); RFLP; SSCP; genetic diversity analysis.